CN104726500B - Application of the MicroRNA26b 3p inhibitor in people's umbilical cord derived mesenchymal stem cell is prepared - Google Patents
Application of the MicroRNA26b 3p inhibitor in people's umbilical cord derived mesenchymal stem cell is prepared Download PDFInfo
- Publication number
- CN104726500B CN104726500B CN201510107949.6A CN201510107949A CN104726500B CN 104726500 B CN104726500 B CN 104726500B CN 201510107949 A CN201510107949 A CN 201510107949A CN 104726500 B CN104726500 B CN 104726500B
- Authority
- CN
- China
- Prior art keywords
- umbilical cord
- people
- stem cell
- derived mesenchymal
- mesenchymal stem
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The present invention relates to biological technical field, the invention provides application of the MicroRNA26b 3p inhibitor in the reagent for promoting people's umbilical cord derived mesenchymal stem cell propagation is prepared, the reagent includes but is not limited to:1) MicroRNA26b 3p inhibitor;2) recombinant vector containing MicroRNA26b 3p inhibitor encoding genes;3) recombinant virus containing MicroRNA26b 3p inhibitor encoding genes;4) recombinant viral vector containing MicroRNA26b 3p inhibitor encoding genes.The present invention significantly improves the growth rate of people's umbilical cord derived mesenchymal stem cell it is demonstrated experimentally that MicroRNA26b 3p inhibitor can increase the expression of ERs.The cell that the present invention obtains the clinical practice of mescenchymal stem cell in regenerative medicine for people's umbilical cord derived mesenchymal stem cell fast breeding and faster provides new thinking and mode.
Description
Technical field
The present invention relates to biological technical field, more particularly to-kind of MicroRNA26b-3p inhibitor comes in preparation people's umbilical cord
Application in the mescenchymal stem cell of source, namely a kind of method for promoting people's umbilical cord derived mesenchymal stem cell to breed, and its should
Method is applied to prepare organizational project cell.
Background technology
Mescenchymal stem cell (MSC) is the stem cell remained in adult tissue, with unlimited amplification and Multidirectional Differentiation energy
Power, convenient acquisition, relatively low immunogenicity, the trophic factors without dispute of ethic and secretion due to MSC cells, can press down
Immune response processed, promotion vascularization, nutrition periphery cell, and it is careful to be expected to turn into a kind of exciting kind in regenerative medicine
Born of the same parents.An item data NIH official websites in 2011, lists 19364 cell therapy cases, wherein 206 are that MSC cells are related
, for treating various clinical lesion, part Experiment has arrived at the clinical test III phases.(Wang S,Qu X,Zhao
RC.Clinical applications of mesenchymal stem cells [J] .J Hematol Oncol, 2012,5:
19.) still, human mesenchymal stem cell in-vivo content is few, in marrow, also only occupies the 0.001- of monocyte
0.01%, amplification in vitro culture can cause with the related aging of cell proliferative block agent, and more than the part treatment of cell after 5 generations
Characteristic can be lost, currently used for treatment use MSC cell requirements amount substantially all in 1.0-2.0 × 106MSCs/kg, these are all
It strongly limit its application in clinical treatment.(Ikebe C,Suzuki K.Mesenchymal Stem Cells for
Regenerative Therapy:Optimization of Cell Preparation Protocols[J].Biomed Res
Int, 2014,951512.).Mescenchymal stem cell can be isolated from Various Tissues, wherein between just including umbilical cord source
Mesenchymal stem cells, existing many researchs report that it is obtained not in wound healing, ischemic brain damage and neurodegenerative disease
Wrong curative effect, in addition its convenient material drawing, be preferable regenerative therapy cell to human body fanout free region, possess more preferable multiplication capacity,
It is the same with other types mescenchymal stem cell, also it is faced with limited multiplication capacity and cultured cell in vitro dryness progressive is lost
The problem of.
MiRNA, is endogenic small short, the single-stranded non-coding RNA molecule of a group, is about made up of 22 nucleotides, can
Target mrna degradation is caused by incomplete base complementrity and the specific combination of said target mrna or suppresses protein translation, so as to regulate and control
Expression (Eulalio A, Huntzinger E, the Izaurralde E.Getting to the root of miRNA- of gene
mediated gene silencing[J].Cell,2008,132(1):9-14.).MicroRNA has regulated and controled in vivo about 60%
The expression of albumen coded sequence, and a microRNA molecule can target several mRNA, and increasing evidence at present
Show, microRNA participates in many physiology course (Clark such as regulation and control MSC differentiation, propagation, survival, migration in animal and human body
EA,Kalomoiris S,Nolta JA,et al.Concise review:MicroRNA function in
multipotent mesenchymal stromal cells[J].Stem Cells,2014,32(5):1074-1082).Most
Nearly research report miR-26b lowered in the expression quantity of many tumour cells such as liver cancer, lung cancer (Liu XX, Li XJ, Zhang B,
et al.MicroRNA-26b is underexpressed in human breast cancer and induces cell
Apoptosis by targeting SLC7A11 [J] .FEBS Lett, 2011,585 (9):1363-7.), and miR-26b
In breast cancer can by target PTGS2, CDK8 equimolecular suppress cancer cell propagation (Li J, Kong X, Zhang J,
Luo Q,et al.MiRNA-26b inhibits cellular proliferation by targeting CDK8in
breast Cancer、MiRNA-26b inhibits proliferation by targeting PTGS2in breast
Cancer [J] .Cancer Cell Int, 2013,13 (1):7.).
MiR-26b includes sub-district positioned at host gene CTDSPs's, through transcription generation miR-26b-5p and miR-26b-3p
Two kinds of microRNA molecule (http://www.mirbase.org/).Although the research of microRNA and cell function is increasingly
It is many, but the document report of the MicroRNA26b-3p researchs related to people's umbilical cord derived mesenchymal stem cell and application is there is no at present
Road.
The content of the invention
It is an object of the invention to provide the new application of MicroRNA26b-3p inhibitor, another object of the present invention is to
A kind of method for promoting people's umbilical cord derived mesenchymal stem cell to breed is provided, the third object of the present invention is to provide
MicroRNA26b-3p inhibitor promotes people's umbilical cord derived mesenchymal stem cell to increase using MicroRNA26b-3p inhibitor
Application of the method grown in organizational project cell is prepared.
The present invention carries to overcome the slow defect of propagation in people's umbilical cord derived mesenchymal stem cell in vitro culture (preparation)
Clinical application effect of the high people's umbilical cord derived mesenchymal stem cell in regenerative medicine there is provided by MicroRNA-be specially
MicroRNA26b-3p inhibitor promotees to realize the new method of people's umbilical cord derived mesenchymal stem cell fast breeding.
MicroRNA26b-3p (MIMAT0004500) of the present invention, through searching miRBase databases, its sequence is such as
Under:CCUGUUCUCCAUUACUUGGCUC(SEQ ID NO:1).
The first aspect of the present invention is being prepared there is provided MicroRNA26b-3p new application, i.e. MicroRNA26b-3p
Promote the application in the reagent of people's umbilical cord derived mesenchymal stem cell propagation.
Further, people's umbilical cord derived mesenchymal is promoted to do in preparation the invention provides MicroRNA26b-3p inhibitor
Application in the reagent of cell propagation.
The reagent of the present invention for promoting people's umbilical cord derived mesenchymal stem cell to breed, is to refer to suppress or lower
The reagent of MicroRNA26b-3p expression quantity.
The described reagent that can suppress or lower MicroRNA26b-3p expression quantity, includes but is not limited to following any:
A) MicroRNA26b-3p inhibitor;
B the recombinant vector) containing MicroRNA26b-3p inhibitor encoding genes;
C the recombinant virus) containing MicroRNA26b-3p inhibitor encoding genes;
D the recombinant viral vector) containing MicroRNA26b-3p inhibitor encoding genes.
In a preferred embodiment of the invention, described MicroRNA26b-3p inhibitor, particular sequence is as follows:
GAGCCAAGUAAUGGAGAACAGG(SEQ ID NO:2)。
Promotion people's umbilical cord derived mesenchymal stem cell propagation of the present invention, refers under conditions of in vitro culture, passes through
Plasmid transfection or the mode of slow-virus infection suppress or it is lower mediator umbilical cord derived mesenchymal stem cell in MicroRNA26b-3p
Expression quantity.
The present invention the experiment proved that, be compared with negative control, be filled between people's umbilical cord source of MicroRNA26b-3p low expressions
Matter stem cells hyperplasia speed is accelerated.
There is provided a kind of method for promoting people's umbilical cord derived mesenchymal stem cell to breed, this method for the second aspect of the present invention
Including:Build a kind of people's navel for suppressing or lowering MicroRNA26b-3p expression quantity (also referred to as MicroRNA26b-3p low expressions)
Band derived mesenchymal stem cell.
It is preferred that this method is including I) and III) or II) and III):
I) artificial synthesized MicroRNA26b-3p suppression body, through liposome transfection, obtains the low tables of MicroRNA26b-3p
The people's umbilical cord derived mesenchymal stem cell reached;
II) recombinant vector, structure containing the MicroRNA26b-3p encoding genes for suppressing body is built to contain
MicroRNA26b-3p suppresses the recombinant virus of the encoding gene of body, or builds the coding for suppressing body containing MicroRNA26b-3p
The recombinant viral vector (referred to as GFP-MIR-26b-3p) of gene;
By the recombinant vector of acquisition, recombinant virus, or recombinant viral vector transfected with human umbilical cord derived mesenchymal stem cell, obtain
Obtain people's umbilical cord derived mesenchymal stem cell of MicroRNA26b-3p low expressions;
III) step I) or people's umbilical cord derived mesenchymal stem cell of MicroRNA26b-3p low expressions for II) obtaining, it is put into
37 DEG C of 5% CO2gas incubator quiescent culture, the same people's umbilical cord derived mesenchymal stem cell not processed of used medium,
For 10% hyclone, DMEM in high glucose.
The present invention is in people's umbilical cord derived mesenchymal stem cell culture, using Edu incorporation methods (Peng F, Wu H, Zheng
Y,et al.The effect of noncoherent red light irradiation on proliferation and
osteogenic differentiation of bone marrow mesenchymal stem cells[J].
Lasers Med Sci,2012,27(3):645-53.) the propagation speed of measurement people's umbilical cord derived mesenchymal stem cell
Degree, finds to be overexpressed people's umbilical cord derived mesenchymal stem cell of MicroRNA26b-3p inhibitor, than the people for transfecting negative control
Umbilical cord derived mesenchymal stem cell, growth rate is dramatically speeded up.
The third aspect of the present invention answering in organizational project cell is prepared there is provided MicroRNA26b-3p inhibitor
With, and or it is a kind of promote the method for people's umbilical cord derived mesenchymal stem cell propagation in organizational project cell is prepared should
With.
(also referred to as attach most importance to present invention obtains a kind of people's umbilical cord derived mesenchymal stem cell of MicroRNA26b-3p low expressions
Group people's umbilical cord derived mesenchymal stem cell), described recombined human umbilical cord derived mesenchymal stem cell further applies preparation group
Knit engineering cell.
There is provided a kind of product for having and promoting people's umbilical cord derived mesenchymal stem cell propagation for the fourth aspect of the present invention
(reagent), described active component is following any:
A) MicroRNA26b-3p inhibitor;
B the recombinant vector) containing MicroRNA26b-3p inhibitor encoding genes;
C the recombinant virus) containing MicroRNA26b-3p inhibitor encoding genes;
D the recombinant viral vector) containing MicroRNA26b-3p inhibitor encoding genes.
The present invention the experiment proved that, after MicroRNA26b-3p inhibitor is overexpressed, can suppress ESR1 expression.ESR1,
Estrogen receptor α, can mediate the rush cell proliferative biological effect of 17 beta estradiols.It is overexpressed in the present invention
After MicroRNA26b-3p inhibitor, by suppressing ESR1 expression, people's umbilical cord derived mesenchymal stem cell can be remarkably promoted
Propagation.Therefore illustrate, MicroRNA26b-3p inhibitor is relevant with people's umbilical cord derived mesenchymal stem cell propagation,
MicroRNA26b-3p inhibitor can be used for preparing people's umbilical cord derived mesenchymal stem cell, promote people's umbilical cord derived mesenchymal dry thin
Born of the same parents breed.The present invention, which is overcome in people's umbilical cord derived mesenchymal stem cell in vitro culture, breeds slow defect, makes one umbilical cord source
Mescenchymal stem cell can in large quantities, extensive clinic is obtained in regenerative medicine at low cost.
Brief description of the drawings
Fig. 1 is the overexpression efficiency that RT-PCR detects MicroRNA26b-3p mimicus and Inhibitor;Wherein A is
People's umbilical cord derived mesenchymal stem cell is overexpressed in MicroRNA26b-3p mimicus (referred to as ov26b-hUMSC)
MicroRNA26b-3p expression quantity;B is that people's umbilical cord derived mesenchymal stem cell is overexpressed MicroRNA26b-3p
MicroRNA26b-3p expression quantity in Inhibitor (referred to as in26b-hUMSC).
Fig. 2 is EdU incorporation efficiency situations in observation ov26b-hUMSC, in26b-hUMSC under immunofluorescence microscopy;Wherein A
Decline for ov26b-hUMSC incorporation efficiencies;B raises for in26b-hUMSC;C is that control group EdU mixes situation;ABC has three width respectively
Figure, contaminates the fluorogram that core DAPI, EdU, DAPI merge with EdU from left to right under the respectively 100 times visuals field;D is ov26b-
The Score Map of EdU incorporation efficiency in hUMSC, in26b-hUMSC and control group nc groups.
The expression that Fig. 3 is ESR1 in RT-PCR and western-blot detections ov26b-hUMSC, in26b-hUMSC;Wherein
A is ESR1mRNA expression quantity decline in ov26b-hUMSC;B is ESR1mRNA expression quantity rising in in26b-hUMSC;C is
Observation result in ov26b-hUMSC and in26b-hUMSCwestern-blot, the same RT-PCR of variation tendency.
Fig. 4 is that 293T cells luciferase reporter gene tests to detect MicroRNA26b-3p and ESR1 targeting knot
Cooperation is used.As a result show ov26b groups uciferase activity decline and in26b is then raised.
Fig. 5 be bright-field under observe the activator 17- that ESR1 acceptors are separately added into ov26b-hUMSC, in26b-hUMSC
Cell growth state after β-Estradiol (referred to as E2) and inhibitor Fulvestrant (referred to as F);Wherein scheming A was
Express MicroRNA26b-3pmimicus;B for be overexpressed after MicroRNA26b-3p mimicus24h add activator 17- β-
Estradiol;C is the blank control group for not doing what processing;D is overexpression MicroRNA26b-3p Inhibitor;E was
Express and inhibitor Fulvestrant is added after MicroRNA26b-3p Inhibitor24h.
Embodiment
In conjunction with embodiment and accompanying drawing, the present invention is described in detail, but the implementation of the present invention is not limited only to this.
Agents useful for same and raw material of the present invention are commercially available or can be prepared by literature method.Unreceipted tool in the following example
The experimental method of concrete conditions in the establishment of a specific crime, generally according to normal condition such as Sambrook et al.《Molecular cloning:Lab guide》(New
York:Cold Spring Harbor Laboratory Press, 1989) described in condition, or according to normal condition, or
According to the condition proposed by manufacturer.Unless otherwise indicated, otherwise percentage and number are calculated by weight.
People's umbilical cord derived mesenchymal stem cell (hUMSC) used source in embodiment:It is derived from the foot by written consent
Produce umbilical cord per month, separating creep plate method using tissue separates.(Drela K1,Sarnowska A1,Siedlecka P,et
al.Low oxygen atmosphere facilitates proliferation and maintains
undifferentiated state of umbilical cord mesenchymal stem cells in an hypoxia
inducible factor-dependent manner[J].Cytotherapy,2014,16(7):881-92.)
Embodiment 1:People's umbilical cord derived mesenchymal stem cell is overexpressed MicroRNA26b-3p mimicus and Inhibitor
First, recovery people umbilical cord derived mesenchymal stem cell
HUMSC is taken out from nitrogen storage tank, is placed in 37 DEG C of water-baths and rocks until dissolving.Under the conditions of 1000rpm from
Heart 5min, abandons supernatant, adds DMEM (L) nutrient solution 1ml suspension cells containing FBS, and is transferred in T25 blake bottles, plus culture
Liquid is to 5ml.It is placed in 37 DEG C, 5%CO2It is incubated in incubator, changes a nutrient solution within every 3 days.
2nd, cell transfecting
1. transfect MicroRNA26b-3p mimicus and Inhibitor.It is (limited purchased from the lucky agate chemical gene technology in Shanghai
Company, is that can raise or lower the RNA small fragments of MicroRNA26b-3p expression quantity in hUMSC), transfection reagent is used
Invitrogen companiesRNAimax Reagent, according to the said firm's guide transfectional cell.
MicroRNA26b-3p analogies (mimicus) sequence is:
Positive-sense strand (sense):CCUGUUCUCCAUUACUUGGCUC(SEQ ID NO:1)
Antisense strand (antisense) GCCAAGUAAUGGAGAACAGGUU (SEQ ID NO:3)
MicroRNA26b-3p inhibitor (inhibitor) sequence is:
GAGCCAAGUAAUGGAGAACAGG(SEQ ID NO:2)
1) (normal trainings in the day before transfection is inoculated into 12 orifice plates by well-grown hUMSC obtained from step one
Support, 37 degree, 5%CO2 incubators), cell density is 50% or so during transfection.
2) is provided according to Invitrogen companiesRNAimax Reagent operating procedures are transfected
hUMSC。
3) .37 degree, 5%CO2 incubators continue after cultivating 48 hours, obtain ov26b-hUMSC and in26b-hUMSC, with
And its control group nc-hUMSC, innc-hUMSC.
MicroRNA26b-3p expression in 2.RT-PCR detection cells,
The total serum IgE of four groups of cells of above-mentioned acquisition is extracted using RNAiso Reagent (TAKALA), and using total serum IgE as mould
Plate, MicroRNA26b-3p primers (synthesis of Jie Li companies) carry out QRT-PCR, using U6 as internal reference (synthesis of Jie Li companies), with
Nc-hUMSC, innc-hUMSC are used as control.As a result it is as shown in Figure 1.
Experimental result shows that the relative expression that ov26b-hUMSC relative expression is 20, nc-hUMSC is 1;
The relative expression that in26b-hUMSC relative expression is 0.25, innc-hUMSC is 1.It can be seen that MicroRNA26b-
3p rises in ov26b-hUMSC expression quantity and declined in in26b-hUMSC.
Primer sequence is as follows:
U6 primer:
U6 reverse transcriptase primer:5'AACGCTTCACGAATTTGCGT3'(SEQ ID NO:4)
Universal primer:5'CGCTTCACGAATTTGCGTGTCAT3'(SEQ ID NO:5)
Forward primer:5'GCTTCGGCAGCACATATACTAAAAT3'(SEQ ID NO:6)
MicroRNA221-3p primer:
MicroRNA26b-3p reverse transcriptase primer:
5'GTCGTATCCAGTGCGAACTGTGGCGATCGGTACGGGCTACACTCGGAATTGCACTGGATACGACGAG
CC3'(SEQ ID NO:7)
Universal primer:5'CGCTTCACGAATTTGCGTGTCAT3'(SEQ ID NO:8)
Forward primer:5'GGCCTGTTCTCCATTACTTGG3'(SEQ ID NO:9)
Embodiment 2:Experimental study ov26b-hUMSC and in26b-hUMSC multiplication characteristic are mixed using EdU
The hUMSC for taking growth conditions good is laid in 48 holes, when cell length to 50% degree of polymerization, is transfected as stated above
After hUMSC, after incubator is incubated 48 hours, the propagation of cell is detected with EdU kits, wherein EdU kits are purchased from sharp rich
Bio tech ltd, all steps are carried out in strict accordance with the specification of this product.
Fluorescence microscopy Microscopic observation, experimental result is as shown in Figure 2.
Experimental result shows that the EdU relative to figure C control groups (nc groups) mixes fluorescence volume, and figure A results show ov26b-
HUMSC EdU incorporation efficiencies are significantly reduced, and figure B results show that in26b-hUMSCEdU incorporation efficiencies are significantly raised.Figure D is ov26b-
The Score Map of EdU incorporation efficiency in hUMSC, in26b-hUMSC and control group nc groups
Embodiment 3, MicroRNA26b-3p can be with negative regulation ESR1 expression
1.RT-PCR detects ESR1mRNA expression
The total serum IgE of four groups of cells of above-mentioned acquisition is extracted using RNAiso Reagent (TAKALA), reverse transcription is cDNA.
Primer is designed, ESR1mRNA expressions are detected.GAPDH is used as detection internal reference.Using nc-hUMSC, innc-hUMSC as right
According to.
Primer sequence is as follows:
ESR1 primer is as follows:
Forward primer:5'ATGAAAGGGATACGAAAAGACCG3'(SEQ ID NO:10)
Reverse primer:5'TTGGCAGCTCTCATGTCTCC3'(SEQ ID NO:11)
GAPDH primer is as follows:
Forward primer:5'GGCCTCCAAGGAGTAAGACC3'(SEQ ID NO:12)
Reverse primer:5'AGGGGTCTACATGGCAACTG3'(SEQ ID NO:13)
As a result it is as shown in Figure 3, it is seen that ESR1 mRNA expression is reduced and increased in in26b-hUMSC in ov26b-hUMSC.
2.western-blot detects the expression of ESR1 albumen
(1) sample that goes after above-mentioned RNAiso Reagent (TAKALA) extracted total RNA extracts total protein therein, grasps
Make flow with reference to corresponding instructions.
(2) 1%SDS soluble proteins are used, adds after appropriate 4 × Loading Buffer, 10min. is boiled in EP pipes
(3) loading after sample returns to room temperature.
(4) electrophoresis, transferring film.
(5) room temperature in 5% skimmed milk power confining liquid is immersed in slowly to sway one hour.4 DEG C of overnight incubations of primary antibody.
(6) suitable secondary antibody is selected according to primary antibody source, selects horseradish peroxidase (HRP) to mark according to authentication method
Antibody, dilute (1 by corresponding proportion:1000~1:10000), room temperature jog one hour.
(7) wash, use horseradish peroxidase HRP-ECL luminescence methods.
Experimental result such as Fig. 3 figures A results are shown compared with control group nc-hUMSC, ov26b-hUMSC groups ESR1 mRNA
Expression quantity is significantly reduced;Scheme B results and show in26b-hUMSC groups with respect to innc-hUMSC, ESR1 mrna expression amount significantly rises
It is high;Scheme the expression quantity change that C is ESR1 protein levels in above-mentioned treated people's umbilical cord derived mesenchymal stem cell.Fig. 3 results
Illustrate that MicroRNA26b-3p can be in ESR1mRNA and albumen while suppressing ESR1 expression.
Embodiment 4:Dual-luciferase reporter system detects MicroRNA26b-3p and ESR1 targeting knot in 293T
Close
1. prepare the following two plasmids of plasmid, it is as follows:
(1) pRL-TK plasmids, are used as the internal reference plasmid for evening up transfection influence
(2) build each nearby with MicroRNA26b-3p targetings combination in ESR1CDS sequences in pMIR-Report plasmids
The recombinant vector (referred to as pMIR-ESR1) of 300bp fragments
(3) above two plasmid is shaken into bacterium and goes endotoxin extraction agent box (being purchased from Axygen companies) extracting, for turning
Contaminate cell.
2. prepare cell
Experiment is using the high vehicles cells HEK-293T of transfection efficiency simultaneously is easily bred, with every hole 1x104Individual cell is per ml
Density paving Yu in 96 orifice plates, if 2 multiple holes.When cell 70-80% degrees of fusion, transfected as stated above.
3. luciferase reporter gene is tested
Kit is purchased from promega companies, and is tested in strict accordance with corresponding instructions., will after the completion of measure
Excel forms are copied out and carry out interpretation.
Experimental result is as shown in figure 4, the substrate reduction of ov26b groups luciferase degraded, illustrates under pMIR-ESR1 expression quantity
Drop, also illustrate MicroRNA26b-3p can by DNA base match ESR1, and in26b groups it is not anticipated that in rise, may
It is not high with the local expression quantity of MicroRNA26b-3p in 293T.Fig. 4 results show that MicroRNA26b-3p can pass through alkali
Base complementation combination ESR1mRNA, so as to suppress ESR1 expression
Embodiment 5:Ov26b-hUMSC, in26b-hUMSC, which are separately added into after E2, F, observes proliferative activity
MicroRNA26b-3p mimicus, Inhibitor will be overexpressed and activator 17- β-Estradiol, suppression is added
HUMSC after preparation Fulvestrant is placed under inverted microscope and observes and photograph to record.
Experimental result is as shown in figure 5, ov26b- under relative to without any processing group (blank groups), 100 × bright-field
HUMSC, in26b-hUMSC cell number are reduced, raised respectively, and after corresponding E2 and F is added, cell quantity difference is
Increase and reduction.More illustrate, MicroRNA26b-3p is that regulation and control hUMSC cell propagation is played by ESR1.
The preferred embodiment to the invention is illustrated above, but the invention be not limited to it is described
Embodiment, those skilled in the art can also make a variety of equivalent on the premise of without prejudice to the invention spirit
Modification or replacement, these equivalent modifications or replacement are all contained in the application claim limited range.
Claims (9)
1. MicroRNA26b-3p inhibitor answering in the reagent for promoting people's umbilical cord derived mesenchymal stem cell propagation is prepared
With.
2. MicroRNA26b-3p inhibitor according to claim 1 promotes people's umbilical cord derived mesenchymal dry thin in preparation
Application in the reagent of born of the same parents' propagation, it is characterised in that the reagent that described promotions people's umbilical cord derived mesenchymal stem cell is bred is
It can suppress or lower the reagent of MicroRNA26b-3p expression quantity.
3. MicroRNA26b-3p inhibitor according to claim 2 promotes people's umbilical cord derived mesenchymal dry thin in preparation
Application in the reagent of born of the same parents' propagation, it is characterised in that the described examination that can suppress or lower MicroRNA26b-3p expression quantity
Agent, including it is following any:A) MicroRNA26b-3p inhibitor;B) base is encoded containing MicroRNA26b-3p inhibitor
The recombinant vector of cause;C the recombinant virus) containing MicroRNA26b-3p inhibitor encoding genes.
4. MicroRNA26b-3p inhibitor according to claim 1 promotes people's umbilical cord derived mesenchymal dry thin in preparation
Application in the reagent of born of the same parents' propagation, it is characterised in that the sequence of described MicroRNA26b-3p inhibitor such as SEQ ID NO:2
It is shown.
5. a kind of method for promoting people's umbilical cord derived mesenchymal stem cell to breed, it is characterised in that this method includes:Build one
Plant people's umbilical cord derived mesenchymal stem cell of MicroRNA26b-3p low expressions.
6. a kind of method for promoting people's umbilical cord derived mesenchymal stem cell to breed according to claim 5, its feature exists
In this method is including I) and III) or II) and III):I) artificial synthesized MicroRNA26b-3p suppression body, through lipid
Body is transfected, and obtains people's umbilical cord derived mesenchymal stem cell of MicroRNA26b-3p low expressions;II) build and contain
MicroRNA26b-3p suppresses the recombinant vector of the encoding gene of body or builds the volume for suppressing body containing MicroRNA26b-3p
The recombinant virus of code gene;By the recombinant vector transfected with human umbilical cord derived mesenchymal stem cell of acquisition, MicroRNA26b- is obtained
People's umbilical cord derived mesenchymal stem cell of 3p low expressions;III) step I) or the low tables of MicroRNA26b-3p that II) obtain
The people's umbilical cord derived mesenchymal stem cell reached, is put into 37 DEG C of 5% CO2gas incubator quiescent culture, used medium is not with
The people's umbilical cord derived mesenchymal stem cell processed, is 10% hyclone, DMEM in high glucose.
7. MicroRNA26b-3p inhibitor prepare organizational project cell in application, described organizational project cell be by
What a kind of people's umbilical cord derived mesenchymal stem cell of MicroRNA26b-3p low expressions was prepared.
8. a kind of method of promotion people's umbilical cord derived mesenchymal stem cell propagation as described in claim 5 or 6 is preparing tissue
Application in engineering cell, described organizational project cell is by a kind of people's umbilical cord source of MicroRNA26b-3p low expressions
What mescenchymal stem cell was prepared.
9. a kind of have the reagent for promoting people's umbilical cord derived mesenchymal stem cell propagation, it is characterised in that living in described reagent
Property composition to be following any:A) MicroRNA26b-3p inhibitor;
B the recombinant vector) containing MicroRNA26b-3p inhibitor encoding genes;C) press down containing MicroRNA26b-3p
The recombinant virus of preparation encoding gene.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201510107949.6A CN104726500B (en) | 2015-03-12 | 2015-03-12 | Application of the MicroRNA26b 3p inhibitor in people's umbilical cord derived mesenchymal stem cell is prepared |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201510107949.6A CN104726500B (en) | 2015-03-12 | 2015-03-12 | Application of the MicroRNA26b 3p inhibitor in people's umbilical cord derived mesenchymal stem cell is prepared |
Publications (2)
Publication Number | Publication Date |
---|---|
CN104726500A CN104726500A (en) | 2015-06-24 |
CN104726500B true CN104726500B (en) | 2017-09-12 |
Family
ID=53450912
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201510107949.6A Active CN104726500B (en) | 2015-03-12 | 2015-03-12 | Application of the MicroRNA26b 3p inhibitor in people's umbilical cord derived mesenchymal stem cell is prepared |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN104726500B (en) |
Families Citing this family (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN105316286B (en) * | 2015-11-26 | 2018-12-14 | 中国人民解放军军事医学科学院基础医学研究所 | A kind of method of preparation and reorganization mescenchymal stem cell and its obtained recombination mescenchymal stem cell |
CN105343894B (en) * | 2015-11-26 | 2019-01-29 | 中国人民解放军军事医学科学院基础医学研究所 | The recombination mescenchymal stem cell of efficient secretion prostaglandin E2 (PGE2) and its application |
CN110592088B (en) * | 2019-09-29 | 2020-10-23 | 拉菲尔(深圳)投资咨询有限公司 | MiRNA for promoting stem cell proliferation and cell model thereof |
CN112481219B (en) * | 2020-11-30 | 2023-01-13 | 上海东方星际干细胞科技有限公司 | Application of high gene expression in promoting proliferation of human umbilical cord mesenchymal stem cells in-vitro culture |
CN113621580B (en) * | 2021-08-18 | 2023-01-31 | 山东科金生物发展有限公司 | Reagent for enhancing in-vitro amplification activity of adipose-derived mesenchymal stem cells |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2006128245A1 (en) * | 2005-06-03 | 2006-12-07 | Southern Adelaide Health Service-Flinders Medical Centre | Targeting cells with altered microrna expression |
CN103432595A (en) * | 2013-08-19 | 2013-12-11 | 南京市妇幼保健院 | Application of human miR-26b in preparation of drugs for inhibiting fat cell proliferation |
-
2015
- 2015-03-12 CN CN201510107949.6A patent/CN104726500B/en active Active
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2006128245A1 (en) * | 2005-06-03 | 2006-12-07 | Southern Adelaide Health Service-Flinders Medical Centre | Targeting cells with altered microrna expression |
CN103432595A (en) * | 2013-08-19 | 2013-12-11 | 南京市妇幼保健院 | Application of human miR-26b in preparation of drugs for inhibiting fat cell proliferation |
Non-Patent Citations (3)
Title |
---|
MicroRNA-26b Represses Colon Cancer Cell Proliferation by Inhibiting Lymphoid Enhancer Factor 1 Expression;Zichao Zhang等;《Molecular Cancer Therapeutics》;20140430;第13卷;第1942-1951页 * |
microRNA-26b对宫颈癌Hela细胞增殖和侵袭的影响;凌燕等;《广东医学》;20130630;第34卷(第11期);第1651-1653页,尤其是摘要,第1651页第1.3节,第1652页第2.2节 * |
微小RNA-26b在乳腺癌中的作用及其分子机制研究;徐丽平等;《中国全科医学》;20131130;第16卷(第11C期);第3923-3926页 * |
Also Published As
Publication number | Publication date |
---|---|
CN104726500A (en) | 2015-06-24 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN104726500B (en) | Application of the MicroRNA26b 3p inhibitor in people's umbilical cord derived mesenchymal stem cell is prepared | |
Liu et al. | Lentivirus‑mediated microRNA‑26a overexpression in bone mesenchymal stem cells facilitates bone regeneration in bone defects of calvaria in mice | |
EP2374884A2 (en) | Human miRNAs isolated from mesenchymal stem cells | |
JP2016514953A (en) | Compounds, compositions, methods and kits for telomere elongation | |
CN108486060B (en) | Exosome for treating tumors and preparation method and application thereof | |
JPWO2008084319A1 (en) | New nucleic acid | |
CN109224130B (en) | Application of long-chain non-coding RNA lnc-HCAR in preparation of bone repair system, bone repair system and preparation method | |
WO2014197421A1 (en) | Compositions and methods for induced tissue regeneration in mammalian species | |
Liu et al. | A functionalized collagen-I scaffold delivers microRNA 21-loaded exosomes for spinal cord injury repair | |
CN111500578A (en) | Circ RNA-FTO for regulating and controlling osteogenic differentiation and tissue regeneration of ADSCs and application thereof | |
JPWO2011111824A1 (en) | Method for proliferating cardiomyocytes using microRNA | |
JP5804459B2 (en) | Cell aging promoter for cancer diseases | |
Weng et al. | Improvement of muscular atrophy by AAV–SaCas9-mediated myostatin gene editing in aged mice | |
CN110075122B (en) | Liver cancer therapeutic exosome medicine | |
CN108465108B (en) | Specific gene target for preventing or treating brain glioma | |
CN104995300B (en) | The adjusting of RNA activity and vasopermeability | |
CN113876798B (en) | Application of microRNA in preparation of medicine for promoting healing of tendon and bone | |
CN106244593A (en) | A kind of microRNA regulating Cornu Cervi Pantotrichum young pilose antler skin fast-growth and application thereof | |
CN105457028A (en) | Stress sensitivity microRNA exerting regulating effect in bone formation | |
CN104561101B (en) | Methods and application of the 3p of MicroRNA 221 in epidermal cell is prepared | |
CN103952406B (en) | The siRNA of targeting STAT3 gene of suppression people's malignant glioma propagation and expression vector thereof and application | |
CN112941020A (en) | Application of chicken circular RNA in promoting proliferation of myoblasts | |
CN101787367A (en) | siRNA for restraining MAEL gene expression of human being and application thereof in preparing anti-tumor medicine | |
CN110669763A (en) | MSCs bracket for bone defect repair and preparation thereof | |
CN105435242A (en) | Application of human miR-23a in preparation of cell growth and/or ageing regulators |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |