CN107875166A - The inhibitor of EVI 1 is preparing the application in being used to treat the medicine of aberrant angiogenesis remoldability disease - Google Patents

Abstract

The present invention discloses a kind of transcription factor and cancer protein tropic virus integration site 1 (ecotropic viral integration site 1, the EVI 1) application of inhibitor in vascular remodeling.The inhibitor of EVI 1 is with vascular smooth muscle specificity marker gene (SMA, SM22 etc.) and its idiosyncratic transcription factor (SRF, Myocardin) it is direct target spot, promote smooth muscle expression of specific gene, significantly inhibit media vasorum smooth muscle cell to be converted from shrinkage type to secreting type, so as to mitigate the aberrant nascent of inner membrance after injury of blood vessel.The Study on Molecular Mechanism of gene, protein level is deep into from cell function experiment, the analyzing specimen of clinical patients is changed into from internal animal pathology model experiment, it is the important regulating and controlling factor of Phenotypic Change of Smooth Muscle Cells all to confirm the inhibitor of EVI 1.So we are also it is believed that the inhibitor of EVI 1 is very likely used to treat cardiovascular and cerebrovascular disease as a kind of new anti-angiogenic abnormal remoldability medicine in future.

Description

EVI-1 inhibitor is being prepared for treating in the medicine of aberrant angiogenesis remoldability disease Application

Technical field

The present invention relates to biomedical sector, more particularly to EVI-1 inhibitor answering in aberrant angiogenesis remoldability disease With more particularly to miR-22-3p in preparation by the extremely caused aberrant angiogenesis remoldability disease of Phenotype Transformation of Vascular Smooth Muscle Application in the medicine of disease.

Background technology

Atherosclerosis (Atherosclerosis, AS) is common disease clinically, is acute coronary syndrome (Acute Coronary Syndrome, ACS), acute myocardial infarction (Acute Myocardial Infarction, AMI) and ischemic The pathogenesis basis of property cerebro-vascular diseases.In the whole world the sick morbidity and mortality occupy always various diseases it It is first.

Percutenous transluminal coro-nary angioplasty (Percutaneous transluminal coronary Angioplasty, PTCA) be current treatment using atherosclerosis as main underlying diseases coronary heart disease most efficient method it One, the application of the technology greatly improves patient survival and time-to-live.But with intravascular ultrasound (Intravascularultrasound, IVUS) technology, optical coherence tomography (Optical coherence Tomography, OCT) etc. intravascular iconography detection technique development, interior ISR (In-stent after percutaneous transluminal coronary stent implantation Restenosis, ISR) the problem of be also gradually exposed.Constantly exerting by vast cardiovascular researcher in the past 20 years Power, the preventing and treating of ISR achieve important breakthrough, such as new anticoagulant, overlay film frame, Biodegradable scaffold, gene therapy Development and application etc. new technology make ISR incidence compared to constantly decline in the past, but ISR patient still has significant proportion.Study carefully Its reason is main or specific mechanism to in-stent restenosis still not exclusively understands, and based on being currently understood that found tune Control target spot can not block its generation completely, and this also makes it still turn into whole world cardiovascular field experts and scholars attention and urgently broken through Field.At present it is considered that ISR is related to the number of mechanisms in Pathological Physiology, including vascular endothelial cell (Vascular Endothelial Cell, VECs) damage, inflammatory and immune response and vascular smooth muscle cells (Vascular Smooth Muscle Cell, VSMC) abnormality proliferation with migration etc..The mechanism is intricate, but after all or support After implantation caused by body blood vessel homeostasis.Therefore the injury of blood vessel reparation participated in for vascular cell, it is intended to it is steady to recover blood vessel The research of state is the focus of the current area research.

Blood vessel plays an important role in the pathological processes of body.Various mechanical damages or pathological stimuli are drawn The blood vessel risen is extensive and complicated Cellular response can destroy blood vessel homeostasis, causes blood vessel structure to change with function, this Individual process is also referred to as injury of blood vessel (Vascular Injury).Numerous studies show, continue or excessive injury of blood vessel and repair Multiple process is the common disease of the important vascular injury disease such as atherosclerosis, post stent implantation restenosis, pulmonary hypertension Reason basis, cell of the process medium vessels itself serve important function.In cardiovascular system, vascular smooth muscle cells are vascular walls Main composition cell, it is a kind of differentiated cell of high degree of specificity, mainly controls body blood pressure and blood by shrinking Flow distribution is so as to playing function.In vascular pathological physiology, the most important feature of vascular smooth muscle cells is its cell phenotype tool There is highly plastic (Plasticity).In normal blood vessel, smooth muscle cell often exists with shrinkage type.And by various Physiological and pathological factor stimulate the stimulation of such as injury of blood vessel, inflammatory mediator, hemodynamics disturbance, smooth muscle cell can occur Phenotypic Change (Phenotypic modulation), is changed into other types of smooth muscle cell, such as proliferation apoptosis from shrinkage type Type, macrophage type, inflammatory type, apoptosis type, Ossification of Protruded etc..Synthesis type differentiation degree after conversion is low or undifferentiated.Its smooth muscle Shrinking gene expression significantly reduces, and breeds, migrates, the ability of the synthetic cell factor and extracellular matrix is but remarkably reinforced.Smoothly The plasticity of myocyte is advantageous to embryonic development and ripe blood vessel injury repair process, however, this plasticity also makes smoothly The susceptible pathological stimuli factor in environment of myocyte, it is set to participate in the occurrence and development of vascular diseases.

Clinically the taxol used in bracket for eluting medicament coating and rapamycin are effectively suppressing vascular smooth muscle at present Breed, prevent from also counteracts that the endothelialization again of blood vessel while ISR, therefore thrombosis at a specified future date and postoperative patient need The problems such as Long-term Oral antiplatelet drug, also seriously annoyings clinician.

Transcription factor and cancer protein-EVI-1 are the DBPs of a site-specific, are positioned at core, mainly by with The combination in target gene promoters region so as to regulate and control body hematopoiesis, cell differentiation, cell propagation with migration etc. disease physiological disease Reason process.The research of the gene is concentrated mainly on hemopoietic system at present, and research in the past finds that it can be by suppressing RUNX1 genes Transcriptional activation, the signal dredging collateral of TGF-β 1 is blocked, Cdk2 enzymatic activitys, epigenetic distortion is lowered, regulates and controls other transcription factor (such as： JNK and AP1) etc. participate in leukaemia generation.Also let us is carried out further deeply EVI-1 this biological effect to which creating The great interest of research.Our early-stage Study is found that EVI-1 can the specific Phenotypic Change for participating in vascular smooth muscle cells. Therefore EVI-1 is likely to be the crucial target spot for the treatment of aberrant angiogenesis remoldability disease.

MicroRNA (miRNA) be a kind of length be about 22 nucleotides non-coding RNA (non-coding RNA, NcRNA) molecule, it mainly regulates and controls its expression by being combined with-the UTR of target gene 3 ' come negativity, so as to cell development, differentiation, Propagation, migration etc. play a significant role.Our seminars report miR-22 by regulating and controlling methylated CpG combination egg recently White 2 (Methyl CpG-Binding Protein 2, MECP-2) are so as to promoting embryonic stem cell to SMC differentiation.But It is whether miR-22 works in terms of neointima after ripe blood vessel Phenotypic Change of Smooth Muscle Cells and injury of blood vessel and have not yet to see Relevant report.

We are using multiple bioinformatic analysis databases such as Targetscan and miRanda in smooth muscle cell MiR-22 downstream target genes are predicted.Finally found that EVI-1 is miR-22 downstream target gene.

At present, both at home and abroad still without the suppression anti-angiogenic reports remolded extremely of EVI-1.

The content of the invention

It is an object of the invention to provide a kind of EVI-1 inhibitor to prepare for treating aberrant angiogenesis remoldability disease Application in medicine, it is intended to find the medicine that a kind of energy specific regulatory control vascular smooth muscle cells adjust Phenotypic Change.

The purpose of the present invention is achieved through the following technical solutions：EVI-1 inhibitor is different for treating blood vessel in preparation Application in the medicine of normal remoldability disease.

Further, the EVI-1 inhibitor includes microRNA：MiR-22-3p, sequence 5 '- AAGCTGCCAGTTGAAGAACTGT-3’(SEQ ID NO.1)。

Further, microRNA is the microRNA of chemical synthesis, or is the microRNA of plasmid vector expression.

Further, the EVI-1 inhibitor includes small molecule shRNA, sequence Evi1-shRNA-F：5'- CCGGCAGGTACTGTGGCAAGATATTCTCGAGAATATCTTGCCACAGTACCTGTTTTTG-3'(SEQ ID NO.2)； Evi1-shRNA-R：5'-AATTCAAAAACAGGTACTGTGGCAAGATATTCTCGAGAATATCTTGCCACAGTACCTG-3' (SEQ ID NO.3)。

The beneficial effects of the present invention are：The present invention creatively has found that EVI-1 inhibitor can be straight by influenceing EVI-1 Binding closes the startup of smooth muscle specificity marker gene (SMA, SM22 etc.) and its idiosyncratic transcription factor (SRF, Myocardin) Sub- site, promote smooth muscle expression of specific gene, significantly inhibit media vasorum smooth muscle cell and turned from shrinkage type to secreting type Change, so as to mitigate the disease after injury of blood vessel caused by the aberrant nascent of inner membrance；Suppress comprising the EVI-1 including miR-22-3p Agent can mitigate the toxic side effect to body by topical application；Experiment in vivo also indicates that, is existed by directly wrapping up miR-22-3p Perivascular, it can effectively mitigate abnormal neointima caused by injury of blood vessel.

Brief description of the drawings

Figure 1A~Figure 1B is result figure in the embodiment of the present invention 1, it is shown that the phenotype that EVI-1 take part in smooth muscle cell turns Change.Wherein, Figure 1A is that smooth muscle cell is cultivated, under the stimulation of non-serum starved and TGF-β normal, and potential smooth muscle regulates and controls base The detection of expression design sketch of cause；Figure 1B is EVI-1 detection of expression design sketch in the model of nature Phenotypic Change.

Fig. 2A~Fig. 2 F are result figure in the embodiment of the present invention 2, it is shown that the phenotype of EVI-1 regulation and control smooth muscle cells turns Change.Wherein, Fig. 2A-Fig. 2 B are that EVI-1 genes stably strike EVI-1mRNA and protein expression testing result figure in low cell line；Figure When 2C- Fig. 2 D is suppress EVI-1, vascular smooth muscle cells shrink gene and its transcription factor expression testing result figure；Fig. 2 E- scheme When 2F is suppresses EVI-1, vascular smooth muscle cell proliferation and migration testing result figure.

Fig. 3 A~Fig. 3 E are result figure in the embodiment of the present invention 3, it is shown that EVI-1 Transcription inhibitions vascular smooth muscle cells are special The opposite sex shrinks gene expression.Wherein, when Fig. 3 A- Fig. 3 B is suppress EVI-1, smooth muscle specific gene promoter Activity determination knot Fruit is schemed；When Fig. 3 C- Fig. 3 D is suppress EVI-1, smooth muscle specific gene transcription factor promoter Activity determination result figure.Fig. 3 E During to suppress EVI-1, chromatin immune co-precipitation (CHIP) testing result figure of smooth muscle specific gene and its transcription factor.

Fig. 4 A~Fig. 4 H are result figure in the embodiment of the present invention 4, it is shown that miR-22 regulates and controls Phenotypic Change of Smooth Muscle Cells. Wherein, when Fig. 4 A- Fig. 4 B is transfect miR-22mimics or miR-22inhibitor, miR-22 detection of expression result figures；Figure When 4C- Fig. 4 D are the high expression of miR-22 or are suppressed, smooth muscle gene expression detection result figure.Fig. 4 E- Fig. 4 F are overexpression During miR-22, vascular smooth muscle cell proliferation and migration testing result figure；When Fig. 4 G- Fig. 4 H is suppress miR-22, vascular smooth Muscle cell multiplication and migration testing result figure.

Fig. 5 A~Fig. 5 E are result figure in the embodiment of the present invention 5, it is shown that miR-22 direct regulations and controls EVI-1.Wherein, Fig. 5 A Binding site and mutational site sequence diagram for miR-22 and EVI-1；Fig. 5 B- Fig. 5 C are the high expression of miR-22 or are suppressed When, the result testing result figure of EVI-1mRNA and protein expression；When Fig. 5 D are the high expression of miR-22 or are suppressed, EVI-1UTR Reporter gene activity testing result figure；When Fig. 5 E are miR-22 binding sites mutation on EVI-1, EVI-1-UTR-mut report bases Because of Activity determination result figure.

Fig. 6 A~Fig. 6 C are result figure in the embodiment of the present invention 6, and EVI-1 can mediate miR-22 modulating vascular smooth muscle cells Shrink gene expression and function changes.Wherein, Fig. 6 A stably strike in low cell line or control cell lines for EVI-1 and transfect miR- During 22inhibitor or miR-22inhibitor control, vascular smooth muscle cells shrinkage gene expression detection result Figure；Fig. 6 B- Fig. 6 C are that EVI-1 stably strikes transfection miR-22inhibitor or miR- in low cell line or control cell lines During 22inhibitor control, vascular smooth muscle cell proliferation, shift function change testing result figure.

Fig. 7 A~Fig. 7 D are result figure in the embodiment of the present invention 7, it is shown that being overexpressed miR-22 in body blood vessel can substantially press down Neointima caused by seal wire damage processed.Wherein, Fig. 7 A- Fig. 7 B are to wrap up the PF- containing miR-22agomir in perivascular When 127, miR-22 and its target gene EVI-1 detection of expression result figures in blood vessel；Fig. 7 C- Fig. 7 D perivasculars transfect miR-22 When, endangium new life testing result figure.

Fig. 8 A~Fig. 8 C are result figure in the embodiment of the present invention 8, it is shown that miR-22 and its target gene are normal and sick in people The differential expression become in blood vessel.Wherein, Fig. 8 A are healthy human femoral artery (Healthy Femoral Artery, HFA) Xiang Yudong Lower limb femoral artery (Diseased Femoral Artery, DFA) HE testing result figures of the disease patients such as pulse atherosclerosis.；Figure 8B shows for testing result figures of the miR-22 and its target gene EVI-1 in people normally and in lesion vesselses；Fig. 8 C are shown as miR-22 With correlation analysis result figures of its target gene EVI-1 in healthy blood vessel and lesion vesselses.

Embodiment

EVI-1 be leukemic prognosis judge independent risk factor, therefore the research to it also concentrate on hemopoietic system with And related tumor area, relevant report is had no at present in cardiovascular field, and the present invention is found surprisingly that by genescreen Effects of the EVI-1 in Phenotypic Change of Smooth Muscle Cells.With going deep into for research, we are used to control by its inhibitor creativeness Aberrant angiogenesis remoldability disease is treated, achieves the effect of fabulous.

With reference to embodiment, the invention will be further described.

The EVI-1 of embodiment 1 take part in Phenotypic Change of Smooth Muscle Cells process.

Mouse primary aortic smooth muscle cell is separately cultured using enzyme digestion.Experiment vascular smooth muscle cells used Choose P3-P12.Using 10%FBS-DMEM culture mediums, (FBS is purchased from Gibco to primary aortic smooth muscle cell, and DMEM is purchased from Hyclone) cultivated in 37 DEG C of 5%CO2 incubators.

Vascular smooth muscle cells stimulate packet：Normally 48 hours groups of culture, non-serum starved 48 hours groups and serum-free are hungry Starving 24 hours+5ng/ml TGF-βs stimulates 24 hours groups.Smooth muscle cell collects cell RNA after being handled by above-mentioned packet, Expression of the related target gene during Phenotypic Change of Smooth Muscle Cells is detected using RT-qPCR to change.Figure 1A result shows, EVI-1 is substantially reduced after non-serum starved 24 hours of smooth muscle cell, and further 5ng/ml TGF-βs stimulate its lower expression It is horizontal further to decline.

The model of natural Phenotypic Change:Sustainer is separated from mouse, it is thin to cultivate primary smooth muscle using enzyme digestion Born of the same parents, normal Secondary Culture, P0, P3, P8, P9, P12 cell are taken, RNA, RT-qPCR detection related genes are extracted with TRIZOL methods Expression.Figure 1B result is shown, with the increase of cell algebraically, EVI-1 expression gradually increases.

Result above shows that EVI-1 take part in Phenotypic Change of Smooth Muscle Cells process.

The EVI-1 of embodiment 2 regulates and controls the Phenotypic Change of smooth muscle cell.

EVI-1 genes stably strike the foundation of low cell line.EVI-1shRNA plasmid constructions, shRNA sequences：Evi1- shRNA-F:5'-CCGGCAGGTACTGTGGCAAGATATTCTCGAGAATATCTTGCCACAGTACCTGTTTTTG-3' (SEQIDNO.2)；Evi1-shRNA-R:5'- AATTCAAAAACAGGTACTGTGGCAAGATATTCTCGAGAATATCTTGCCACAGTACCTG-3'(SEQ ID NO.3).Matter Grain structure needs to play a role by further virus packaging after completing：(1) 293T cells cellar culture, passage, passage It is optimal that ratio reaches 80% according to requirement of experiment in second angel's cell density.(2) using TransIT-X2, (mirusbio is public Take charge of agent cotransfection Evi1-shRNA plasmids or control plasmid, pUMVC and pCMV-VSV-G enter 293T cells (in strict accordance with company Operation instruction).(3) conventional medium is changed after transfection overnight.Cell supernatant is collected after (4) 48 hours, centrifugation, filtering, is concentrated, The slow virus concentrate of high titre is obtained, -80 DEG C of packing preserve.(5) for the titre detection of virus, we employ slow virus Coat protein p24 immunology ELISA schemes.The kit of use is QuickTiter^TM Lentivirus Titer Kit (Lentivirus-Associated HIV p24)。

Slow virus infected cell (exemplified by 6 orifice plates)：(6) smooth muscle cell routine passage.Cell density is about 80% or so For the optimal density of infection of virus.(7) the infection same day changes former culture medium, and adding 1mL virus liquids+1ml in every hole of 6 orifice plates maintains training Base is supported, the efficiency of infection that Polybrene (10ug/mL) improves virus is added, 6 orifice plates is placed in 37 DEG C of 5%CO2 incubator mistakes Night.After (8) 24 hours, use the 10%FBS+DMEM culture mediums that puromycin concentration is 4 μ g/ml instead and metainfective cell is entered Row screening.(infecting successful cell with puromycin resistance gene) (9) changed the fresh cultured containing the antibiotic every 2-3 days Base once, until the cell survived after 7-10 days is the cell of stable expression puromycin resistance gene.(10) cell Pass on and use 10%FBS+DMEM conventional medium culture instead.(11) collection cell is needed to do corresponding detection according to experiment. Fig. 2A and Fig. 2 B are shown, compared with control group, EVI-1 mRNA and protein expression level significantly drop in EVI-1shRNA cell lines Low, cell line successfully constructs.

Cellular control unit and EVI-1 genes stably strike low cell after non-serum starved 24 hours, are stimulated with 20%FBS 48 hours, sample detection was received afterwards.Fig. 2 C and Fig. 2 D are shown, compared with control group, EVI-1shRNA group smooth muscle cell contraction bases Cause and transcription factor expression are significantly raised.

Brdu is tested：I uses the BrdU kits of Roche companies, and experimental implementation is strictly entered by kit step specification OK.(1) experiment is carried out using 96 orifice plates, and all cell non-serum culture mediums are hungry 24 hours, after changed into according to experimental design 20%FBS+DMEM or 10ng/ml PDGF-BB+DMEM culture mediums stimulate 15-20 hours.(2) 10ul BrdU labelled reagents drip Enter every hole mark cell.(3) cell continues to cultivate 10-12 hours.(4) original culture medium is removed.(5) 200ul 10%FBS are used PBS wash 3 volumes.(6) plus 250ul 0.5M HCl (hydrochloric acid) and 70%Ethanol (ethanol) configure the cell fixer formed ,- 20 DEG C are fixed 30 minutes.(7) remove fixer, 3 volumes are washed with 200ul 10%FBS PBS.(8) addition 200ul nucleases, 37 DEG C 30 minutes.(9) remove nuclease, 3 volumes are washed with 200ul 10%FBS PBS.(10) the anti-BrdU antibody-solutions of 100ul are added, 37 DEG C 30 minutes.(11) remove anti-BrdU antibody-solutions, washed three times with 200ul cleaning buffer solutions.(12) 100ul peroxidating is added Thing zymolyte, normal temperature are incubated 20-30 minutes, at this time it may be seen that liquid color is as reaction carries out gradual greening and adds It is deep.(13) ELIASA is put into after mixing, reads numerical value of the sample in 405/490nm wavelength, data is obtained and carries out statistical analysis.Figure 2E shows that suppressing EVI-1 can substantially suppress to stimulate caused smooth muscle cell proliferation by high concentration FBS and PDGF.

Transwell is tested：(1) DMEM of smooth muscle cell serum-free is hungry 24 hours.(2) sterile PBS washes 1 time, pancreas Enzymic digestion cell, it is transferred to after being neutralized with 10%FBS+DMEM culture mediums in 15ml centrifuge tubes.(3) 1000 × rpm centrifuge 5 points Clock.(4) supernatant is abandoned, cell is resuspended with serum-free DMEM.(5) cell count, cell is added according to the cell concentration of Room 30000/. (6) 20%FBS+DMEM or 30ng/ml PDGF-BB+DMEM are added in lower room to induce ventricular cell to creep downwards.(7) by 24 Well culture plate moves to cell culture incubator together with cell, cultivates 12-20 hours.(8) to after the time, 24 are taken out from cell culture incubator Well culture plate is simultaneously gently pressed from both sides out cell from culture plate with tweezers, and PBS is washed 3 times.(9) cell is put into 4%PFA, normal temperature is solid Fixed 30 minutes, PBS is washed 3 times.(10) 0.1% crystal violet normal temperature are dyed 15 minutes, and PBS is washed 3 times.(11) cell is cut with scalpel On pore membrane.(12) outside is put on wave carrier piece upwardly, mountant mounting in drop.(13) micro- Microscopic observation, take it is upper and lower, Left and right five visuals field, count cell, statistical analysis.Fig. 2 F show that suppressing EVI-1 can substantially suppress by high concentration FBS and PDGF Stimulate caused smooth muscle cell migration.

It is above-mentioned test result indicates that, EVI-1 has important adjustment effect in the Phenotypic of smooth muscle cell.

Embodiment 3.EVI-1 Transcription inhibitions vascular smooth muscle cells specificity shrinks gene table.

Cell transfecting：Related plasmids intravasation smooth muscle cell is transfected (with 24 using TransIT-X2TM transfection reagents The hole of well culture plate one).(1) smooth muscle cell cellar culture, passage, passage ratio are close in second angel's cell according to requirement of experiment It is optimal that degree, which reaches 80%,.(2) TransIT-X2TM transfection reagents are mixed before using.(3) following reagent is matched somebody with somebody according to protocol. Serum-free DMEM 50ul；Plasmid 200ng；TransIT-X21.5ul (4) was stored at room temperature more than or equal to 30 minutes, made mix reagent Liquid fully is changed with reference to (5) cell, adds the 2%FBS+DMEM of Fresh culture medium.(6) transfection cocktail is uniformly instilled In orifice plate.Collection of cellular samples detects after (7) 48 hours.

Luciferase detects：Utilize Dual-Luciferase Reporter Assay System (E1910, Promega) Kit carries out luciferase assays with reference to its specification, with firefly luciferase numerical value divided by β-gal readings, you can The uciferase activity numerical value corrected.With one luciferase reporting base (pGL3- of TransIT-X2 transfection reagents cotransfection Luc-SMA/pGL3-Luc-mus_SM22a/pGL3-Luc-mus_SMaA-SRF_bs1_mu/pGL3-Luc-mus_SM22a- SRF_bs1/2_mu/pGL3-Luc-mus_SRF/pGL3-Luc-mus_Myocardin) and pmiR- β-gal control plasmids enter Enter EVI-1 genes and stably strike low cell line (EVI-1shRNA) and its control cell lines (Non-target).Detected after 48 hours Uciferase activity and β-gal activity.

Fig. 3 A and Fig. 3 B show that the two smooth muscle contractility gene promoters of SMaA and SM22a can be activated by suppressing EVI-1 Activity, but when we transfect pGL3-Luc-mus_SMaA-SRF_bs1_mu or pGL3-Luc-mus_SM22a-SRF_bs1/ When 2_mu plasmids, this activation is wholly absent.EVI-1 is prompted to start smooth muscle contractility gene SMaA, SM22a The activation of sub- activity is implemented in combination with by SRF.Fig. 3 C and Fig. 3 D results show, suppress EVI-1 can activate SRF and The activity of the two smooth muscle contractility gene transcription factor promoters of Myocardin.

Chromatin immune co-precipitation experiment (CHIP)：EVI-1 antibody comes from abcam companies employed in this experiment.CHIP Millipore 17-371EZ CHIP KIT agent box comes from Merck Millipore companies used by testing us.Operation is tight Lattice are carried out to specifications.Step is as follows：(1) EVI-1shRNA cell line and its 24 small to impinging upon serum free medium starvation When after use instead 20%FBS+DMEM culture mediums stimulate 48 hours.(2) 16% is added into each culture dish containing nutrient solution Formaldehyde crosslinking albumen and DNA, formaldehyde final concentration of 1%, gently rock culture dish, mix.(3) add then in above-mentioned culture dish The glycine solution for entering 10X terminates crosslinking.(4) cell is collected：After cold PBS three times, scraping cells are scraped with cell.(5) use Lysate RIP buffer 500ul (120mM NaCl+25mM Tris+1mM EDTA+0.5%NP-40+ protease inhibitors+ RNase inhibitor) 20-30 minute cell lysis on ice, (6) ultrasonication：VCX750,25% power, 10s impact, between 10s Gap.Totally 15 times.(7) 40ul aforesaid liquids purifying DNA is taken to survey concentration.(8) will be dense between each sample with RIP buffer according to concentration Degree is diluted to consistent.And 50ul is taken to be stored in -20 DEG C (9) as in-putMagnetic bead 10ul adds 500ul RIP buffer, supernatant is removed using magnetic separator absorption magnetic bead, washes 3 times, is finally resuspended in 100ul RIP buffer. (10) add IgG corresponding to 5ugEVI-1 its each kind as control, overturning rotation under normal temperature mixes 1 hour, make antibody with Magnetic bead combines and prepares antibody-bead complexes.(11) antibody-bead complexes are adsorbed with magnetic separator, remove Excess antibody, 500ul RIP buffer are washed 3 times, and it is standby to be finally resuspended in 900ul RIP buffer.(12) product after 100ul ultrasonications 900ul antibody-bead complexes are added, 4 DEG C of reverse rotations are overnight.(13) second days utilization magnetic separator adhesion proteins-anti- Body-bead complexes, uncombined albumen is removed, 500ul RIP buffer are washed 5-6 times, 500ul low salt wash Buffer is washed 1 time, and 500ul highsalt wash buffer are washed 1 time, and 500ul LiCl wash buffe wash 1 time, finally 500ul TE buffer are washed 2 times.(14) after cleaning, start to elute.The formula of eluent：100 μ l 10%SDS, 100 μ l 1M NaHCO3,800 μ lddH2O, common 1ml.(15) often pipe adds 120 μ l elution buffer, and top turns 15 minutes at room temperature, magnetic Separator adsorbs magnetic bead, collects supernatant.(16) 48ul 5M NaCl (the final concentration of 0.2M of NaCl) are often added in pipe, are mixed. (17) 65 DEG C of solution crosslinkings are overnight.(18) after solution crosslinking terminates, often pipe adds 2ul 10mg/ml Proteinase Ks and 2ul 10mg/ml RNaseA, 45 DEG C 1 hour, digestible protein, RNA etc..(19) magnetic separator absorption magnetic bead, supernatant are transferred to new 0.5ml EP Guan Zhong.(20) DNA is collected with DNA Purification Kits, qPCR carries out coherent detection.Fig. 3 E are shown, compared with control group, EVI-1shRNA groups EVI-1 smooth muscle contractility gene SMaA, SM22a promoter region and its idiosyncratic transcription factor SRF, Myocardin promoter region enrichment is obvious to be reduced.

In summary, EVI-1 by be directly incorporated in the promoter region of smooth muscle contraction gene and its transcription factor come Regulate and control its expression.

Embodiment 4.miR-22 regulates and controls Phenotypic Change of Smooth Muscle Cells.

MiR-22 mature sequences are 5 '-AAGCTGCCAGTTGAAGAACTGT-3 ' (22bp, SEQ ID NO.1), can be passed through Chemical synthesis, viral vector mediation miR-22 expression two ways obtain：

(a) chemical synthesis

MiR-22 analogies (miRNA mimic or agomir) or inhibitor (miRNA inhibitor or Antagomir) synthesized by Guangzhou Rui Bo bio tech ltd, endogenous sexal maturity miR-22 high level expressions or suppression can be simulated Make its expression；Standard purification, in -20 DEG C of preservations.Be configured to 25 μM of storing liquid with the water dissolving without RNase, put -80 DEG C it is standby With the used time is diluted to required concentration.

(b) viral vector mediation miR-22 expression

(1)miRBase(http://www.mirbase.org/) miR-22 mature sequence and precursor is obtained in database Sequence (pre-miRNA) information.The flank sequence in each about 200~300bp in mature sequence both sides is found in genome database Row, according to flanking sequence design pair of primers, and XhoI and Hpa I restriction enzyme site and corresponding protection base are added respectively, - GTGCTC the GTTAACCTGCCCTTTGAATGCCGAAG-3 ' of sense primer 5 ' (SEQ ID NO.4) and anti-sense primer 5 '- GTGCTCCTCGAGGGGGAGGTGGAGTCACCTAT-3’(SEQ ID NO.5).(2) genomic DNA is template, passes through design Primer enter performing PCR amplification, PCR reaction conditions be 95 DEG C preheat 2 minutes, 95 DEG C 30 seconds, 55 DEG C 30 seconds, 72 DEG C 50 seconds carry out 35 Individual circulation, 72 degree extend 5 minutes.(3) by after the PCR primer agarose gel electrophoresis of amplification, said by the operation of glue reclaim kit It is bright to be reclaimed.(4) double digestion and then with restriction enzyme XhoI and Hpa I (TAKARA) is carried out, by the PCR pieces after digestion Section is used as Insert Fragment, PLV/EGFP slow virus carriers (match industry (Guangzhou) after being reclaimed by DNA purification kit operating instructions Bio tech ltd).Carrier with XhoI and Hpa I (TAKARA) carry out double digestion after, using with recovery PCR primer it is identical The step of purified.By Insert Fragment and carrier segments (mol ratio=3:1~10:1) (5) utilize T4 ligases (Thermo Scientific companies) connection is overnight.(6) JM109 cells (Promega), 37 DEG C of overnight incubations and then by connection product are converted The good single bacterium colony of picking growing state is expanded in the LB nutrient solutions containing carrier corresponding antibiotic afterwards.(7) matter is extracted Grain (GenElute Plasmid Miniprep Kit kits, SIGMA-ALDRICH companies) carries out sequence verification afterwards (Invitrogen)。

DNA vector can be transfected into cell, transient expression miR-22, carry out correlation function research；MiR-22 slow virus is packed It is similar with EVI-1shRNA virus formulations and Establishment of Cell Line method with the method for building up of miR-22 high-expression cell lines.

It is as follows that the miR-22 obtained by any of the above-described method regulates and controls smooth muscle cell：Cell transfecting receives sample after 48 hours, Carry out RT-qPCR detections.Fig. 4 A- Fig. 4 B show that transfection miR-22mimics or miR-22inhibitor significantly can be raised or dropped Low miR-22 expression.Fig. 4 C- Fig. 4 D are shown：MiR-22 regulates and controls smooth muscle gene expression.Cell is bred and migration experiment packet： MiRNA mimics control groups, miR-22mimics groups, miRNA inhibitor control groups, miR-22inhibitor groups.Carefully Dysuria with lower abdominal colic changes serum-free DMEM after contaminating 12 hours is hungry 24 hours, then changes the culture containing high concentration FBS and PDGF stimulating factor Base stimulates smooth muscle cell proliferation and migration.Fig. 4 E- Fig. 4 F show that vascular smooth muscle cell proliferation can be suppressed by being overexpressed miR-22 And migration；Fig. 4 G- Fig. 4 H show that vascular smooth muscle cell proliferation and migration can be increased by suppressing miR-22.

In summary, miR-22 opens important function during Phenotypic Change of Smooth Muscle Cells.

Embodiment 5.miR-22 direct regulations and controls EVI-1.

Fig. 5 A are miR-22 and EVI-1 binding site and mutational site sequence.We are in vascular smooth muscle cells MiR-22mimics or miR-22inhibitor is transfected, EVI-1 expression is detected with RT-qPCR and Western-blot, Fig. 5 B- Fig. 5 C show that EVI-1 mRNA and albumen expression can be significantly inhibited by being overexpressed miR-22, and when we suppress miR- When 22, EVI-1 mRNA and protein expression are significantly raised.Us are prompted in vascular smooth muscle cells, EVI-1 be by MiR-22 regulation and control.Whether suppress EVI-1 expression by being applied directly on the UTR of EVI-1 3 ' for research miR-22, I Used the pmiR-Luc-EVI-1 luciferase reporter gene plasmids containing miR-22 binding sites.Fig. 5 D are shown, are overexpressed MiR-22 can significantly inhibit the activity of the UTR reporter genes of EVI-1 3 ', and the UTR of EVI-1 3 ' reports can substantially be activated by suppressing miR-22 Accuse the activity of gene.More crucially, when we are mutated to the binding site of miR-22 on the UTR of EVI-1 3 ' Wait, Fig. 5 E are shown, are overexpressed the effect of the UTR reporter gene activities of the EVI-1 3 ' rise caused by miR-22 and are wholly absent.

The above results are prompted, and miR-22 directly in conjunction with the UTR of EVI-1 3 ' by regulating and controlling its expression.

The EVI-1 of embodiment 6 can mediate miR-22 modulating vascular smooth muscle cell contraction gene expressions and function to change.

Whether EVI-1 mediates miR-22 modulating vascular smooth muscle cell contraction gene expressions and function to change, and we are not It is clear.Our experiment is divided into four groups：MiRNA ctrl/non-target groups, miR-22inhibitor/non-target groups, MiRNA ctrl/EVI-1shRNA groups, miR-22inhibitor/EVI-1shRNA groups.Cell receives sample, RT-PCR after transfection Detection, Fig. 6 A are shown, miR-22inhibitor groups and the obvious reduction of EVI-1shRNA groups miR-22 and EVI-1 expression, are suppressed MiR-22 can significantly raise EVI-1 expression.Smooth muscle cell contraction gene expression reduction can be made by individually suppressing miR-22, individually suppression EVI-1 processed can raise smooth muscle contraction gene expression.And miR- can be completely eliminated by suppressing EVI-1 while miR-22 is suppressed Vascular smooth muscle cells caused by 22 suppression are shunk gene expression and declined.Further functional experiment also achieves similar As a result, BRDU the and Transwell results in Fig. 6 B and Fig. 6 C show, individually suppressing miR-22 can increase promotion smooth muscle cell Grow and migrate, individually suppress EVI-1 and suppress smooth muscle cell proliferation and migration.And suppress EVI-1 while miR-22 is suppressed The increase of vascular smooth muscle cell proliferation and transfer ability caused by miR-22 suppression can be offset.

The above results, which fully demonstrate EVI-1, can mediate miR-22 modulating vascular smooth muscle cell contraction gene expressions and work( It can change.

Embodiment 7. is overexpressed neointima caused by miR-22 substantially suppresses seal wire damage in body blood vessel

Mouse femoral artery seal wire Establishing an injured model：The model is using male C57BL/6 wild-type mices, 8-14 weeks Week old, 25-30 grams of body weight.(1) all surgical instrument disinfections, operating table paving aseptic towel.Anesthetic：8mg/ml ketamines+1mg/ Ml xylazines.(2) according to the dosage of 100ul/mg anesthetic, intraperitoneal injection of anesthesia mouse.(3) mouse is fixed on hand after anaesthetizing On art platform, field of operation hair is removed using special depilatory cream.(4) routine disinfection, operating scissors cut off medial thigh skin, exposure Blood vessel.(5) microforceps blunt separation goes out femoral artery,superficial.(6) 0.25mm spring-guide wires are inserted into femoral artery,superficial, until femoral artery master It is dry.(7) by seal wire push-and-pull 3 times back and forth repeatedly in the blood vessels, it is statically placed in after push-and-pull intravascular about 5 minutes.After (8) 5 minutes Seal wire slowly is exited, ligatures femoral artery,superficial with 6/0 silk thread, suture needle skin suture simultaneously sterilizes.(9) needed according to experiment when specific Between point carry out receipts sample, row pathological analysis and RNA detections.

Experiment packet is as follows：+ PF127 groups, simple damage+intervention control group (PF127+Cel-miR- are not damaged 67agomiR), simple damage+miR-22 intervention groups (PF127+miR-22agomiR).Experimental procedure：(1) it is according to concentration 2.5nmol/100ul, agomiR-22 or Cel-miR-67agomiR is compareed to the 30%pluronic for being mixed into precooling and being in a liquid state In F-127 glue.(pluronic F-127 glue liquid at 4 DEG C, normal temperature become solid-state) (2) mouse femoral artery seal wire trauma surgery Afterwards, pre- mixed 100ul PF-127 glue is uniformly wrapped in around femoral artery.(3) need to check and accept in special time according to experiment Collect sample, row tectology and the horizontal detection of related gene expression.

Fig. 7 A results are shown, compared with normal blood vessels group, injured blood vessel group miR-22 is substantially reduced, but transfect miR- The miR-22 expression of 22agomiR groups is significantly raised, prompts perivascular parcel to contain miR-22agomiaR Pluronic glue energy Success expression miR-22 high in vivo.Fig. 7 B results show that EVI-1 table can be significantly inhibited by being overexpressed miR-22 in body blood vessel Reach.

Mouse blood vessel is drawn materials and specimens paraffin embedding slices：(1) mouse CO2 asphyxias are put to death, and are positioned on operating table.(2) cut off Skin, microforceps blunt separation femoral artery, observe blood vessel state.(3) microforceps breaks ring right auricle of heart, and catheter needle is inserted at the apex of the heart Enter until aortic root.(4) with PBS lavations about 5 minutes.(5) 4%PFA lavations are used instead about 15 minutes, fixed blood vessel.(6) show Micro- clip target vessel, it is put into 4%PFA, 4 DEG C of refrigerator overnights.(7) blood vessel is dehydrated, and FFPE is made wax stone and (can protected for a long time Deposit).(8) paraffin mass is cut into slices, and paster, is dried stand-by.

Blood vessel paraffin section HE staining analysis：(1) dimethylbenzene (I) 15 minutes.(2) dimethylbenzene (II) 15 minutes.(3) diformazan Benzene：(III) 15 minutes.(4) 100% ethanol 5 minutes.(5) 90% ethanol 5 minutes.(6) 70% ethanol 5 minutes.(7) distilled water 5 Minute.(8) bush seminal fluid dyes 5 minutes.(9) 1% acidic alcohol 1-3s.(10) slowly flowing water is washed 30 minutes.(11) 0.5% she Red liquid dyes 1-3 minutes.(12) distilled water slightly washes 1-2s.(13) 90% ethanol 5 minutes.(14) 100% ethanol (I) 5 minutes. (15) 100% ethanol (II) 5 minutes.(16) dimethylbenzene (I) 5 minutes.(17) dimethylbenzene (II) 5 minutes.(18) tissue instills Neutral gum, cover glass progressively cover down mounting (avoiding producing bubble) from one end.(19) micro- Microscopic observation is taken pictures and analyzed. Fig. 7 C- Fig. 7 D are shown, compared with control group, the pathologic endometrial hyperplasia of miR-22 overexpression groups significantly reduces (nearly 60%).

The above results fully prove that being overexpressed miR-22 in body blood vessel can cause by suppressing EVI-1 mitigation seal wire damages Neointima.

The differential expression of embodiment 8.miR-22 and its target gene in people normally and in lesion vesselses

In order to which achievement in research is grafted onto into clinic from basis.We collect Healthy People and the lower limb vascular tissue of patient, and one In portion of tissue storage and formalin, follow-up dehydration, FFPE, section, HE dyeing.Fig. 8 A are shown, are moved with Healthy People stock Arteries and veins (Healthy Femoral Artery, HFA) is compared, the lower limb femoral artery of the disease patient such as atherosclerosis (Diseased Femoral Artery, DFA) visible obvious abnormal neointima, lesion are obvious.

Another part tissue freezing extracts in liquid nitrogen for RNA, RT-qPCR detection related gene expression changes.Figure 8B is shown, compared with healthy blood vessel, the miR-22 expression of lesion femoral artery reduces, and its target gene EVI-1 expression rises.Fig. 8 C Pearson's correlation coefficient analysis display, either in normal blood vessels or lesion vesselses, miR- 22 expression and and its target gene EVI-1 all exist it is obvious negatively correlated.

The above results show that miR-22 and its target gene EVI-1 take part in the abnormal of human vas and reconstruct.

Claims (4)

1.EVI-1 inhibitor is preparing the application in being used to treat the medicine of aberrant angiogenesis remoldability disease.

2. application according to claim 1, it is characterised in that the EVI-1 inhibitor includes microRNA：miR-22- The 3p ,-AAGCTGCCAGTTGAAGAACTGT-3 ' of sequence 5 ' (SEQ ID NO.1).

3. application according to claim 1, it is characterised in that microRNA is the microRNA of chemical synthesis, or is The microRNA of plasmid vector expression.

4. application according to claim 1, it is characterised in that the EVI-1 inhibitor can also include small molecule EVI-1 ShRNA, sequence are：

Evi1-shRNA-F:5'-CCGGCAGGTACTGTGGCAAGATATT CTCGAG

AATATCTTGCCACAGTACCTG TTTTT G-3'(SEQ ID NO.2)。

Evi1-shRNA-R:5'-AATTCAAAAA CAGGTACTGTGGCAAGATATT CTCGAGAATATCTTGCCACAGTACCTG-3'(SEQ ID NO.3)。