CN116064688A - Application of Curvularia longifolia ZJPH2105 in preparation of chiral aromatic alcohol through biocatalysis - Google Patents
Application of Curvularia longifolia ZJPH2105 in preparation of chiral aromatic alcohol through biocatalysis Download PDFInfo
- Publication number
- CN116064688A CN116064688A CN202211148258.7A CN202211148258A CN116064688A CN 116064688 A CN116064688 A CN 116064688A CN 202211148258 A CN202211148258 A CN 202211148258A CN 116064688 A CN116064688 A CN 116064688A
- Authority
- CN
- China
- Prior art keywords
- volume
- zjph2105
- substrate
- strain
- use according
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/02—Preparation of oxygen-containing organic compounds containing a hydroxy group
- C12P7/22—Preparation of oxygen-containing organic compounds containing a hydroxy group aromatic
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/14—Fungi; Culture media therefor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/645—Fungi ; Processes using fungi
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Botany (AREA)
- Mycology (AREA)
- Medicinal Chemistry (AREA)
- Tropical Medicine & Parasitology (AREA)
- Virology (AREA)
- Biomedical Technology (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention provides an application of a strain ZJPH2105 of Curvularia longifolia (Tolypocladium inflatum) in preparing chiral aromatic alcohol by asymmetrically reducing aromatic ketone. The method utilizes the product e.e. value obtained by catalyzing the strain ZJPH2105 of the torticollis to be more than 99.9 percent, and the strain is green and safe, easy to culture, rich in source, low in cost, environment-friendly in the conversion process and the like, and expensive coenzyme is not needed to be added in the conversion process. According to the invention, 4' -bromo-2, 2-trifluoroacetophenone is reduced by using a strain cell of Curvularia longifolia (Tolypocladium inflatum) ZJPH2105 as a biocatalyst, and when the concentration of a substrate is 10mM, the yield of a target product (S) -1- (4-bromophenyl) -2, 2-trifluoroethanol can reach 98.2%, and the e.e. value is more than 99.9%.
Description
Field of the art
The invention relates to an application of a strain ZJPH2105 of Curvularia longifolia (Tolypocladium inflatum) in preparing chiral aromatic alcohol by asymmetrically reducing aromatic ketone.
(II) background art
Chiral aromatic alcohol is a key intermediate for constituting a plurality of medicines, bioactive molecules, fine chemicals, pesticides and the like, the variety and market demand of chiral medicines are continuously increased, and efficient preparation of chiral aromatic alcohol with high optical activity has become an important research direction. The biocatalysis for preparing chiral aromatic alcohol is widely focused by researchers because of the environment friendliness and mild reaction conditions. The biocatalysis method can utilize free enzyme or whole cells as catalysts for catalysis, wherein the enzyme catalysis method needs to add expensive coenzyme to ensure the realization of the reaction, and the intracellular ketoreductase needs to be obtained through steps of separation, purification and the like, so that the industrialized application of the method is limited to a certain extent, and the whole cell catalysis method has the advantages of low cost, easy obtainment of the catalysts and the like.
The torticola (Tolypocladium inflatum) belongs to ascomycota and is a nemataceae fungus which can be parasitic to nematodes, wheel worms, mites, mosquito larvae, fireflies, cicada, cordyceps sinensis hepialus and the like, is an important entomopathogenic fungus and can be used as a pesticide to reduce the use of chemical pesticides. The strain of the torticola can produce a plurality of secondary metabolites with biological activity, wherein the most main secondary metabolite is cyclosporin A (Cyclosporin A), and the strain is used as an immunosuppressant for organ transplantation or autoimmune diseases in medicine, so that researches on the strain are focused on fermentation production processes of cyclosporin, and few researches on biocatalysis reactions by using the strain as a catalyst are carried out.
(III) summary of the invention
The invention aims to provide a method for preparing chiral aromatic alcohol by using a strain ZJPH2105 of Curvularia longifolia (Tolypocladium inflatum). The mycelium of the strain ZJPH2105 of the torticollis is used as a biocatalyst to carry out asymmetric reduction to prepare chiral alcohol, so that the method has the advantages of safe and nontoxic strain, easy culture, low cost for preparing enzyme source cells and the like, can catalyze the asymmetric reduction of a substrate 4-bromo-2, 2-trifluoro acetophenone with high selectivity to prepare chiral aromatic alcohol, and has high optical purity of the product.
In order to achieve the above purpose, the technical scheme adopted by the invention is as follows:
the invention provides an application of Curvularia longifolia (Tolypocladium inflatum) in preparing chiral aromatic alcohol by asymmetric reduction of a latent chiral ketone compound in a biocatalysis manner. In the embodiment of the invention, the torticola is torticola (Tolypocladium inflatum) ZJPH2105, and is preserved in China center for type culture Collection with a preservation date of 2022, 8 months and 29 days, and the preservation number is as follows: CCTCC M20221346, address: 430072, university of martial arts, wuhan, china.
Further, the application is as follows: the method comprises the steps of (1) taking wet thalli obtained by fermentation culture of the torticollis as enzyme source cells, taking ketone compounds shown in a formula I as substrates, adding auxiliary substrates, taking phosphate buffer solution with pH of 6.0-8.0 (preferably pH 7.0) as a reaction medium to form a conversion system, reacting at 16-37 ℃ and 100-200rpm (preferably 25-30 ℃ and 150rpm-200rpm, particularly preferably 25 ℃), and separating and purifying the reaction solution after the reaction is finished to obtain chiral aromatic alcohol compounds shown in a formula II; the auxiliary substrate is glucose, maltose, fructose, methanol, isopropanol or glycerol; the mass of the wet bacterial cells is 50-400g/L (preferably 200-350g/L, particularly preferably 350 g/L) in terms of buffer volume; the concentration of the substrate is 5 to 30mmol/L (preferably 10 to 20mmol/L, most preferably 10 mmol/L) in terms of buffer volume; when the co-substrate is glucose, maltose, fructose or glycerol, the mass of the co-substrate is 20-200g/L (preferably 50-150g/L, most preferably 50 g/L) in terms of buffer volume, and when the co-substrate is methanol or isopropanol, the volume of the co-substrate is 5-20% (preferably 10%) of the volume of the buffer;
wherein R is 1 Is H, halogen, NO 2 、OCH 3 Or CF (CF) 3 ，R 2 Is C 1 -C 4 Alkyl or CF 3 。
Preferably, R 1 Is Cl, br or CF 3 ，R 2 Is CH 3 Or CF (CF) 3 。
Preferably, the compound of formula I is one of the following: 4 '-bromo-2, 2-trifluoroacetophenone, 4' -bromoacetophenone, 4 '-chloroacetophenone, 4' -trifluoromethyl acetophenone.
The invention provides a method for separating and purifying the reaction liquid, which comprises the following steps: extracting the reaction liquid with equal volume of ethyl acetate, centrifuging, collecting an upper ethyl acetate extraction phase, performing rotary evaporation, performing silica gel column chromatography separation on the obtained crude extract by taking a mixed liquid of petroleum ether and ethyl acetate with a volume ratio of 4:1 as an eluent, collecting an eluent containing a target product, and performing rotary evaporation to obtain the chiral aromatic alcohol compound shown in the formula II.
Further, when the auxiliary substrate is glucose, maltose, fructose or glycerol, the addition amount is 25-200g/L based on the volume of the buffer solution; when the auxiliary substrate is methanol or isopropanol, the addition amount is 5% -10% (v/v) based on the buffer volume; preferably, the auxiliary substrate is glycerol and the addition amount is 50g/L based on the buffer volume.
Taking 4' -bromo-2, 2-trifluoroacetophenone as an example, the invention provides an application of a strain ZJPH2105 of Curvularia longifolia (Tolypocladium inflatum) in biocatalysis aromatic ketone asymmetric reduction, and the method comprises the following steps: the wet thalli obtained by fermenting and culturing the strain ZJPH2105 of the torticollis is used as an enzyme source cell, 4' -bromo-2, 2-trifluoroacetophenone is used as a substrate, an auxiliary substrate is added, a phosphate buffer solution with the pH of 6.0-8.0 is used as a reaction medium to form a conversion system, the reaction is carried out under the conditions of 16-37 ℃ and 100-200rpm (preferably 25-30 ℃ and 150-200 rpm), and after the reaction is finished, the reaction solution is separated and purified to obtain the (S) -1- (4-bromophenyl) -2, 2-trifluoroethanol product.
Further, the wet bacterial cells of the present invention are obtained as follows:
1) Slant culture: inoculating the strain ZJPH2105 of the Curvularia longifolia (Tolypocladium inflatum) into a slant culture medium, culturing at constant temperature of 25 ℃ for 6d, and storing the obtained slant strain in a refrigerator at 4 ℃;
2) Liquid culture: from the slaveDigging the inclined plane strain obtained in the step 1) for 1cm 2 Inoculating the bacterial block into liquid culture medium, fermenting at 16-37deg.C and 120-250rpm for 2-5d (preferably 25deg.C and 150rpm for 3 d), centrifuging the obtained fermentation broth, precipitating with 0.1M K with pH of 7.0 2 HPO 4 -KH 2 PO 4 Washing with buffer solution, and centrifuging to obtain the wet thalli, namely enzyme source cells for catalyzing substrates.
Further, the slant culture medium in the step 1) is PDA culture medium, and consists of the following components with the final concentration: 200g/L of potato, 20g/L of glucose and 20g/L of agar, wherein the solvent is water, and the pH is natural. The fermentation medium in step 2) consists of the following components in the final concentration: 10g/L of maltose, 5g/L of glucose, 5g/L of yeast extract powder, water as a solvent and natural pH.
The technical route of the invention is as follows:
the strain of the invention, namely the strain of the Curvularia longifolia (Tolypocladium inflatum), is provided by edible fungi laboratory of gardening institute of agricultural sciences, zhejiang province, and is preserved in China center for type culture Collection, with a preservation date of 2022, 8 months and 29 days, and a preservation number: cctccc M20221346.
The analysis and detection method of the conversion liquid comprises the following steps: after the reaction is finished, adding an equal volume of ethyl acetate (containing tetradecane as an internal standard) into the conversion solution to terminate the reaction, oscillating and extracting for 30min, standing, taking an upper layer extract, analyzing and detecting by adopting a gas chromatography, and finally calculating to obtain the yield and the e.e. value of the target product.
Compared with the prior art, the invention has the beneficial effects that: the invention provides a novel method for preparing chiral aromatic alcohol by catalyzing asymmetric reduction of 4' -bromo-2, 2-trifluoroacetophenone by using Curvularia longifolia. Compared with the prior report level, the method utilizes the product e.e. value obtained by catalyzing the strain ZJPH2105 of the torticollis to be more than 99.9 percent, and the strain is green and safe, easy to culture, rich in source, free from adding expensive coenzyme in the conversion process, low in cost, green in the conversion process, environment-friendly and the like. According to the invention, the 4' -bromo-2, 2-trifluoroacetophenone is catalyzed by using the ZJPH2105 bacterial cells of the torticollis (Tolypocladium inflatum) as a biocatalyst, and when the concentration of a substrate is 10mM, the yield of a target product (S) -1- (4-bromophenyl) -2, 2-trifluoroethanol can reach 98.2%, and the e.e. value is more than 99.9%.
(IV) description of the drawings
FIG. 1 shows the gas phase detection chromatograms (containing the internal standard tetradecane) of the substrates 4' -bromo-2, 2-trifluoroacetophenone, the product (S) -1- (4-bromophenyl) -2, 2-trifluoroethanol and (R) -1- (4-bromophenyl) -2, 2-trifluoroethanol.
FIG. 2 is a gas chromatography detection chromatogram (containing an internal standard tetradecane) of a reaction extract of a P.megaterium ZJPH2105 strain for asymmetrically reducing 4' -bromo-2, 2-trifluoroacetophenone.
FIG. 3 is a gas phase detection chromatogram (containing internal standard dodecane) of a reaction extract of a reaction for asymmetrically reducing 4' -bromoacetophenone by a strain ZJPH2105 of Curvularia.
FIG. 4 is a gas chromatography detection chromatogram of an asymmetric reduction 4' -chloroacetophenone reaction extract of the strain ZJPH2105 of Curvularia, containing internal standard dodecane.
FIG. 5 is a gas chromatography detection chromatogram (containing internal standard dodecane) of a reaction extract of a reaction for asymmetrically reducing 4' -trifluoromethyl acetophenone by a strain ZJPH2105 of Curvularia.
(fifth) detailed description of the invention
The invention will be further described with reference to the following specific examples, but the scope of the invention is not limited thereto:
example 1: identification of species
Morphological characteristics of strain ZJPH 2105: after PDA plate culture, the bacterial colony appearance, color, growth speed and other basic characteristics of the strain ZJPH2105 are observed. The bacterial colony on the PDA flat plate is pure white, flocculent, round and compact, and the back of the culture medium is light yellow brown without effusion;
molecular biology identification: the ITS sequence of strain ZJPH2105 was determined by Beijing, bio-technology Co., ltd. The extracted total DNA of cells is used as a template, the ITS sequences of the strains are amplified by using fungus universal primers ITS1 and ITS4, and then the PCR products are subjected to agarose gel electrophoresis with the concentration of 1%. The ITS gene sequence of the strain ZJPH2105 is shown as SEQ ID NO.1 through sequencing. SEQ ID NO.1: AACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTATCAACTCCCAAACCCCTGTGAACATACCCAACGTTGCTTCGGCGGGACCGCCCCGGCGCCTCGGCGTCCCGGAACCAGGCGCCCGCCGGAGGACCCAAACTCTTGTTTAACCATAGTGGCATATTCTGAGTCTCACAAGAAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCCCAGCGGCTTGGTGTTGGGGACCGGCCCCGGCCGCCCCCCAAATGCAGTGGCGACCTCGCCGCAGCCTCCCCTGCGTAGTAGCACAACTCGCACCGGAGCGCGGAGACGGTCACGCCGTAAAACGCCCAACTTCTCAGAGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGTCGGAGG
The ITS sequence of strain ZJPH2105 (SEQ ID NO. 1) was subjected to homology alignment (BLAST) on NCBI website (http:// www.ncbi.nlm.nih.gov), which showed that: the sequence homology of strain ZJPH2105 with strain Tolypocladium inflatum (GenBank accession No. AB103381.1) was 93%.
According to morphological characteristics of the strain ZJPH2105 and combined with molecular biological identification, the strain is identified and named as ZJPH2105 of Curvularia longifolia (Tolypocladium inflatum), and is preserved in China center for type culture Collection with a preservation date of 2022, 8 and 29 days, and a preservation number of: cctccc NO: m20221346, deposit address: 430072, university of martial arts, wuhan, china.
Example 2: obtaining of wet cell
Slant culture medium composition: 200g/L of potato, 20g/L of glucose, 20g/L of agar, water as a solvent and natural pH;
liquid medium composition: 10g/L of maltose, 5g/L of glucose, 5g/L of yeast extract powder, water as a solvent and natural pH.
Inoculating the strain ZJPH2105 of the Curvularia longifolia to a slant culture medium, and culturing for 6d at 25 ℃ to obtain slant strain.
Digging a piece of 1cm from the mature slant strain 2 Inoculating bacterial block with the size of about to 250mL shake flask containing 100mL liquid culture medium, culturing at 25deg.C and 150rpm for 3d, and culturingThe fermentation broth was centrifuged at 9000rpm for 10min, washed with 0.1. 0.1M, pH 7.0.7.0 potassium phosphate buffer, and collected to obtain wet cells.
Example 3: gas chromatography detection method for product
After the reaction is finished, adding an equal volume of ethyl acetate into the conversion solution, extracting for 30min, centrifuging, and taking an upper layer extract for gas chromatography analysis and detection. The gas chromatography detection method comprises the following steps: the gas chromatograph was Agilent7820A and the column was a Varian CP-Chirasil-Dex chiral capillary gas chromatography column (25 m 0.25mm 0.25 μm, df=0.25). Quantitative analysis of the substrate and product was performed using tetradecane (3.78 mM) as an internal standard, and the carrier gas was high purity nitrogen gas using a hydrogen Flame Ionization Detector (FID).
Gas chromatography detection conditions: the carrier gas flow rate is 2mL/min, the sample injection amount is 1 mu L, the split ratio is 15:1, the sample injection port temperature is 250 ℃, the detector temperature is 250 ℃, the chromatographic column temperature is 142 ℃, and the temperature is raised to 152 ℃ at 1 ℃/min. The retention time of each substance was: 4' -bromo-2, 2-trifluoroacetophenone for 1.6min, tetradecane for 3.0min, and (S) -1- (4-bromophenyl) -2, 2-trifluoroethanol for 8.4min, and (R) -1- (4-bromophenyl) -2, 2-trifluoroethanol for 8.7min, the gas phase detection chromatogram is shown in FIG. 1.
The yield calculation method comprises the following steps:
drawing a standard curve: preparing standard substance solutions of a substrate and a product with the final concentration of 40mM, and preparing standard substance solutions with the concentrations of 5mM, 10mM, 15mM, 20mM, 30mM and 40mM by dilution, and detecting by gas chromatography. Integrating the obtained chromatograms to obtain peak areas, drawing a standard curve by taking the ratio of the peak areas of a substrate or a product to the peak areas of tetradecane as an abscissa and the ratio of the concentration of the substrate or the product to the concentration of the tetradecane as an ordinate, and performing linear regression fitting to obtain a product standard curve equation: y=2.0037x+0.2472, r 2 ＝0.9997。
The product yield was calculated as follows:
yield (%) =c p /C 0 X 100% equation 1
C in the formula p Concentration of (S) -1- (4-bromophenyl) -2, 2-trifluoroethanol after completion of the reaction, C 0 Is the initial concentration of 4' -bromo-2, 2-trifluoroacetophenone.
The optical purity of the product is characterized by the e.e. value. The calculation formula is as follows:
e.e.＝(C S -C R )/(C S +C R ) X 100% equation 2
C in the formula R And C S 1- (4-bromophenyl) -2, 2-trifluoroethanol molar concentrations in R-configuration and S-configuration, respectively.
Examples 4 to 10: influence of co-substrate species on biocatalytic reduction reactions
The wet cells obtained in the method of example 2 were resuspended in 10mL of potassium phosphate buffer (0.1M, pH 7.0) and the amount of the wet cells added was 200g/L of buffer based on the wet weight; 4' -bromo-2, 2-trifluoroacetophenone was added as substrate in 15mM by volume of buffer, different saccharides and glycerol were added in 100g/L by volume of buffer, or methanol and isopropanol in 10% (v/v) by volume of buffer were added as auxiliary substrates, and the mixture was placed in a shaking table at 25℃and 150rpm for biotransformation for 72 hours. The detection product (S) -1- (4-bromophenyl) -2, 2-trifluoroethanol was analyzed for yield and e.e. value by the detection method of example 3 (table 1).
TABLE 1 influence of the addition of different cosubstrates on the reaction yield and e.e. values
As can be seen from Table 1, when the co-substrate is glycerol, the yield of (S) -1- (4-bromophenyl) -2, 2-trifluoroethanol is up to 70.1%, e.e. value >99.9%.
Examples 11 to 17: effect of glycerol concentration on biological reduction reactions
The wet cell obtained in the method of example 2 was resuspended in 10mL of potassium phosphate buffer (0.1M, pH 7.0) and the amount of wet cell added was 200g/L buffer based on the wet weight; 4' -bromo-2, 2-trifluoroacetophenone was added as substrate in 15mM by volume of buffer, glycerol was added as co-substrate in 0g/L, 25g/L, 50g/L, 75g/L, 100g/L, 150g/L, 200g/L by volume of buffer, and the mixture was placed in a shaker at 25℃and 150rpm for biotransformation for 72h. The detection product (S) -1- (4-bromophenyl) -2, 2-trifluoroethanol was analyzed for yield and e.e. value by the detection method of example 3 (table 2).
TABLE 2 Effect of glycerol concentration on reaction yield and e.e. values
As is clear from Table 2, the yield of (S) -1- (4-bromophenyl) -2, 2-trifluoroethanol was found to be at most 72.7% at a co-substrate glycerol concentration of 50g/L, and the e.e. value was >99.9%.
Examples 18 to 22: influence of the conversion temperature on the biological reduction reaction
The wet cell obtained in the method of example 2 was resuspended in 10mL of potassium phosphate buffer (0.1M, pH 7.0) and the amount of wet cell added was 200g/L buffer based on the wet weight; 4' -bromo-2, 2-trifluoroacetophenone was added as substrate in 15mM buffer volume, glycerol was added as auxiliary substrate in 50g/L buffer volume, and the mixture was placed in a shaking table at 16℃and 20℃and 25℃and 30℃and 37℃and 150rpm, respectively, for bioconversion for 72h. The detection product (S) -1- (4-bromophenyl) -2, 2-trifluoroethanol was analyzed for yield and e.e. value by the detection method of example 3 (table 3).
TABLE 3 influence of the conversion temperature on the reaction yield and e.e. values
As can be seen from Table 3, when the bioconversion reaction was carried out at 25℃the yield of (S) -1- (4-bromophenyl) -2, 2-trifluoroethanol was up to 72.7%, e.e. value >99.9%.
Examples 23 to 27: effect of buffer initial pH on biological reduction reactions
Suspending the wet cell obtained in the method of example 2 in 10mL of potassium phosphate buffer (0.1M) with pH value ranging from 6.0 to 8.0, wherein the addition amount of the wet cell is 200g/L buffer based on the wet weight; 4' -bromo-2, 2-trifluoroacetophenone was added as substrate at 15mM by volume of buffer, glycerol was added as co-substrate at 50g/L by volume of buffer, and the mixture was placed in a shaker at 25℃and 150rpm for biotransformation for 72h. The detection product (S) -1- (4-bromophenyl) -2, 2-trifluoroethanol was analyzed for yield and e.e. value by the detection method of example 3 (table 4).
TABLE 4 influence of initial pH of buffer on reaction yield and e.e. value
As can be seen from Table 4, the yield of (S) -1- (4-bromophenyl) -2, 2-trifluoroethanol was found to be up to 71.3% and the e.e. value was >99.9% when the buffer initial pH was 7.0.
Examples 28 to 35: influence of the amount of wet cells on the biological reduction reaction
The wet cells obtained in example 2 were resuspended in 10mL of potassium phosphate buffer (0.1M, pH 7.0) and the amounts of the wet cells added were 50g/L, 100g/L, 150g/L, 200g/L, 250g/L, 300g/L buffer, respectively, based on the wet weight; 4' -bromo-2, 2-trifluoroacetophenone was added as substrate at 15mM by volume of buffer, glycerol was added as co-substrate at 50g/L by volume of buffer, and the mixture was placed in a shaker at 25℃and 150rpm for biotransformation for 72h. The yield and e.e. values of (S) -1- (4-bromophenyl) -2, 2-trifluoroethanol were analytically examined using the detection procedure of example 3 (Table 5).
TABLE 5 influence of the addition of wet cells on the reaction yield and e.e. value
Preferably, the wet cell is added at a rate of 350g/L, and under these conditions, the yield of (S) -1- (4-bromophenyl) -2, 2-trifluoroethanol produced is 87.5%, and the e.e. value is >99.9%.
Examples 36 to 40: influence of substrate concentration on the biological reduction reaction
The wet cell obtained in the method of example 2 was resuspended in 10mL of potassium phosphate buffer (0.1M, pH 7.0) and the amount of wet cell added was 350g/L buffer based on the wet weight; 4' -bromo-2, 2-trifluoroacetophenone was added as substrate in 10mM, 15mM, 20mM, 30mM, 40mM, respectively, based on the buffer volume, glycerol was added as co-substrate in 50g/L based on the buffer volume, and the mixture was placed in a shaking table at 25℃and 150rpm for biotransformation for 72 hours. The yield and e.e. values of (S) -1- (4-bromophenyl) -2, 2-trifluoroethanol were analytically examined using the detection procedure of example 3 (Table 6).
TABLE 6 influence of substrate concentration on reaction yield and e.e. value
Preferably, the substrate concentration is 10mM, under which conditions the yield of (S) -1- (4-bromophenyl) -2, 2-trifluoroethanol is 98.2%, e.e.value >99.9%.
Examples 41 to 49: conversion results of Curvularia longifolia ZJPH2105 Strain to biological reduction of different aryl ketone substrates
The wet cell obtained in the method of example 2 was resuspended in 10mL of potassium phosphate buffer (0.1M, pH 7.0) and the amount of wet cell added was 200g/L buffer based on the wet weight; different substrates, such as 4 '-bromo-2, 2-trifluoroacetophenone, 4' -bromoacetophenone, 4 '-chloroacetophenone, 4' -trifluoromethyl acetophenone and the like, which are 10mM in terms of buffer volume, are added respectively for biocatalysis to prepare (S) -1- (4-bromophenyl) -2, 2-trifluoroethanol, (R) -1- (4-bromophenyl) ethanol, (R) -1- (4-chlorophenyl) ethanol and (R) -1- (4-trifluoromethylphenyl) ethanol, and 100g/L of glucose, which is calculated in terms of buffer volume, is added as an auxiliary substrate, and placed in a shaking table at 25 ℃ and 150rpm for bioconversion for 72 hours. Analytical testing was performed using the test procedure of example 3 (Table 7).
TABLE 7 yield and e.e. values of reduction of different aromatic ketones catalyzed by the strain ZJPH2105 of Curvularia longifolia
NR: unreacted reaction
Example 50: preparation of (S) -1- (4-bromophenyl) -2, 2-trifluoroethanol by asymmetric reduction of 4' -bromo-2, 2-trifluoroacetophenone by Lentinus edodes (Lentinus. Edodes) 808 strain
Slant culture medium composition: 200g/L of potato, 20g/L of glucose, 20g/L of agar, water as a solvent and natural pH;
seed medium composition: 200g/L of potato, 20g/L of glucose, water as a solvent and natural pH;
fermentation medium composition: 10g/L of maltose, 5g/L of glucose, 5g/L of yeast extract powder, water as a solvent and natural pH.
Inoculating 808 # mushroom strain into slant culture medium, and culturing at 25deg.C for 8d to obtain slant strain.
Digging a piece of 1cm from the mature slant strain 2 About the size of the fungus block is inoculated into 100mL of liquid culture medium in 250mL shaking flask, 25 ℃,150rpm culture 7d, and then 10mL seed liquid is inoculated into 100mL fermentation medium with 10% inoculation amount of volume concentration, 25 ℃,150rpm culture 3d. After the completion of the culture, the fermentation broth was filtered, washed with 0.1. 0.1M, pH 7.0.7.0 potassium phosphate buffer, and collected to obtain wet cells.
2g of wet bacterial strain No. 808 of Lentinus edodes was added to 10mL of potassium phosphate buffer (0.1M, pH 7.0), the amount of substrate 4' -bromo-2, 2-trifluoroacetophenone was 5mM by volume of the buffer, 100g/L of glucose by volume of the buffer was added as an auxiliary substrate, and the mixture was subjected to biotransformation at 25℃and 200rpm for 72 hours, and after the completion of the reaction, the analysis and detection were carried out by the detection method of example 3.
Conclusion: the E.e. value of 4' -bromo-2, 2-trifluoroacetophenone transformed from Lentinus edodes (Lentus. Edodes) 808 strain was 12.0% for (S) -1- (4-bromophenyl) -2, 2-trifluoroethanol, and the yield was 13.3%.
Claims (10)
1. Use of a calicheamicin (tolypocladium) ZJPH2105 deposited in the chinese collection of typical cultures with a date of 2022, 8 months and 29 days, deposit number, for the biocatalysis preparation of chiral aromatic alcohols by asymmetric reduction of latent chiral ketone compounds: CCTCC M20221346, address: 430072, university of martial arts, wuhan, china.
2. The application of claim 1, wherein the application is: the method comprises the steps of taking wet thalli obtained by fermentation culture of the torticollis as enzyme source cells, taking ketone compounds shown in a formula I as substrates, adding auxiliary substrates, taking phosphate buffer solution with pH of 6.0-8.0 as a reaction medium to form a conversion system, reacting at 16-37 ℃ and 100-200rpm, and separating and purifying reaction liquid after the reaction is finished to obtain chiral aromatic alcohol compounds shown in a formula II; the auxiliary substrate is glucose, maltose, fructose, methanol, isopropanol or glycerol; the mass of the wet thalli is 50-400g/L based on the volume of the buffer solution; the concentration of the substrate is 5-30mmol/L in terms of buffer volume; when the auxiliary substrate is glucose, maltose, fructose or glycerol, the mass of the auxiliary substrate is 20-200g/L calculated by the volume of the buffer solution, and when the auxiliary substrate is methanol or isopropanol, the volume of the auxiliary substrate is 5-20% of the volume of the buffer solution;
wherein R is 1 Is H, halogen, NO 2 、OCH 3 Or CF (CF) 3 ，R 2 Is C 1 -C 4 Alkyl or CF 3 。
3. The use according to claim 2, wherein: r is R 1 Is Cl, br or CF 3 ，R 2 Is CH 3 Or CF (CF) 3 。
4. The use according to claim 3, wherein the compound of formula I is one of the following: 4 '-bromo-2, 2-trifluoroacetophenone, 4' -bromoacetophenone, 4 '-chloroacetophenone, 4' -trifluoromethyl acetophenone.
5. The use according to claim 2, wherein: the temperature of the reaction is 25-30 ℃.
6. The use according to claim 2, wherein: the auxiliary substrate is glycerol, and the mass of the auxiliary substrate is 50g/L in terms of buffer volume.
7. The use according to claim 2, wherein: the pH value of the phosphate buffer solution is 7.0.
8. The use according to claim 2, wherein: the concentration of the substrate was 10mmol/L in terms of buffer volume.
9. The use according to claim 2, wherein: the mass of the wet thalli is 200-350g/L calculated by the volume of the buffer solution.
10. Use according to claim 2, characterized in that the wet cells are obtained by the following method:
1) Slant culture: inoculating a torticola (Tolypocladium) ZJPH2105 into a slant culture medium, and culturing at a constant temperature of 25 ℃ for 6d;
2) Liquid culture: digging 1cm from the slant strain obtained in step 1) 2 Inoculating the bacterial block into liquid culture medium, fermenting at 16-37deg.C and 120-250rpm for 2-5d, centrifuging the obtained fermentation broth, and collecting precipitate with 0.1M K having pH value of 7.0 2 HPO 4 -KH 2 PO 4 Washing with buffer solution, and centrifuging to obtain the wet bacterial cells.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211148258.7A CN116064688A (en) | 2022-09-20 | 2022-09-20 | Application of Curvularia longifolia ZJPH2105 in preparation of chiral aromatic alcohol through biocatalysis |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211148258.7A CN116064688A (en) | 2022-09-20 | 2022-09-20 | Application of Curvularia longifolia ZJPH2105 in preparation of chiral aromatic alcohol through biocatalysis |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN116064688A true CN116064688A (en) | 2023-05-05 |
Family
ID=86182703
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202211148258.7A Pending CN116064688A (en) | 2022-09-20 | 2022-09-20 | Application of Curvularia longifolia ZJPH2105 in preparation of chiral aromatic alcohol through biocatalysis |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN116064688A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114426997A (en) * | 2021-12-06 | 2022-05-03 | 南京师范大学 | Method for preparing insecticide by fermentation |
-
2022
- 2022-09-20 CN CN202211148258.7A patent/CN116064688A/en active Pending
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114426997A (en) * | 2021-12-06 | 2022-05-03 | 南京师范大学 | Method for preparing insecticide by fermentation |
| CN114426997B (en) * | 2021-12-06 | 2024-04-12 | 南京师范大学 | Method for preparing insecticide by fermentation |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107746861B (en) | Biological preparation method of (R) -1- (2-trifluoromethylphenyl) ethanol | |
| CN109022293B (en) | Monascus purpureus strain, and fermentation product and fermentation method thereof | |
| CN113462602B (en) | Corksaiella radicata ZJPH202011 and application thereof | |
| CN116064688A (en) | Application of Curvularia longifolia ZJPH2105 in preparation of chiral aromatic alcohol through biocatalysis | |
| CN112063532B (en) | Geotrichum linum and application thereof in preparation of (S) -1- (2-trifluoromethylphenyl) ethanol | |
| CN103224963B (en) | Method for preparing chiral amine through asymmetric reduction under catalysis of marine strain | |
| CN112063531B (en) | Geotrichum candidum ZJPH1907 and application thereof in preparing (S) -2-chloro-1- (3, 4-difluorophenyl) ethanol | |
| CN110760449B (en) | Geotrichum galactose ZJPH1810 and application thereof in preparation of (S) -1- (2, 6-dichloro-3-fluorophenyl) ethanol | |
| CN113667702B (en) | Biosynthesis method of miconazole chiral intermediate | |
| CN107881202B (en) | Biological preparation method of key chiral intermediate of levonorgestrel | |
| CN111925949B (en) | Curvularia lunata B-36 and application thereof in synthesis of chiral alcohol | |
| CN103773724B (en) | Rhodococcus XS1012 and preparing the application in chiral alcohol | |
| CN113462728B (en) | Method for preparing (R) -1- (4-bromophenyl) -2, 2-trifluoroethanol by using starwheel head yeast | |
| CN112725205B (en) | Saccharomyces strain and screening method and application thereof | |
| CN102154133A (en) | Method and strain for preparing (R)-1,3-butanediol by asymmetric reduction | |
| CN104178432B (en) | Rhodotorula mucilaginosa and application thereof | |
| CN108441433B (en) | Rhodotorula mucilaginosa NQ1 and application thereof in preparation of chiral alcohol | |
| CN1511943A (en) | Engineering strain and its preparing method, and method for preparing taxol thereof | |
| CN108998430B (en) | Interface self-assembly carbonyl reductase and application thereof in synthesis of (R) -3-hydroxy-3-ethyl phenylpropionate | |
| CN104711201B (en) | Yarrowia lipolytica and application thereof | |
| CN107118986B (en) | Pseudomonas putida and application thereof in preparation of (R) -1- (2-trifluoromethylphenyl) ethanol | |
| CN101824438A (en) | Method for preparing (S)-3-hydroxy butyric acid ethyl ester through ethyl acetoacetate microbial conversion | |
| CN110982757A (en) | Enterobacter cloacae ZJPH1903 and application | |
| CN110016444A (en) | Acinetobacter calcoaceticus ZJPH1806 and its application for preparing Miconazole chiral intermediate | |
| CN111778198B (en) | Micrococcus luteus HMC01 and application thereof in preparation of chiral alcohol through asymmetric reduction |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |