CN106244593A - A kind of microRNA regulating Cornu Cervi Pantotrichum young pilose antler skin fast-growth and application thereof - Google Patents
A kind of microRNA regulating Cornu Cervi Pantotrichum young pilose antler skin fast-growth and application thereof Download PDFInfo
- Publication number
- CN106244593A CN106244593A CN201610794787.2A CN201610794787A CN106244593A CN 106244593 A CN106244593 A CN 106244593A CN 201610794787 A CN201610794787 A CN 201610794787A CN 106244593 A CN106244593 A CN 106244593A
- Authority
- CN
- China
- Prior art keywords
- cornu cervi
- cervi pantotrichum
- pilose antler
- growth
- young pilose
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering N.A.
- C12N2310/141—MicroRNAs, miRNAs
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Biomedical Technology (AREA)
- Chemical & Material Sciences (AREA)
- Molecular Biology (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
A kind of microRNA regulating Cornu Cervi Pantotrichum young pilose antler skin fast-growth and application thereof, it relates to a kind of tiny RNA (microRNA), the invention provides quick growth cell this to Northeast Wapiti (Cervus elaphus) Cornu Cervi Pantotrichum young pilose antler skin and play the factor of inhibitory action, it is named: PC 5p 1090, its sequence is CACUGACUGGCUCAGCGUGUGCCU, there is the effect efficiently lowering SOX9 albumen, propagation capable of inhibiting cell.
Description
Technical field
The present invention relates to a kind of tiny RNA (microRNA), the cancer sample growth of negative regulation Cornu Cervi Pantotrichum.
Background technology
In mammal, only abnormal antler is the current known organ uniquely with table form regeneration capacity, is i.e. losing
Can also regenerate out (such as Fig. 1,2) after going completely.In the regeneration period, Cornu Cervi Pantotrichum extends 1-2cm from grown on top point average every day.
So there being people to claim the growth of Cornu Cervi Pantotrichum to be " cancer sample " (cancer-like) growth.Along with a large amount of carcinogenic factors in recent years, as TNF α,
The discovery of KGF etc., this viewpoint thinking that Cornu Cervi Pantotrichum cancer sample grows has obtained the support of molecular level evidence.Can be noticeable
Tumor and the little spontaneous recovery of cancerous tissue, and Cornu Cervi Pantotrichum can nearly hundred days cancer sample growth after be finally automatically stopped, young pilose antler skin
Can slowly death come off.Certainly exist negative regulatory factor during stopping after the growth of this Cornu Cervi Pantotrichum young pilose antler canceroderm sample to work.
MicroRNA (miRNA) is life, the negative regulatory factor of important gene expression in a class, by regulation target
MRNA stability or translation efficiency show its function.A length of 20-24 the nucleotide of these tiny RNA, derive from long having
The transcripton of hair fastener sample secondary structure, and sheared by two kinds of Cobra venom endonuclease Drosha and Dicer.Detailed process: miRNA is first
By endonuclear ribonuclease Drosha produce, this enzyme by gene coding primary miRNA (primary miRNA,
Pri-miRNA) loop-stem structure is processed into precursor miRNA (precursor miRNA, pre-miRNA), and 60-70 nucleotide is long.
Then by output albumen 5 (esportin-5), pre-miRNA indexing exported Cytoplasm, and at another kind of RNAIII,
The lower miRNA forming double-strand of the effect of Dicer.
RNA induction silencing complex (RNA-induced silencing complex, RISC) comprises AGO
(argonaut) albumen, forms miRNA double-strand.MiRNA that wherein chain formation is ripe and another chain degradation.Ripe
MiRNA protein complexes is combined by 3 ' the UTR district target sites with mRNA, and carries out Transcription inhibition or degraded mRNA decision
In ripe miRNA and target mRNA complementarity.
The selective active of one miRNA depends on the Seed Sequences (seed of the miRNA complementary with this homologous mRNA
region).Can potential know because the intraseminal imperfect base pairing of microRNA represents this core 5-7 nucleotide sequence
Not combining a lot of mRNA sequences, Seed Sequences generally repeats in genome and regulates and controls hundreds of target mRNA simultaneously.So
And, it is relatively mild that miRNA affects single protein level, while it is true, regulate several by a miRNA in a path simultaneously
The situation of individual gene has a build-up effect for the biological process coming from this path.
Increasing evidence shows that miRNA is in biologys such as many cell proliferation, differentiation, form generation and tumor generations
During play the most crucial regulation effect.Initiate and progress it is known that miRNA participates in regulation tumor, and by suppression mesh
Mark gene plays the function of oncogene or tumor suppression.Up till now, increasing miRNA is proved in development of cancer
Playing a very important role, this explanation miRNA can be as the potential new target drone for the treatment of cancer.
SOX9(transcription factor sex-determining region Y(SRY)-box 9protein)
Belong to SOX family, be in male decision, Subchondral drilling, neural formation and the developmental process such as impaired neural crest development, stem cell formation
One transcription factors critical.Multinomial research confirms, SOX9 plays a decisive role in cell proliferation and cells survival.
Summary of the invention
Present invention determine that this quick growth cell of Northeast Wapiti (Cervus elaphus) Cornu Cervi Pantotrichum young pilose antler skin plays suppression and makees
The factor, and determine the title of this negative regulatory factor, sequence.The present invention is from the microRNA number of Cervus elaphus linnaeus Cornu Cervi Pantotrichum young pilose antler skin tissue
According to screening the microRNA obtained in storehouse, PC-5p-1090 (hereinafter referred to as PC-1090), is a kind of specific expressed in fine and soft skin
MiRNA, for 24nt, cartilaginous tissue cannot detect this maturation miRNA.Sequence is as shown in SEQ ID NO:1
(CACUGACUGGCUCAGCGUGUGCCU)。
The present invention is through experiments such as the detection of Hela, U2OS, 293T isocellular cell proliferation and Western Blotting
Prove that PC-1090 lowers the expression (Fig. 4,5 shown in) of cell proliferation key transcription factor SOX9, propagation capable of inhibiting cell (Fig. 6 institute
Show).
The present invention comprises following beneficial effect:
As the negative regulatory factor of gene expression, microRNA is in cell growth, allelotaxis, individual growth and various disease
Sick process all plays very important effect.Therefore, separate from the Cornu Cervi Pantotrichum top young pilose antler skin tissue of fast-growth
The growth of cancer sample and the automatic termination of microRNA sequence pair Cornu Cervi Pantotrichum can play very important regulating and controlling effect.
To this end, the present invention obtains from the newborn road Cornu Cervi Pantotrichum top young pilose antler skin tissue microRNA sequencing result of fast growing period
To miRNA, a PC-1090, its transcript precursor is about 120nt, can form hairpin structure, ripe miRNA total length 24nt
(the GenBank number of logging in: KJ179845), without homologous sequence in miRBase data base (Release 21).BLAST result shows
Show, either ripe miRNA total length or its seed sequence, in people, mice, rat, Canis familiaris L., chicken, pig isotype species gene group
In all without homologous sequence.On cattle (Bos taurus) o.11 chromosome, only there are the homologous sequence of ripe miRNA, similarity
100%.
Key factor S OX9 grown by TargetScan prediction Cornu Cervi Pantotrichum young pilose antler skin is one of target gene of PC-1090,
PC-1090 has targeting to SOX9 by PC-1090mimics experimental verification, proves in the cells such as U2OS, 293T
PC-1090 has the effect (experimental result is as shown in Figure 4,5) efficiently lowering SOX9 albumen, and suppresses cell proliferation (experiment
Result is as shown in Figure 6).
The gene order of present invention screening is as follows:
Title: PC-5p-1090
Sequence: CACUGACUGGCUCAGCGUGUGCCU.
Accompanying drawing explanation
Fig. 1 is Cervus elaphus linnaeus Cornu Cervi Pantotrichum table form regeneration period figure.Wherein, arrow indication is hypertrophy district, Cornu Cervi Pantotrichum top；
Fig. 2 is the axial rip cutting in hypertrophy district, Cornu Cervi Pantotrichum fast growing period top figure and fine and soft skin organization chart；Wherein, left side is axle
To rip cutting figure, right side is fine and soft skin organization chart, and E is epithelium, and D is skin corium, and RM is mesenchyme layer, and CA is non-mineralising cartilage
District, H is hair follicle, and S is sebaceous gland；In figure at arrow indication seen from red blood vessel in cartilage；
Fig. 3 is that various modes biology SOX9mRNA 3 ' UTR district has the seed sequence of potential PC-1090 (under small letter adds
Underlined sequence) complementation combines conserved positions (sequence in frame)；
Fig. 4 is that PC-1090mimics lowers U2OS cellular endogenous SOX9 protein level figure；Internal reference is GAPDH；
Fig. 5 is that PC-1090mimics can lower 293T cell pMIR-SOX9-3UTR-Luc vector expression luciferase；In
Ginseng is GAPDH, and experiment sets pMIR-Luc empty plasmid (ev) comparison；
Fig. 6 be CCK-8 method detection transfection PC-1090mimics after with 24 hours for be spaced Hela cell-proliferation activity
Figure；Wherein, A is PC-1090-NC negative control activity curve；B is PC-1090mimics activity curve.
Detailed description of the invention
Detailed description of the invention one: a kind of microRNA regulating Cornu Cervi Pantotrichum young pilose antler skin fast-growth of present embodiment, its name
For: PC-5p-1090, its sequence is CACUGACUGGCUCAGCGUGUGCCU (as shown in Seq ID No:1).
Detailed description of the invention two: the application of a kind of microRNA regulating Cornu Cervi Pantotrichum young pilose antler skin fast-growth of present embodiment,
Suppression promotes that the key transcription factor SOX9 of cell proliferation expresses.
Detailed description of the invention three: the application of a kind of microRNA regulating Cornu Cervi Pantotrichum young pilose antler skin fast-growth of present embodiment,
It has suppression cell proliferation function.
Present invention is not limited only to the content of the respective embodiments described above, one of them or the group of several detailed description of the invention
Contract sample can also realize the purpose of invention.
By following example checking beneficial effects of the present invention:
Below example facilitates a better understanding of the present invention, but does not limit the present invention.Experiment in following embodiment
Method, if no special instructions, is conventional method.Test material used in following embodiment, if no special instructions, is certainly
Routine biochemistry Reagent Company is commercially available.% in following embodiment, if no special instructions, is weight/mass percentage composition.With
Quantitative test in lower embodiment, is respectively provided with three times and repeats experiment, results averaged.
Embodiment 1, the acquisition process of Cornu Cervi Pantotrichum young pilose antler skin PC-1090
1) material obtains: experiment material therefor is the Northeast Wapiti Cornu Cervi Pantotrichum young pilose antler skin tissue being in about 70 days quick rise periods
(shown in Fig. 2).With the shears of sterilization, Cornu Cervi Pantotrichum apical meristem is cut into the thickness lamellar less than 0.5cm immediately after saw young pilose antler, puts immediately
Enter equipped with in the protection liquid (RNAlater) preventing RNA from degrading, be placed in cryopreservation case and take back laboratory and preserve.
2) extraction of mRNA: weigh 30mg, in superclean bench after laboratory is preserved the fine and soft skin separate tissue of Cornu Cervi Pantotrichum
Quickly chopping is placed in aseptic 1.5mL test tube, utilizes QIAGEN company (German) test kit DNeasy Blood&Tissue Kit
(Cat.No.69504) extract the total serum IgE in Cornu Cervi Pantotrichum young pilose antler skin, and the total serum IgE of extraction is finally dissolved in the water of RNAse-free
In, the total serum IgE of extraction is respectively provided with higher quality (OD260nm/OD280nm:1.75-1.86) through spectrophotomelric assay.
3) Cornu Cervi Pantotrichum young pilose antler skin small RNA high-flux sequence: the total serum IgE of extraction is delivered to Lian Chuan company of the U.S. (Hangzhou) and leads to
Cross Illumina miRNA Solexa order-checking platform to carry out Cornu Cervi Pantotrichum young pilose antler skin tissue small RNAs library and carry out high-flux sequence
After, carry out data process with ACGT101-miRv4.2 (LC Sciences) software.
4) acquisition of the new miRNAPC-1090 of Cornu Cervi Pantotrichum young pilose antler skin: the small RNA library of Cornu Cervi Pantotrichum young pilose antler skin tissue is carried out respectively
Obtaining sequence initial data after the order-checking of the Solexa degree of depth comprehensively to analyze, obtain a kind of new miRNA, PC-1090, its sequence is not
Energy comparison, can be with comparison but record sequence (known ripe body) to the miRNAs precursor (pre-miRNAs) of miRBase cattle
On genome, and the genome sequence extended can form qualified hairpin structure.
5) microRNA target prediction: quickly increased for the fine and soft skin of regulation by one of target gene of TargetScan prediction PC-1090
Key transcription factor SOX9.
Embodiment 2, PC-1090 can lower rush key factor S OX9 of cell proliferation on a cellular level and express
1) PC-1090 synthesis: PC-1090 sequence is delivered to Shanghai Ji Ma company synthesis mimics with corresponding
Negative Control(NC)。
2) SOX9-3 ' UTR-pMIR-REPORT carrier is built: sequence alignment analysis learns various modes biology Sox9mRNA
3 ' UTR districts have potential PC-1090seed sequence (small letter underlines sequence) complementation and combine conserved positions (sequence in frame)
(shown in Fig. 3).Therefore, the fragment that the present embodiment has cloned 339bp according to 3 ' the UTR districts of mice SOX9 is inserted into pMIR-
In REPORT (Applied Biosystems company, the U.S.) carrier, wherein Insert Fragment comprises the mutual of PC-1090 Seed Sequences
Complementary series, Insert Fragment (as shown in Seq ID No:2) is as follows:
caatgttttcagccatagacctttgggtctgcctggactgtatgtggatgtgtgcgtgtgttgtgacacgggacaac
acatgcctctgcaagtgtgtgtgccgtggatagccccttggctgctctcctgcagagagacatcggacagaccttaa
ttcttactcactgctgtggctggagagtataaggaatgctttttctttttttctttctttctttctttttttttttt
aagacagcagtctttttttttaatttaaaaaaaaaaagatatattaacagttttagaagtcagtagaataaaacctt
aaagcgttcttataatatggcatctttcgcg。
PMIR-REPORT carrier is that the target sequence by a miRNA that ABI company (U.S.) designs is inserted into polyclone position
In point, the luciferase protein Luciferase report carrier of pMIR-REPORT can be used to qualitative and quantitative measurement miRNA
Function.When PC-1090mimics and SOX9-3 ' UTR-pMIR-REPORT carrier cotransfection cell, if Luciferase egg
White down-regulated expression, illustrates that PC-1090 has downward effect to SOX9 expression.
3) cell is cultivated: 293T cell and U2OS cell are purchased from American Type Culture Collection committee of Chinese Academy of Sciences cell
Storehouse, culture medium: 293T cell culture medium is DMEM (Gibco, the U.S.), and U2OS cell culture medium is McCoy's 5A
(Modified) Medium (Gibco, the U.S.), all adds the hyclone (Gibco, the U.S.) of 10% and 100U/mL's is dual anti-
(Invetrogen company, the U.S.).It is placed in 37 DEG C, cultivates under 5% carbon dioxide conditions.
4) transfection detects with Western: cell is with 8 × 105Individual/hole kind, on 6 well culture plates, is cultivated 36 hours, cell
Degree of converging reaches 70%-80%, with Lipofectmin3000 (Invetrogen company, the U.S.) for mediation, by the PC-of synthesis
U2OS cell, 293T cell are transfected by mimics and SOX9-3 ' the UTR-pMIR-REPORT carrier of 1090, the weight of transfection
Group plasmid amount is 2ug/ hole.Receive cell after 40～48 hours, after albumen is carried out degenerative treatments, utilize the PAGE of 4%-12% pre-
Glue (Invitrogen company, the U.S.) electrophoresis.After turning nitrocellulose membrane, close 2 with the TBST mixed liquor of 5% defatted milk powder little
Time, then nitrocellulose membrane respectively at SOX9 mono-anti-(Santa Cruz Biotechnology company, the U.S.) (Fig. 4) or
Luciferase mono-anti-(Santa Cruz Biotechnology company, the U.S.) (Fig. 5) is hatched more than 2 hours, fluorescence mark
Hatching 1 hour in the two of note anti-(Licor Bioscience, the U.S.), with GAPDH, (Santa Cruz Biotechnology is public
Department, the U.S.) it is internal reference, Odyssey infrared laser imaging system sweeps film.Testing result shows that PC-1090 effectively lowers SOX9's
Express (Fig. 4,5 shown in).
Embodiment 3, PC-1090 have suppression cell proliferation function on a cellular level
1) cell is cultivated and transfection: Hela cell is purchased from American Type Culture Collection committee of Chinese Academy of Sciences cell bank, training
Foster base is DMEM (Gibco, the U.S.), and cultural method is with in embodiment 2 3).Cell transfecting is with 4 in embodiment 2).
2) cytoactive detection: utilize CCK-8 (the green skies, Shanghai) test kit detection PC-1090mimic/NC to transfect Hela
Proliferative conditions after cell, carried out counting statistics every 24 hours to the cell after transfection.Testing result shows to compare matched group
(NC), the Hela cell proliferation of PC-1090mimics is suppressed (shown in Fig. 6).
Claims (3)
1. the microRNA regulating Cornu Cervi Pantotrichum young pilose antler skin fast-growth, it is characterised in that it is named: PC-5p-1090, its sequence
For CACUGACUGGCUCAGCGUGUGCCU.
2. the application of the microRNA regulating Cornu Cervi Pantotrichum young pilose antler skin fast-growth, it is characterised in that it suppresses cell proliferation.
The application of a kind of microRNA regulating Cornu Cervi Pantotrichum young pilose antler skin fast-growth the most according to claim 1, it is characterised in that
Suppression cell proliferation is to promote that transcription factor SOX9 of cell proliferation has been expressed by suppression.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610794787.2A CN106244593B (en) | 2016-08-31 | 2016-08-31 | It is a kind of adjust pilose antler young pilose antler skin fast-growth microRNA and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610794787.2A CN106244593B (en) | 2016-08-31 | 2016-08-31 | It is a kind of adjust pilose antler young pilose antler skin fast-growth microRNA and its application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106244593A true CN106244593A (en) | 2016-12-21 |
| CN106244593B CN106244593B (en) | 2019-04-30 |
Family
ID=58081189
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610794787.2A Active CN106244593B (en) | 2016-08-31 | 2016-08-31 | It is a kind of adjust pilose antler young pilose antler skin fast-growth microRNA and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106244593B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111690645A (en) * | 2019-03-13 | 2020-09-22 | 东北林业大学 | MicroRNA derived from cartilaginous antler and application thereof |
| CN112210554A (en) * | 2019-07-11 | 2021-01-12 | 东北林业大学 | CNBP-mediated microRNA derived from pilose antler and application thereof |
| CN115896103A (en) * | 2021-09-30 | 2023-04-04 | 东北林业大学 | RBPMS-mediated microRNA of pilose antler and application thereof |
-
2016
- 2016-08-31 CN CN201610794787.2A patent/CN106244593B/en active Active
Non-Patent Citations (3)
| Title |
|---|
| ZHENG,D. ET AL: "KJ179845.1", 《GENBANK》 * |
| 李璐等: "miRNA-93-5p对VEGF 的转录调控及其与梅花鹿茸细胞增殖的关系", 《东北林业大学学报》 * |
| 陈艳霞: "马鹿（Cervus elaphus）鹿茸快速生长期生长点软骨和茸皮组织microRNA表达谱研究", 《中国博士论文全文数据库》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111690645A (en) * | 2019-03-13 | 2020-09-22 | 东北林业大学 | MicroRNA derived from cartilaginous antler and application thereof |
| CN112210554A (en) * | 2019-07-11 | 2021-01-12 | 东北林业大学 | CNBP-mediated microRNA derived from pilose antler and application thereof |
| CN115896103A (en) * | 2021-09-30 | 2023-04-04 | 东北林业大学 | RBPMS-mediated microRNA of pilose antler and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106244593B (en) | 2019-04-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Tano et al. | MALAT-1 enhances cell motility of lung adenocarcinoma cells by influencing the expression of motility-related genes | |
| CN108753836A (en) | A kind of gene regulation or editing system using RNA interference mechanisms | |
| Chang et al. | Survival of hypoxic human mesenchymal stem cells is enhanced by a positive feedback loop involving miR-210 and hypoxia-inducible factor 1 | |
| Makki et al. | Identification of novel Hoxa1 downstream targets regulating hindbrain, neural crest and inner ear development | |
| CN102656268A (en) | Development of universal cancer drugs and vaccines | |
| US9422559B2 (en) | Production and utilization of a novel anti-cancer drug in therapy | |
| CN109182562B (en) | miRNA apla-mir-25-42 related to follicular development of laying ducks as well as detection primer, inhibitor and application thereof | |
| CN106244593A (en) | A kind of microRNA regulating Cornu Cervi Pantotrichum young pilose antler skin fast-growth and application thereof | |
| CN111035648B (en) | Application of long-chain non-coding RNAGAS5 in preparation of medicine for promoting nerve regeneration and repairing nerve injury | |
| CN106350519A (en) | MicroRNA for adjusting rapid growth of cornua cervi pantotrichum cartilage and application thereof | |
| CN109402118B (en) | miRNA apla-mir-145-4 related to follicular development of laying ducks as well as detection primer, inhibitor and application thereof | |
| JP5804459B2 (en) | Cell aging promoter for cancer diseases | |
| CN113186306A (en) | miRNA related to skin hair follicle maturation of sheep and application thereof | |
| CN114517204B (en) | CircPOLK for tumor treatment target and diagnosis biomarker and application thereof | |
| CN109402269A (en) | One kind miRNA relevant to duck enteron aisle oxidative stress and its application | |
| CN114854882A (en) | Sheep hair follicle development marker miR-23b and application thereof | |
| CN114891796A (en) | Application of miRNA-133 in regulating development of sheep embryo hair follicle | |
| Zhang et al. | MicroRNA sponge knockdowns miR-483-5p and upregulates serum ALT/AST in transgenic mice | |
| CN112210554A (en) | CNBP-mediated microRNA derived from pilose antler and application thereof | |
| CN103710372B (en) | A kind of construction process of the miR-505 high-expression vector for functional study | |
| CN114480672A (en) | Method for screening high-meat-yield alkaline black cattle through miR-145 | |
| EP2882859A2 (en) | Production and utilization of a novel anti-cancer drug in therapy | |
| CN110279706B (en) | Application of hnRNPC gene C1 and/or C2 subtype as drug target in screening anti-cancer drugs | |
| CN106215189A (en) | The people microRNA miR 185 application in preparing cell growth and/or Senescence manipulation agent | |
| CN111690645A (en) | MicroRNA derived from cartilaginous antler and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |