CN101724568A - Trichoderma asperellum and application thereof in synthesizing (R)-[3,5-dual (trifluoromethyl) phenyl] ethanol - Google Patents

Trichoderma asperellum and application thereof in synthesizing (R)-[3,5-dual (trifluoromethyl) phenyl] ethanol Download PDF

Info

Publication number
CN101724568A
CN101724568A CN200910155775A CN200910155775A CN101724568A CN 101724568 A CN101724568 A CN 101724568A CN 200910155775 A CN200910155775 A CN 200910155775A CN 200910155775 A CN200910155775 A CN 200910155775A CN 101724568 A CN101724568 A CN 101724568A
Authority
CN
China
Prior art keywords
trifluoromethyl
phenyl
ethanol
trichoderma asperellum
zjph0810
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN200910155775A
Other languages
Chinese (zh)
Other versions
CN101724568B (en
Inventor
王普
何军邀
唐俊
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Zhejiang University of Technology ZJUT
Original Assignee
Zhejiang University of Technology ZJUT
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Zhejiang University of Technology ZJUT filed Critical Zhejiang University of Technology ZJUT
Priority to CN2009101557755A priority Critical patent/CN101724568B/en
Publication of CN101724568A publication Critical patent/CN101724568A/en
Application granted granted Critical
Publication of CN101724568B publication Critical patent/CN101724568B/en
Expired - Fee Related legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Abstract

The invention provides a new strain-Trichoderma asperellum ZJPH0810, and an application thereof in microbial catalysis asymmetric synthesis of (R)-[3,5-dual (trifluoromethyl) phenyl] ethanol. The Trichoderma asperellum ZJPH0810 is preserved in the CCTCC, the address is Wuhan University, Wuhan Province, China, 430072 with the preservation date of 16th, December, 2009 and the preservation number of CCTCC No: M209307. The strain of the invention is used for the microbial asymmetric reduction of 1-[3,5-dual (trifluoromethyl) phenyl] ethanol to prepare the (R)-[3,5-dual (trifluoromethyl) phenyl] ethanol which has the advantages of high stereoselectivity, high optical purity and the like. When substrate concentration reaches 80 mmol/ L, yield can reach 53.4%. The invention screens and obtains new microbe strains different from the existing similar research reports, and can obtain the yield of (R)-[3,5-dual (trifluoromethyl) phenyl] ethanol product, which is higher than the yield reported by the document under the same substrate concentration, so that the invention provides a beneficial reference on the aspect of preparing the key chiral intermediates of Emend drugs with a microbiological method.

Description

Trichoderma asperellum and the application in the ethanol of synthetic (R)-[3, two (trifluoromethyl) phenyl of 5-]
(1) technical field
The invention belongs to the biocatalysis technology field, relate to the new bacterial classification of a strain---trichoderma asperellum (Trichoderma asperellum) ZJPH0810, and the application in microorganism catalysis asymmetric synthesis (R)-[3, two (trifluoromethyl) phenyl of 5-] ethanol.
(2) background technology
The chiral alcohol that contains aromatic base is the crucial chiral intermediate of multiple chiral drug synthetic.Aprepitant (Aprepitant), trade(brand)name: Emend
Figure G2009101557755D00011
, chemical name: 5-[[(2R, 3S)-2-[(1R)-1-[3,5-two (trifluoromethyl) phenyl] oxyethyl group]-3-(4-fluorophenyl)-4-morpholinyl-] methyl]-1,2-dihydro-3H-1,2,4-triazole-3-ketone group.Food and drug administration (FDA) approval aprepitant in 2003 be used for highly causing tell due to the chemotherapy regimen feel sick, the medicine of vomiting, it is the anti-emetic thing-nk 1 receptor antagonist of a new mechanism.The nk 1 receptor antagonist to various cause to tell to stimulate have widely the town and tell effect, and effect is outstanding in the vomiting of tardy property.Aprepitant is at present unique clinical nk 1 receptor antagonist that is applied to.In addition, aprepitant also has the effect of treatment depression and other mental disorderes.Aprepitant and 5-HT 3Receptor antagonist, dexamethasone share and are listed in height and cause the standard drug treatment plan of telling chemotherapy and tardive vomiting.At present, aprepitant is considered to one of antiemetic after the best chemotherapy of effect.(R)-[3,5-two (trifluoromethyl) phenyl] ethanol is the crucial chiral intermediate of aprepitant synthetic, obtains the 1-[3 of enantiomer-pure, two (trifluoromethyl) phenyl of 5-] ethanol is one of committed step of synthetic aprepitant.
Adopt traditional chemical method preparation (R)-[3, two (trifluoromethyl) phenyl of 5-] ethanol, need to use expensive metal catalyst,, and can pollute environment as rhodium, ruthenium etc.Utilize biological process preparation (R)-[3, two (trifluoromethyl) phenyl of 5-] ethanol to have reaction conditions gentleness, stereoselectivity height, advantages of environment protection.
At present, the biological process catalysis of bibliographical information is synthesized (R)-[3,5-two (trifluoromethyl) phenyl] ethanol and is mainly contained following several:
(the Microbial and homogenousasymmetric catalysis in the reduction of 1-[3 such as Gelo-Puji of France Rhodia Ltd, 5-bis (trifluoromethyl) phenyl] ethanone[J] .Tetrahedron:Asymmetry, 2006,17:2000-2005) employing Kai Feier Bacterium lacticum (Lactobacillus kefir) and aspergillus niger (Aspergillusniger) reducible [3 have been reported, two (trifluoromethyl) phenyl of 5-] ethyl ketone obtains (R)-[3, two (trifluoromethyl) phenyl of 5-] ethanol, wherein transform [3 with Kai Feier Bacterium lacticum (Lactobacillus kefir), two (trifluoromethyl) phenyl of 5-] during ethyl ketone, the substrate starting point concentration is 5mmol/L, the productive rate that reacted 16 hours is 100%, and the ee value is greater than 99%; When concentration of substrate is brought up to 50mmol/L, react that productive rate only is 13% after 16 hours; When concentration of substrate increased to 200mmol/L, the productive rate that reacted 16 hours was 2%, prolong reaction times to 96 hour after, productive rate is 31%.Because of this bacterial classification only could obtain higher productive rate when concentration of substrate is on the low side, be not suitable for industrial applications.
(Efficient Synthesis of (1R)-[3 such as India Vankawala; 5-Bis (trifluoromethyl) phenyl] Ethanol; a Key Intermediate forAprepitant; an NK-1 Receptor Antagonist[J] .Synthetic Communications; 2007; 37:3439-3446) reported with racemic [3; two (trifluoromethyl) phenyl of 5-] ethanol is substrate; the ethene acetic ester is as acyl acceptor; by antarctic candidia lipase (Candidaantarctica lipase-B; CAL-B) catalysis (R)-[3; two (trifluoromethyl) phenyl of 5-] ethanol generates (R)-[3, two (trifluoromethyl) phenyl of 5-] ethyl acetate, and the S-type alcohol in the racemic modification does not react; then use hydrochloric acid hydrolysis (R)-[3 again; two (trifluoromethyl) phenyl of 5-] ethyl acetate can obtain (R)-[3, two (trifluoromethyl) phenyl of 5-] ethanol, and productive rate is 84%; the ee value is greater than 99%, and reaction formula is as follows:
Figure G2009101557755D00031
(3) summary of the invention
The object of the invention provides the new bacterial classification of a strain---trichoderma asperellum (Trichodermaasperellum) ZJPH0810, and the application in microorganism catalysis asymmetric synthesis (R)-[3, two (trifluoromethyl) phenyl of 5-] ethanol.
The technical solution used in the present invention is:
Trichoderma asperellum (Trichoderma asperellum) ZJPH0810, be preserved in Chinese typical culture collection center (CCTCC), the address: Chinese Wuhan Wuhan University, 430072, preservation date: on December 16th, 2009, deposit number: CCTCC NO:M 209307.
The bacterial classification source: trichoderma asperellum ZJPH0810 is that separation screening obtains from the soil sample of picking up from Hangzhou Zhejiang Polytechnical University campus (morning sunlight school district).Screening through following flow process obtains the purpose bacterial strain.
Soil sample collection → flat board cultivation → strain separating → slant culture → seed culture → fermentation culture → bioconversion reaction → gas chromatographic detection product → acquisition purpose bacterial strain
The feature of this new bacterial strain is as follows:
Colonial morphology: on the PDA flat board bacterium colony just be white in color velvet-like, densification, circle, to expansion all around, the closely knit product spore of the mycelia district of colyliform appears in the later stage, and color is green to deep green, the zone of growth of periphery of bacterial colonies adularescent mycelia, last whole bacterium colony all becomes green.
Cellular form: conidiophore has barrier film, and vertically to branch estranged, carefully cut at the caulody tip, and is little curved, and most advanced and sophisticated living spore ball estranged contains 4～12 in spore; Conidium is colourless, and is spherical to avette, 2.5～4.5 * 2～4 μ m.
Physiological and biochemical property is shown in Table 1:
Table 1: (in the table :-expression is negative for trichoderma asperellum ZJPH0810 physiological and biochemical property; + expression is positive)
Biochemical title English Qualification result Biochemical title English Qualification result
Alpha-cyclodextri ??α-Cyclodextrin ??+ Dextrin ??Dextrin ??+
Mannosans ??Mannosan ??+ Polysorbate40 ??Tween40 ??-
Tween 80 ??Tween?80 ??+ N-acetyl-β-D-mannosamine ??N-Acetyl-β-D-??Mannosamine ??+
Amygdaloside ??Amygdalin ??+ The D-arabitol ??D-Arabitol ??-
Arbutin ??Arbutin ??+ The D-cellobiose ??D-Cellobiose ??+
The L-trehalose ??L-Fucose ??- Gentiobiose ??Gentiobiose ??+
Gluconic acid ??Gluconic?Acid ??- Alpha-D-glucose ??α-D-Glucose ??-
α-D-lactose ??α-D-Lactose ??+ Maltose ??Maltose ??-
Trisaccharide maltose ??Maltotriose ??+ D-N.F,USP MANNITOL ??D-Mannitol ??+
Alpha-Methyl-D-galactoside ??α-Methyl-D-??Galactoside ??- The D-psicose ??D-Psicose ??-
Biochemical title English Qualification result Biochemical title English Qualification result
Alpha-Methyl-D-glucoside ??α-Methyl-D-??Glucoside ??+ Beta-methyl-D-glucoside ??β-Methyl-D-??Glucoside ??+
Saligenin ??Salicin ??+ The D-tagatose ??D-Tagatose ??+
The D-trehalose ??D-Fucose ??+ α-hydroxybutyric acid ??α-Hydroxybut??yricAcid ??+
γ-hydroxybutyric acid ??γ-Hydroxybutyri??cAcid ??+ α-oxopentanoic acid ??α-Oxopentanoi??cAcid ??+
N-acetyl-L-L-glutamic acid ??N-Acetyl-L-??Glutamic?Acid ??+ The lactic acid single ethanol amide ??Lactic????Acid??Monoethanola??mide ??+
Putrescine ??Putrescine ??+ The L-Pyrrolidonecarboxylic acid ??L-Pyroglutami??cAcid ??+
2, the 3-butyleneglycol ??2，3-Butanediol ??+ Glycerine ??Glycerin ??+
Inosine ??Carnine ??+ The D-sorbyl alcohol ??D-Sorbitol ??-
Biochemical title English Qualification result Biochemical title English Qualification result
Wood (four) sugar ??Stachyose ??- α-Tong Wuersuan ??αKetoglutaric??Acid ??-
The D-methyl lactate ??D-Lactic?Acid??Methyl?Ester ??- L-lactic acid ??L-Lactic?Acid ??-
The D-oxysuccinic acid ??D-Malic?Acid ??- L MALIC ACID ??L-Malic?Acid ??-
Pyruvic Acid Methyl ester ??Methyl?Pyruvate ??- The mono succinate methyl ester ??Mono-Methyl??Succinate ??-
L-propylamine acid amides ??L-Alaninamide ??- The D-L-Ala ??D-Lactamine ??-
L-alanyl-glycine ??L-Alanyl-??Glycine - The L-Serine ??L-Serine -
Thymidine ??Adenosine - 5 '-phosphoric acid uridine ??5’-Uridine??Monophosphat??e -
1-phosphoric acid-alpha-D-glucose ??1-Phosphate??-α-D-Glucose - D-L-alpha-phosphate glycerine ??D-L-α-Glycero??l?Phosphate -
The ITS sequence characteristic of bacterial classification: utilize the evaluation fungi that pcr amplification fungi rrna ITS (InternalTranscribedSpacer) constant gene segment C can be quick, accurate, easy.Adopt universal primer ITS1 and ITS4,, produce the dna fragmentation that size is 602bp, above-mentioned pcr amplification product has been carried out sequencing the ITS district of ZJPH0810 bacterial strain rDNA increasing.After measured, fungi rrna ITS (InternalTranscribed Spacer) gene order of described trichoderma asperellum ZJPH0810 bacterial strain is as follows:
TCCGTAGGTGAACCTGCGGAGGGATCATTACCGAGTTTACAACTCCCAAACCCAATGTGAACGTTACCAAACTGTTGCCTCGGCGGGGTCACGCCCCGGGTGCGTCGCAGCCCCGGAACCAGGCGCCCGCCGGAGGAACCAACCAAACTCTTTCTGTAGTCCCCTCGCGGACGTATTTCTTACAGCTCTGAGCAAAAATTCAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCCCTCCGGGGGATCGGCGTTGGGGATCGGGACCCCTCACACGGGTGCCGGCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCCTGCGCAGTAGTTTGCACAACTCGCACCGGGAGCGCGGCGCGTCCACGTCCGTAAAACACCCAACTTTCTGAAATGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA。
This sequence has been submitted GenBank (the GenBank accession number is No.GU318216) to.
(http://www.ncbi.nlm.nih.gov) carries out homology comparison (BLAST) in the NCBI website with the ITS sequence of ZJPH0810 bacterial strain, finds that the part bacterial strain sequence homology of ZJPH0810 bacterial strain and trichoderma (Tsukamurella) is higher.Bacterial strain ZJPH0810 and Trichoderma asperellum CPK2722 (GenBank accession number: NO.FJ412053, sequence homology 100%/596bp, based on the ITS sequence), Trichodermaasperellum CPK2724 (GenBank accession number: NO.FJ412054, sequence homology 100%/591bp, based on the ITS sequence), Trichoderma asperellum GJS 99-6 (GenBank accession number: NO.DQ109538, sequence homology 100%/576bp is based on the ITS sequence) Phylogenetic Relationships nearest.
According to physiological and biochemical property and binding molecule biological assay, this bacterial classification is accredited as trichoderma asperellum (Trichoderma asperellum).
By the response surface experimental design, obtain the preferable substratum of this bacterial strain and consist of: glucose 20.0～25.0g/L, peptone 20.0～27.5g/L, (NH 4) 2SO 43.0～4.0g/L, KH 2PO 41.0～2.0g/L, MgSO 40.5～1.25g/L, ZnSO 47H 2O 0.008～0.02g/L.
The shake-flask culture condition is: initial pH4.0～7.5, shake bottled liquid measure 20%～40%, 30 ℃ of culture temperature, shaking speed 180～240r/min, inoculum size 1%～13%, incubation time 17～24 hours.
ZJPH0810 bacterial strain involved in the present invention obtains by following program screening:
1) the dull and stereotyped cultivation: get the 1g soil sample and be diluted to 10 respectively -3With 10 -4, get 1 μ L inoculation with substrate 1-[3, two (trifluoromethyl) phenyl of 5-] and ethyl ketone is the plate culture medium of sole carbon source, cultivates 7d for 30 ℃, the slant medium of picking list bacterium colony switching afterwards.The plate culture medium prescription is as follows: 1-[3, two (trifluoromethyl) phenyl of 5-] ethyl ketone 60mmol/L, (NH 4) 2SO 42g/L, KH 2PO 42g/L, NaCl 1g/L, MgSO 47H 2O 0.2g/L, agar 20g/L, with the distilled water preparation, pH 6.0.
2) slant culture (PDA substratum): potato 200g/L, glucose 20g/L, agar 20g/L.Cultivate 2～3d for 30 ℃, 4 ℃ of refrigerators are preserved.
3) seed culture: will cultivate sophisticated slant strains and insert the 250mL that the 75mL seed culture medium is housed and shake in the bottle, 30 ℃, 200r/min cultivated 16～24 hours.The seed culture based formulas is as follows: glucose 25g/L, peptone 27.5g/L, (NH 4) 2SO 43g/L, KH 2PO 41g/L, MgSO 41.25g/L, ZnSO 47H 2O 0.008g/L, the distilled water preparation, pH 6.0.
4) fermentation culture: the inoculum size with 5%～10% is inoculated into the 250mL that the 70mL fermention medium is housed with seed liquor and shakes in the bottle, and 30 ℃, 200r/min cultivated 18～48 hours.Fermentative medium formula is as follows: glucose 25g/L, peptone 27.5g/L, (NH 4) 2SO 43g/L, KH 2PO 41g/L, MgSO 41.25g/L, ZnSO 47H 2O 0.008g/L, the tap water preparation, pH 6.0.
5) bioconversion reaction: the centrifugal wet mycelium that obtains is suspended in the phosphate buffered saline buffer, adds a certain amount of [3, two (trifluoromethyl) phenyl of 5-] ethyl ketone substrate and glucose, place 30 ℃ of reactions of shaking table certain hour.After reaction finishes, the reaction solution ethyl acetate extraction, the centrifugal supernatant liquor that obtains adopts gas chromatographic analysis.
6) analyzing and testing:
The product in the reaction, extraction liquid and the concentration of residual substrate adopt gas chromatographic analysis, use inner mark method ration.Internal standard substance is a dodecane.Getting the 1mL extraction liquid adds 2 μ L dodecanes and analyzes.GC conditions: adopt day island proper Tianjin GC-2014 gas chromatograph, chiral chromatographic column CP-Chirasil-Dex CB (25m * 0.25mm * 0.25 μ m), detector is FID, 250 ℃ of sampler temperature, 250 ℃ of detector temperatures, column temperature keeps 2min for 80 ℃, be warming up to 180 ℃ with 4～8 ℃/min and keep 10min, carrier gas is a nitrogen, flow is 1.5～2.0mL/min, splitting ratio 1: 15～1: 20, and sample size is 1 μ L, the standard substance gas chromatogram is seen Fig. 1, and trichoderma asperellum ZJPH0810 bacterial strain biological reducing reaction, extraction liquid gas chromatogram is seen Fig. 2.
Calculate the substrate in the reaction solution and the concentration of product respectively with relative correction factor.And then obtain the productive rate (Yield) of reaction.Calculating formula is:
Productive rate=C i/ C 0* 100%
C in the formula 0, C iThe volumetric molar concentration of product when being respectively the volumetric molar concentration of the initial substrate of reaction and reacting end.
(enantiomeric excess ee) represents the optical purity of product by enantiomeric excess value.
Definition is:
ee = C R - C S C R + C S × 100 %
C in the formula RAnd C SBe respectively R type and S type 3,5-dual-trifluoromethyl benzene alcoholic acid volumetric molar concentration.
The invention still further relates to the application of described trichoderma asperellum ZJPH0810 in microorganism catalysis asymmetric synthesis (R)-[3, two (trifluoromethyl) phenyl of 5-] ethanol.
Concrete, described being applied as: cultivating the wet mycelium that obtains with trichoderma asperellum ZJPH0810 is the enzyme source, with 1-[3, two (trifluoromethyl) phenyl of 5-] ethyl ketone is substrate, 30 ℃, carry out conversion reaction 10～45 hours in the transformation system of pH 4.0～8.0, reaction solution obtains described (R)-[3, two (trifluoromethyl) phenyl of 5-] ethanol through separation and purification.Described separation and purification can be carried out according to a conventional method.
In the described transformation system, the starting point concentration of substrate [3, two (trifluoromethyl) phenyl of 5-] ethyl ketone is 10～150mmol/L damping fluid, and the wet mycelium input amount of trichoderma asperellum ZJPH0810 is counted 35～70g/L damping fluid with mycelium dry weight.
For improving reaction efficiency, also can add cosubstrate in the described transformation system, described cosubstrate is one of following: 1. glucose, 2. sucrose, 3. maltose, 4. glycerine, 5. methyl alcohol, 6. ethanol, 7. propyl carbinol.When cosubstrate was glucose, sucrose or maltose, add-on was 10～100g/L damping fluid, and when cosubstrate was methyl alcohol, ethanol or propyl carbinol, adding volume was 2～10% of damping fluid volume.Preferably, described being reflected at when being cosubstrate with ethanol, the optical purity and the productive rate of products therefrom are the highest.
Preferably, described conversion reaction is carried out in the phosphate buffered saline buffer of pH 5.7～8.0.Perhaps, described conversion reaction is carried out in the SODIUM PHOSPHATE, MONOBASIC-citrate buffer solution of pH4.0～6.0.
Described wet mycelium is prepared by following method: ZJPH0810 is seeded to fermention medium with trichoderma asperellum, 30～35 ℃, 180～240r/min shaking culture 17～24 hours, and centrifugal, the washing precipitation of fermented liquid is collected and is obtained wet mycelium; Described fermention medium final concentration is composed as follows: glucose 20.0～25.0g/L, peptone 20.0～27.5g/L, (NH 4) 2SO 43.0～4.0g/L, KH 2PO 41.0～2.0g/L, MgSO 40.5～1.25g/L, ZnSO 47H 2O 0.008～0.02g/L, pH 4.0～7.5.
Concrete, described method is as follows:
(1) trichoderma asperellum ZJPH0810 is seeded to fermention medium, 30 ℃, 180～240r/min shaking culture 21 hours, centrifugal, the washing precipitation of fermented liquid is collected and is obtained wet mycelium;
Described fermention medium final concentration is composed as follows: glucose 25g/L, peptone 27.5g/L, (NH 4) 2SO 43g/L, KH 2PO 41g/L, MgSO 41.25g/L, ZnSO 47H 2O0.008g/L, pH 4.0～7.5;
(2) get the phosphoric acid buffer of 20mM pH5.7, add step (1) gained wet mycelium, wet mycelium is 50g/L with the dry weight concentrations, add substrate 1-[3, two (trifluoromethyl) phenyl of 5-] ethyl ketone to concentration of substrate is 50mmol/L, and to add volume be that the ethanol of damping fluid volume 6.5% is as cosubstrate, 30 ℃ of shaking table oscillatory reactions 30 hours, reaction is centrifugal with reaction solution after finishing, get supernatant liquor, add equal volume of ethyl acetate twice, obtain (R)-[3, two (trifluoromethyl) phenyl of 5-] ethanol.
Beneficial effect of the present invention is mainly reflected in: provide a strain to can be used for biological asymmetric reduction 1-[3, two (trifluoromethyl) phenyl of 5-] ethyl ketone preparation (R)-[3, two (trifluoromethyl) phenyl of 5-] alcoholic acid microorganism novel bacterial, it is good to have stereoselectivity, product optical purity advantages of higher.When concentration of substrate was 80mmol/L, productive rate reached as high as 53.4%.The present invention screens from soil sample and has obtained to report different microorganism novel bacterials with similar research in the past, and can under identical concentration of substrate, obtain to be higher than (R)-[3 of bibliographical information, two (trifluoromethyl) phenyl of 5-] productive rate of ethanol product, provide beneficial reference thereby prepare aspect the crucial chiral intermediate of aprepitant medicine at the research microbial method.
(4) description of drawings
Fig. 1 is the standard substance gas chromatogram;
Fig. 2 is a trichoderma asperellum ZJPH0810 bacterial strain biological reducing reaction, extraction liquid gas chromatogram.
(5) embodiment
The present invention is described further below in conjunction with specific embodiment, but protection scope of the present invention is not limited in this:
Embodiment 1: the acquisition of wet mycelium
The seed culture based formulas is as follows: glucose 25g/L, peptone 27.5g/L, (NH 4) 2SO 43g/L, KH 2PO 41g/L, MgSO 41.25g/L, ZnSO 47H 2O 0.008g/L, the distilled water preparation, pH 6.0.
Fermentative medium formula adopts the tap water preparation with the seed substratum;
The sophisticated slant strains of cultivation is inserted the 250mL that the 70mL seed culture medium is housed shakes in the bottle, 30 ℃, 200r/min cultivated 19 hours, with the inoculum size of volume ratio 5% seed liquor was transferred to the 250mL that the 70mL fermention medium is housed again and shook in the bottle, 30 ℃, 200r/min cultivated 21 hours.It is centrifugal to cultivate end secondary fermentation liquid, and with the phosphoric acid buffer washing, collects wet mycelium, standby.
Embodiment 2: the detection method of production concentration
After bioconversion reaction finished, reaction solution extracted with isopyknic ethyl acetate (10mL), and the concentration of product in the extraction liquid and unreacted substrate adopts gas chromatographic analysis, uses inner mark method ration.Internal standard substance is a dodecane.Getting the 1mL extraction liquid adds 2 μ L dodecanes and analyzes.Gas-chromatography concrete operations condition is: 250 ℃ of sampler temperature, and 250 ℃ of detector temperatures, column temperature keeps 2min for 80 ℃, is warming up to 180 ℃ with 4 ℃/min and keeps 10min, and carrier gas is a nitrogen, and flow is 1.5mL/min, splitting ratio 1: 20, sample size is 1 μ L.Spectrogram according to gas-chromatography obtains calculates the concentration of product in the reaction solution with the relative correction factor method, and then calculates the ee value of productive rate (Yield) and product.
Embodiment 3:
The wet mycelium of embodiment 1 gained is suspended in the 10mL phosphate buffered saline buffer (pH5.7), and wet mycelium is 35g/L with dry weight basis concentration; Ethyl ketone is as substrate in [3, two (trifluoromethyl) phenyl of 5-] of adding 10mmol/L, and the glucose that adds 50g/L again places 30 ℃ as cosubstrate, reacts 10h in the shaking table of 200r/min.Adopt the detection method of embodiment 2, product (R)-[3, two (trifluoromethyl) phenyl of 5-] concentration of ethanol is 4.2mmol/L, optical purity ee value 94.7%, productive rate 42.2% (trichoderma asperellum ZJPH0810 bacterial strain biological reducing reaction, extraction liquid gas chromatogram is seen Fig. 2).
Embodiment 4:
The wet mycelium of embodiment 1 gained is suspended in the 10mL phosphate buffered saline buffer (pH5.7), and wet mycelium is 50g/L with dry weight basis concentration; The 1-[3 that adds 50mmol/L, two (trifluoromethyl) phenyl of 5-] ethyl ketone is as substrate, and the maltose that adds 50g/L again places 30 ℃ as cosubstrate, reacts 31h in the shaking table of 200r/min.Adopt the detection method of embodiment 2, product (R)-[3, two (trifluoromethyl) phenyl of 5-] concentration of ethanol is 26.2mmol/L, optical purity ee value 96.1%, productive rate 524%.
Embodiment 5:
The wet thallus of embodiment 1 gained is suspended in the 10mL phosphate buffered saline buffer (pH5.7), and wet mycelium is 50g/L with dry weight basis concentration; The 1-[3 that adds 80mmol/L, two (trifluoromethyl) phenyl of 5-] ethyl ketone is as substrate, and the sucrose that adds 50g/L again places 30 ℃ as cosubstrate, reacts 45h in the shaking table of 200r/min.Adopt the detection method of embodiment 2, product (R)-[3, two (trifluoromethyl) phenyl of 5-] concentration of ethanol is 42.7mmol/L, optical purity ee value 96.6%, productive rate 53.4%.
Embodiment 6:
The wet thallus of embodiment 1 gained is suspended in the 10mL phosphate buffered saline buffer (pH6.0), and wet mycelium is 50g/L with dry weight basis concentration; The 1-[3 that adds 50mmol/L, two (trifluoromethyl) phenyl of 5-] ethyl ketone is as substrate, and the glucose that adds 50g/L again places 30 ℃ as cosubstrate, reacts 36h in the shaking table of 200r/min.Adopt the detection method of embodiment 2, product (R)-[3, two (trifluoromethyl) phenyl of 5-] concentration of ethanol is 21.0mmol/L, optical purity ee value 96.2%, productive rate 42.0%.
Embodiment 7:
The wet thallus of embodiment 1 gained is suspended in the 10mL phosphate buffered saline buffer (pH5.7), and wet mycelium is 50g/L with dry weight basis concentration; The 1-[3 that adds 50mmol/L, two (trifluoromethyl) phenyl of 5-] ethyl ketone is as substrate, and the glucose that adds 50g/L again places 30 ℃ as cosubstrate, reacts 32h in the shaking table of 200r/min.Adopt the detection method of embodiment 2, product (R)-[3, two (trifluoromethyl) phenyl of 5-] concentration of ethanol is 29.1mmol/L, optical purity ee value 96.2%, productive rate 58.2%.
Embodiment 8:
The wet thallus of embodiment 1 gained is suspended in the 10mL phosphate buffered saline buffer (pH5.7), and wet mycelium is 50g/L with dry weight basis concentration; The 1-[3 that adds 50mmol/L, two (trifluoromethyl) phenyl of 5-] ethyl ketone is as substrate, and the sucrose that adds 50g/L again places 30 ℃ as cosubstrate, reacts 32h in the shaking table of 200r/min.Adopt the detection method of embodiment 2, product (R)-[3, two (trifluoromethyl) phenyl of 5-] concentration of ethanol is 25.0mmol/L, optical purity ee value 96.4%, productive rate 50.0%.
Embodiment 9:
The wet thallus of embodiment 1 gained is suspended in the 10mL phosphate buffered saline buffer (pH5.7), and wet mycelium is 50g/L with dry weight basis concentration; The 1-[3 that adds 50mmol/L, two (trifluoromethyl) phenyl of 5-] ethyl ketone is as substrate, and (6.5%, methyl alcohol v/v) places 30 ℃ as cosubstrate, reacts 32h in the shaking table of 200r/min to add 0.65mL again.Adopt the detection method of embodiment 2, product (R)-[3, two (trifluoromethyl) phenyl of 5-] concentration of ethanol is 23.2mmol/L, optical purity ee value 97.5%, productive rate 46.4%.
Embodiment 10:
The wet thallus of embodiment 1 gained is suspended in the 10mL phosphate buffered saline buffer (pH5.7), and wet mycelium is 50g/L with dry weight basis concentration; The 1-[3 that adds 50mmol/L, two (trifluoromethyl) phenyl of 5-] ethyl ketone is as substrate, and (6.5%, ethanol v/v) places 30 ℃ as cosubstrate, reacts 34h in the shaking table of 200r/min to add 0.65mL again.Adopt the detection method of embodiment 2, product (R)-[3, two (trifluoromethyl) phenyl of 5-] concentration of ethanol is 28.7mmol/L, optical purity ee value 92%, productive rate 57.4%.
Embodiment 11:
The wet thallus of embodiment 1 gained is suspended in the 10mL phosphate buffered saline buffer (pH5.7), and wet mycelium is 50g/L with dry weight basis concentration; The 1-[3 that adds 100mmol/L, two (trifluoromethyl) phenyl of 5-] ethyl ketone is as substrate, and (6.5%, ethanol v/v) places 30 ℃ as cosubstrate, reacts 30h in the shaking table of 200r/min to add 0.65mL again.Adopt the detection method of embodiment 2, product (R)-[3, two (trifluoromethyl) phenyl of 5-] concentration of ethanol is 42.9mmol/L, optical purity ee value 96.2%, productive rate 42.9%.
Embodiment 12:
The wet thallus of embodiment 1 gained is suspended in the 10mL phosphate buffered saline buffer (pH5.7), and wet mycelium is 50g/L with dry weight basis concentration; The 1-[3 that adds 150mmol/L, two (trifluoromethyl) phenyl of 5-] ethyl ketone is as substrate, and (6.5%, ethanol v/v) places 30 ℃ as cosubstrate, reacts 35h in the shaking table of 200r/min to add 0.65mL again.Adopt the detection method of embodiment 2, product (R)-[3, two (trifluoromethyl) phenyl of 5-] concentration of ethanol is 45.9mmol/L, optical purity ee value 97.4%, productive rate 30.6%.
Embodiment 13:
The wet thallus of embodiment 1 gained is suspended in the 10mL phosphate buffered saline buffer (pH5.7), and wet mycelium is 50g/L with dry weight basis concentration; The 1-[3 that adds 80mmol/L, two (trifluoromethyl) phenyl of 5-] ethyl ketone is as substrate, and (6.5%, ethanol v/v) places 30 ℃ as cosubstrate, reacts 34h in the shaking table of 200r/min to add 0.65mL again.Adopt the detection method of embodiment 2, product (R)-[3, two (trifluoromethyl) phenyl of 5-] concentration of ethanol is 34.3mmol/L, optical purity ee value 95.2%, productive rate 42.9%.
Embodiment 14:
The wet thallus of embodiment 1 gained is suspended in 10mL SODIUM PHOSPHATE, MONOBASIC-citrate buffer solution (pH4.0), and wet mycelium is 50g/L with dry weight basis concentration; The 1-[3 that adds 50mmol/L, two (trifluoromethyl) phenyl of 5-] ethyl ketone is as substrate, and (6.5%, ethanol v/v) places 30 ℃ as cosubstrate, reacts 24h in the shaking table of 200r/min to add 0.65mL again.Adopt the detection method of embodiment 2, product (R)-[3, two (trifluoromethyl) phenyl of 5-] concentration of ethanol is 19.1mmol/L, product (R)-[3, two (trifluoromethyl) phenyl of 5-] alcoholic acid optical purity ee value 95.1%, productive rate 38.2%.
Embodiment 15:
The wet thallus of embodiment 1 gained is suspended in 10mL SODIUM PHOSPHATE, MONOBASIC-citrate buffer solution (pH6.0), and wet mycelium is 50g/L with dry weight basis concentration; The 1-[3 that adds 50mmol/L, two (trifluoromethyl) phenyl of 5-] ethyl ketone is as substrate, and (6.5%, ethanol v/v) places 30 ℃ as cosubstrate, reacts 30h in the shaking table of 200r/min to add 0.65mL again.Adopt the detection method of embodiment 2, product (R)-[3, two (trifluoromethyl) phenyl of 5-] concentration of ethanol is 20.1mmol/L, optical purity ee value 95.1%, productive rate 40.2%.
Embodiment 16:
The wet thallus of embodiment 1 gained is suspended in the 10mL phosphate buffered saline buffer (pH8.0), and wet mycelium is 50g/L with dry weight basis concentration; The 1-[3 that adds 50mmol/L, two (trifluoromethyl) phenyl of 5-] ethyl ketone is as substrate, and (6.5%, ethanol v/v) places 30 ℃ as cosubstrate, reacts 45h in the shaking table of 200r/min to add 0.65mL again.Adopt the detection method of embodiment 2, product (R)-[3, two (trifluoromethyl) phenyl of 5-] concentration of ethanol is 15.9mmol/L, product (R)-[3, two (trifluoromethyl) phenyl of 5-] alcoholic acid optical purity ee value 96.2%, productive rate 31.8%.
Embodiment 17:
The wet thallus of embodiment 1 gained is suspended in the 10mL phosphate buffered saline buffer (pH5.7), and wet mycelium is 50g/L with dry weight basis concentration; The 1-[3 that adds 50mmol/L, two (trifluoromethyl) phenyl of 5-] ethyl ketone is as substrate, and (6.5%, ethanol v/v) places 30 ℃ as cosubstrate, reacts 30h in the shaking table of 200r/min to add 0.65mL again.Adopt the detection method of embodiment 2, product (R)-[3, two (trifluoromethyl) phenyl of 5-] concentration of ethanol is 29.7mmol/L, product (R)-[3, two (trifluoromethyl) phenyl of 5-] alcoholic acid optical purity ee value 96.5%, productive rate 59.4%.
SEQUENCE?LISTING
＜110〉Zhejiang Polytechnical University
＜120〉trichoderma asperellum and the application in the ethanol of synthetic (R)-[3, two (trifluoromethyl) phenyl of 5-]
<130>
<160>1
<170>PatentIn?version?3.4
<210>1
<211>602
<2l2>DNA
<213>Trichoderma?asperellum
<400>1
tccgtaggtg?aacctgcgga?gggatcatta?ccgagtttac?aactcccaaa?cccaatgtga??????60
acgttaccaa?actgttgcct?cggcggggtc?acgccccggg?tgcgtcgcag?ccccggaacc?????120
aggcgcccgc?cggaggaacc?aaccaaactc?tttctgtagt?cccctcgcgg?acgtatttct?????180
tacagctctg?agcaaaaatt?caaaatgaat?caaaactttc?aacaacggat?ctcttggttc?????240
tggcatcgat?gaagaacgca?gcgaaatgcg?ataagtaatg?tgaattgcag?aattcagtga?????300
atcatcgaat?ctttgaacgc?acattgcgcc?cgccagtatt?ctggcgggca?tgcctgtccg?????360
agcgtcattt?caaccctcga?acccctccgg?gggatcggcg?ttggggatcg?ggacccctca?????420
cacgggtgcc?ggccccgaaa?tacagtggcg?gtctcgccgc?agcctctcct?gcgcagtagt?????480
ttgcacaact?cgcaccggga?gcgcggcgcg?tccacgtccg?taaaacaccc?aactttctga?????540
aatgttgacc?tcggatcagg?taggaatacc?cgctgaactt?aagcatatca?ataagcggag?????600
ga????????????????????????????????????????????????????????????????????602

Claims (10)

1. trichoderma asperellum (Trichoderma asperellum) ZJPH0810, be preserved in Chinese typical culture collection center (CCTCC), the address: Chinese Wuhan Wuhan University, 430072, preservation date: on December 16th, 2009, deposit number: CCTCC NO:M 209307.
2.1ZJPH0810,ZJPH0810ITS ( Internal Transcribed Spacer ) ：TCCGTAGGTGAACCTGCGGAGGGATCATTACCGAGTTTACAACTCCCAAACCCAATGTGAACGTTACCAAACTGTTGCCTCGGCGGGGTCACGCCCCGGGTGCGTCGCAGCCCCGGAACCAGGCGCCCGCCGGAGGAACCAACCAAACTCTTTCTGTAGTCCCCTCGCGGACGTATTTCTTACAGCTCTGAGCAAAAATTCAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCCCTCCGGGGGATCGGCGTTGGGGATCGGGACCCCTCACACGGGTGCCGGCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCCTGCGCAGTAGTTTGCACAACTCGCACCGGGAGCGCGGCGCGTCCACGTCCGTAAAACACCCAACTTTCTGAAATGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA。
3. the application of trichoderma asperellum ZJPH0810 as claimed in claim 1 in microorganism catalysis asymmetric synthesis (R)-[3, two (trifluoromethyl) phenyl of 5-] ethanol.
4. application as claimed in claim 3, it is characterized in that described being applied as: cultivating the wet mycelium that obtains with trichoderma asperellum ZJPH0810 is the enzyme source, with 1-[3, two (trifluoromethyl) phenyl of 5-] ethyl ketone is substrate, under 30 ℃, carry out conversion reaction 10～45 hours in the transformation system of pH 4.0～8.0, reaction solution obtains described (R)-[3, two (trifluoromethyl) phenyl of 5-] ethanol through separation and purification.
5. application as claimed in claim 4, it is characterized in that in the described transformation system, the starting point concentration of substrate [3, two (trifluoromethyl) phenyl of 5-] ethyl ketone is 10～150mmol/L, and the wet mycelium input amount of trichoderma asperellum ZJPH0810 is counted 35～70g/L with mycelium dry weight.
6. as claim 4 or 5 described application, it is characterized in that also being added with in the described transformation system cosubstrate, described cosubstrate is one of following: 1. glucose, 2. sucrose, 3. maltose, 4. glycerine, 5. methyl alcohol, 6. ethanol, 7. propyl carbinol, when cosubstrate is glucose, sucrose or maltose, add-on is 10～100g/L damping fluid, when cosubstrate was methyl alcohol, ethanol or propyl carbinol, adding volume was 2～10% of damping fluid volume.
7. as claim 4 or 5 described application, it is characterized in that described conversion reaction carries out in the phosphate buffered saline buffer of pH 5.7～8.0.
8. as claim 4 or 5 described application, it is characterized in that described conversion reaction carries out in the SODIUM PHOSPHATE, MONOBASIC-citrate buffer solution of pH4.0～6.0.
9. as claim 4 or 5 described application, it is characterized in that described wet mycelium is prepared by following method: ZJPH0810 is seeded to fermention medium with trichoderma asperellum, 30～35 ℃, 180～240r/min shaking culture 17～24 hours, centrifugal, the washing precipitation of fermented liquid is collected and is obtained wet mycelium; Described fermention medium final concentration is composed as follows: glucose 20.0～25.0g/L, peptone 20.0～27.5g/L, (NH 4) 2SO 43.0～4.0g/L, KH 2PO 41.0～2.0g/L, MgSO 40.5～1.25g/L, ZnSO 47H 2O 0.008～0.02g/L, pH 4.0～7.5.
10. method as claimed in claim 4 is characterized in that described method is as follows:
(1) trichoderma asperellum ZJPH0810 is seeded to fermention medium, 30 ℃, 180～240r/min shaking culture 21 hours, centrifugal, the washing precipitation of fermented liquid is collected and is obtained wet mycelium;
Described fermention medium final concentration is composed as follows: glucose 25g/L, peptone 27.5g/L, (NH 4) 2SO 43g/L, KH 2PO 41g/L, MgSO 41.25g/L, ZnSO 47H 2O0.008g/L, pH 4.0～7.5;
(2) get the phosphoric acid buffer of 20mM pH 5.7, add step (1) gained wet mycelium, wet mycelium is 50g/L with dry weight basis concentration, add substrate 1-[3, two (trifluoromethyl) phenyl of 5-] ethyl ketone to concentration of substrate is 50mmol/L, and to add volume be that the ethanol of damping fluid volume 6.5% is as cosubstrate, 30 ℃ of shaking table oscillatory reactions 30 hours, reaction is centrifugal with reaction solution after finishing, get supernatant liquor, add equal volume of ethyl acetate twice, obtain (R)-[3, two (trifluoromethyl) phenyl of 5-] ethanol.
CN2009101557755A 2009-12-25 2009-12-25 Trichoderma asperellum and application thereof in synthesizing (R)-[3,5-dual (trifluoromethyl) phenyl] ethanol Expired - Fee Related CN101724568B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN2009101557755A CN101724568B (en) 2009-12-25 2009-12-25 Trichoderma asperellum and application thereof in synthesizing (R)-[3,5-dual (trifluoromethyl) phenyl] ethanol

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN2009101557755A CN101724568B (en) 2009-12-25 2009-12-25 Trichoderma asperellum and application thereof in synthesizing (R)-[3,5-dual (trifluoromethyl) phenyl] ethanol

Publications (2)

Publication Number Publication Date
CN101724568A true CN101724568A (en) 2010-06-09
CN101724568B CN101724568B (en) 2011-08-31

Family

ID=42446123

Family Applications (1)

Application Number Title Priority Date Filing Date
CN2009101557755A Expired - Fee Related CN101724568B (en) 2009-12-25 2009-12-25 Trichoderma asperellum and application thereof in synthesizing (R)-[3,5-dual (trifluoromethyl) phenyl] ethanol

Country Status (1)

Country Link
CN (1) CN101724568B (en)

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101999524A (en) * 2010-10-19 2011-04-06 浙江省农业科学院 Application of Trichderma asperellum in fermentation method for converting and utilizing traditional Chinese medicine residues
CN102102087A (en) * 2010-10-28 2011-06-22 浙江工业大学 Leifsonia xyli and use thereof in preparation of (R)-[3,5-bis(trifluoromethyl)phenyl]ethanol
CN102382780A (en) * 2010-09-03 2012-03-21 中国科学院成都生物研究所 Microbacterium oxydans and method for preparing chiral bis(trifluoromethyl) phenyl ethanol by using same
CN103695480A (en) * 2013-12-31 2014-04-02 浙江工业大学 Method for preparing chiral alcohol by using reaction system containing ionic liquid
CN103709230A (en) * 2013-12-31 2014-04-09 浙江工业大学 Tripeptide eutectic ionic liquid as well as preparation method and application thereof
CN103710393A (en) * 2013-12-31 2014-04-09 浙江工业大学 Method for preparing chiral alcohol by use of small peptides-containing ionic liquid reaction system

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN100376681C (en) * 2006-01-18 2008-03-26 江南大学 Process for preparing (R)-mandelic acid by microbial asymmetric reduction
CN101519674B (en) * 2009-03-02 2011-11-23 浙江工业大学 Method for preparing (S)-1-(3,5-bis(trifluoromethyl)) phenylethanol by microbial transformation

Cited By (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102382780A (en) * 2010-09-03 2012-03-21 中国科学院成都生物研究所 Microbacterium oxydans and method for preparing chiral bis(trifluoromethyl) phenyl ethanol by using same
CN102382780B (en) * 2010-09-03 2013-02-13 中国科学院成都生物研究所 Microbacterium oxydans and method for preparing chiral bis(trifluoromethyl) phenyl ethanol by using same
CN101999524A (en) * 2010-10-19 2011-04-06 浙江省农业科学院 Application of Trichderma asperellum in fermentation method for converting and utilizing traditional Chinese medicine residues
CN101999524B (en) * 2010-10-19 2013-03-13 浙江省农业科学院 Application of Trichderma asperellum in fermentation method for converting and utilizing traditional Chinese medicine residues
CN102102087A (en) * 2010-10-28 2011-06-22 浙江工业大学 Leifsonia xyli and use thereof in preparation of (R)-[3,5-bis(trifluoromethyl)phenyl]ethanol
CN102102087B (en) * 2010-10-28 2012-02-29 浙江工业大学 Leifsonia xyli and use thereof in preparation of (R)-[3,5-bis(trifluoromethyl)phenyl]ethanol
CN103695480A (en) * 2013-12-31 2014-04-02 浙江工业大学 Method for preparing chiral alcohol by using reaction system containing ionic liquid
CN103709230A (en) * 2013-12-31 2014-04-09 浙江工业大学 Tripeptide eutectic ionic liquid as well as preparation method and application thereof
CN103710393A (en) * 2013-12-31 2014-04-09 浙江工业大学 Method for preparing chiral alcohol by use of small peptides-containing ionic liquid reaction system
CN103710393B (en) * 2013-12-31 2016-03-09 浙江工业大学 Utilize the method preparing chiral alcohol containing small peptide class ionic liquid reaction system
CN103709230B (en) * 2013-12-31 2016-05-18 浙江工业大学 A kind of tripeptides class eutectic ionic liquid and preparation method thereof and application
CN103695480B (en) * 2013-12-31 2016-05-18 浙江工业大学 Utilize the method for preparing chiral alcohol containing ionic liquid reaction system

Also Published As

Publication number Publication date
CN101724568B (en) 2011-08-31

Similar Documents

Publication Publication Date Title
CN101724568B (en) Trichoderma asperellum and application thereof in synthesizing (R)-[3,5-dual (trifluoromethyl) phenyl] ethanol
CN101565685B (en) Gene recombination bacterium and application thereof in preparing chiral pure acetoin and 2,3-butanediol
CN101851598A (en) Environmentally-friendly breeding of bacillus subtilis for producing 2,3-butanediol by fermentation with glucose substrate
CN104893989A (en) Rhizopus microsporus root-shaped variant ZJPH1308 and application thereof in preparation of sitagliptin intermediate
JP2017502677A (en) Sporolactobacillus terae and its use
CN100370032C (en) Producing dihydroxy acetone by microbe method
CN107746861A (en) A kind of biological preparation method of (R) 1 (2 trifluoromethyl) ethanol
CN103333842B (en) Bacillus subtilis producing 3-hydroxybutanone and application thereof
CN101016530A (en) Bacillus subtilis capable of producing high purity 3-hydroxy butanone
CN101899407B (en) Screening and application of bacillus licheniformis MEL09 with high 3-hydroxy butanone yield
CN101619299B (en) Rhodococcus ruber and method for preparing 5-cyanovaleramide by utilizing same
CN112063532B (en) Geotrichum linum and application thereof in preparation of (S) -1- (2-trifluoromethylphenyl) ethanol
CN105219653B (en) Produce Aspergillusclavatus (Aspergillus clavatus) Ac-32 bacterial strains and its application of Lovastatin
CN101864381A (en) Breeding of microbial strain for producing 3-hydroxy-2-butanone by fermenting substrate glucose
CN102102087B (en) Leifsonia xyli and use thereof in preparation of (R)-[3,5-bis(trifluoromethyl)phenyl]ethanol
CN103849574B (en) Candida parapsilosis ZJPH1305 and the application in chiral alcohol preparation
CN102161978B (en) Rhodococcus ZJPH1003 and application thereof in preparing S-(+)-2,2-dimethylcyclopropane carboxylic acid
CN106086090B (en) A kind of method that two-step microbial conversion method prepares R-MA
CN110760449A (en) Geotrichum galactose ZJPH1810 and application thereof in preparation of (S) -1- (2, 6-dichloro-3-fluorophenyl) ethanol
CN107881202A (en) A kind of biological preparation method of Levonorgestrel key chiral intermediate
US11377670B2 (en) Method for preparing vanillin by fermentation with eugenol as substrate
CN101508960B (en) Rhizopus and uses thereof
CN103773724A (en) Rhodococcus erythropolis XS1012 and application thereof in preparation of chiral alcohol
CN108587923B (en) Method for improving malic acid fermentation performance
CN102703479B (en) 6-geranyl geranyl diphosphate (GGPP) synthase, 8-sesquiterpene synthase and pleuromutilin high-yield strains, and application of strains

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant
CF01 Termination of patent right due to non-payment of annual fee

Granted publication date: 20110831

Termination date: 20161225

CF01 Termination of patent right due to non-payment of annual fee