CN106244593B - It is a kind of adjust pilose antler young pilose antler skin fast-growth microRNA and its application - Google Patents
It is a kind of adjust pilose antler young pilose antler skin fast-growth microRNA and its application Download PDFInfo
- Publication number
- CN106244593B CN106244593B CN201610794787.2A CN201610794787A CN106244593B CN 106244593 B CN106244593 B CN 106244593B CN 201610794787 A CN201610794787 A CN 201610794787A CN 106244593 B CN106244593 B CN 106244593B
- Authority
- CN
- China
- Prior art keywords
- pilose antler
- microrna
- growth
- sequence
- mirna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering N.A.
- C12N2310/141—MicroRNAs, miRNAs
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Biomedical Technology (AREA)
- Chemical & Material Sciences (AREA)
- Molecular Biology (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
It is a kind of adjust pilose antler young pilose antler skin fast-growth microRNA and its application, it is related to a kind of tiny RNA (microRNA), the present invention provides the factors that inhibiting effect is played to this rapid growth cell of Northeast Wapiti (Cervus elaphus) pilose antler young pilose antler skin, it is named are as follows: PC-5p-1090, its sequence is CACUGACUGGCUCAGCGUGUGCCU, have the function of efficiently lowering SOX9 albumen, proliferation capable of inhibiting cell.
Description
Technical field
The present invention relates to a kind of tiny RNA (microRNA), the cancer sample of negative regulation pilose antler is grown.
Background technique
In mammals, only pilose antler angle is currently known unique organ with table form power of regeneration, that is, is being lost
It can also be regenerated completely after going and come (such as Fig. 1,2).In the regeneration period, pilose antler extends 1-2cm from grown on top point is average daily.
So someone claims the growth of pilose antler to be " cancer sample " (cancer-like) growth.With a large amount of carcinogenic factors in recent years, as TNF α,
The discovery of KGF etc., this viewpoint for thinking the growth of pilose antler cancer sample have obtained the support of molecular level evidence.It can be noticeable
It is tumour and the seldom self-healing of cancerous tissue, and pilose antler can be finally automatically stopped after cancer sample growth in nearly hundred days, young pilose antler skin
It can slowly death fall off.Negative regulatory factor is certainly existed during stopping after this pilose antler young pilose antler skin cancer sample growth to work.
MicroRNA (miRNA) is the negative regulatory factor of gene expression raw, important in one kind, by adjusting target
MRNA stability or translation efficiency show its function.These tiny RNA length have for 20-24 nucleotide, from long
The transcripton of hair fastener sample secondary structure, and sheared by two kinds of endonucleases Drosha and Dicer.Detailed process: miRNA is first
By endonuclear ribalgilase Drosha generate, this enzyme by the primary miRNA encoded in gene (primary miRNA,
Pri-miRNA loop-stem structure) is processed into precursor miRNA (precursor miRNA, pre-miRNA), and 60-70 nucleotide is long.
Then pre-miRNA indexing is output to by cytoplasm by output albumen 5 (esportin-5), and in another RNAIII,
The miRNA of double-strand is formed under the action of Dicer.
It includes AGO that RNA, which induces silencing complex (RNA-induced silencing complex, RISC),
(argonaut) albumen forms miRNA double-strand.Wherein a chain forms mature miRNA and another chain degradation.It is mature
MiRNA protein complexes carry out Transcription inhibition or degradation mRNA is determined by conjunction with the 3 ' of the mRNA area UTR target sites
In mature miRNA and target mRNA complementarity.
The selective active of one miRNA depends on the seed sequence (seed of the miRNA complementary with this homologous mRNA
region).Because the intraseminal imperfect base pairing of microRNA, which represents this core 5-7 nucleotide sequence, potential to be known
MRNA sequence that Jie He be not many, seed sequence repeats usually in genome and at the same time the several hundred a target mRNA of regulation.So
And the single protein level of miRNA influence is relatively mild, nevertheless, pass through a miRNA in an access while adjusting several
The situation of a gene has a build-up effect for the biological process derived from this access.
More and more evidences show miRNA in biology such as many cell Proliferations, differentiation, form generation and tumour generations
Very crucial adjustment effect is played in the process.It is well known that miRNA participates in adjusting tumour starting and progress, and by inhibiting mesh
Mark gene plays the function of oncogene or tumor suppression.To currently, more and more miRNA are proved in development of cancer
It plays a very important role, this illustrates that miRNA can be used as the potential new target drone for the treatment of cancer.
SOX9(transcription factor sex-determining region Y(SRY)-box 9protein)
Belong to SOX family, is that male decisions, Subchondral drilling, nerve formation and impaired neural crest development, stem cell are formed etc. in developmental processes
One transcription factors critical.Multinomial research confirms that SOX9 plays a decisive role in cell Proliferation and cells survival.
Summary of the invention
Inhibit to make present invention determine that Northeast Wapiti (Cervus elaphus) pilose antler young pilose antler skin this rapid growth cell rises
The factor, and determine title, the sequence of this negative regulatory factor.MicroRNA number of the present invention from red deer pilose antler young pilose antler skin tissue
It is a kind of specific expressed in fine and soft skin according to the microRNA screened in library, PC-5p-1090 (hereinafter referred to as PC-1090)
MiRNA, be 24nt, can not detect maturation miRNA in cartilaginous tissue.Sequence is as shown in SEQ ID NO:1
(CACUGACUGGCUCAGCGUGUGCCU)。
The present invention is by experiments such as the isocellular cell Proliferation detection of Hela, U2OS, 293T and Western Blotting
Prove that PC-1090 lowers the expression (Fig. 4,5 shown in) of cell Proliferation key transcription factor SOX9, proliferation (Fig. 6 institute capable of inhibiting cell
Show).
The present invention include it is following the utility model has the advantages that
As the negative regulatory factor of gene expression, microRNA is in cell growth, allelotaxis, individual growth and various diseases
All play the role of in the process of disease very important.Therefore, it is separated from the pilose antler top young pilose antler skin tissue of fast-growth
MicroRNA sequence can play very important regulating and controlling effect to the cancer sample growth of pilose antler and automatic terminate.
For this purpose, the present invention is obtained from the newborn road pilose antler top young pilose antler skin tissue microRNA sequencing result of fast growing period
To a miRNA, PC-1090, transcript precursor is about 120nt, can form hairpin structure, mature miRNA overall length 24nt
(the GenBank number of logging in: KJ179845), without homologous sequence in miRBase database (Release 21).BLAST result is aobvious
Show, either maturation miRNA overall length or its seed sequence, in people, mouse, rat, dog, chicken, pig isotype species gene group
In without homologous sequence.Only there are the homologous sequence of mature miRNA, similitude on ox (Bos taurus) o.11 chromosome
100%.
Predict that the key factor S OX9 of pilose antler young pilose antler skin development is one of the target gene of PC-1090 by TargetScan,
There is targeting to SOX9 by PC-1090mimics experimental verification PC-1090, proved in the cells such as U2OS, 293T
PC-1090 has the function of efficiently lowering SOX9 albumen (experimental result is as shown in Figure 4,5), and inhibits cell Proliferation (experiment
As a result as shown in Figure 6).
The gene order that the present invention screens is as follows:
Title: PC-5p-1090
Sequence: CACUGACUGGCUCAGCGUGUGCCU.
Detailed description of the invention
Fig. 1 is red deer pilose antler table form regeneration period figure.Wherein, arrow meaning is pilose antler top hyperplasia area；
Fig. 2 is pilose antler fast growing period top hyperplasia area axially longitudinal sectional figure and fine and soft skin tissue structure chart；Wherein, left side is axis
To longitudinal sectional figure, right side is fine and soft skin tissue structure chart, and E is epithelium, and D is skin corium, and RM is mesenchyma layer, and CA is non-mineralising cartilage
Area, H are hair follicle, and S is sebaceous glands；Red blood vessel in visible cartilage at arrow meaning in figure；
Fig. 3 is seed sequence of the 3 ' area UTR various modes biology SOX9mRNA with potential PC-1090 (under small letter adds
Underlined sequence) it is complementary in conjunction with conserved positions (sequence in frame)；
Fig. 4 is that PC-1090mimics lowers U2OS cellular endogenous SOX9 protein level figure；Internal reference is GAPDH；
Fig. 5 is that PC-1090mimics can lower 293T cell pMIR-SOX9-3UTR-Luc carrier expressing luciferase；It is interior
Ginseng is GAPDH, and experiment sets pMIR-Luc empty plasmid (ev) control；
Fig. 6 be CCK-8 method detection transfection PC-1090mimics after with Hela cell-proliferation activity that 24 hours are interval
Figure；Wherein, A is PC-1090-NC negative control activity curve；B is PC-1090mimics activity curve.
Specific embodiment
Specific embodiment 1: a kind of microRNA of adjusting pilose antler young pilose antler skin fast-growth of present embodiment, it is named
Are as follows: PC-5p-1090, sequence are CACUGACUGGCUCAGCGUGUGCCU (as shown in Seq ID No:1).
Specific embodiment 2: the application of the microRNA of adjusting pilose antler young pilose antler skin fast-growth of present embodiment a kind of,
The key transcription factor SOX9 for promoting cell Proliferation is inhibited to express.
Specific embodiment 3: the application of the microRNA of adjusting pilose antler young pilose antler skin fast-growth of present embodiment a kind of,
It has the function of to inhibit cell Proliferation.
The content of present invention is not limited only to the content of the respective embodiments described above, the group of one of them or several specific embodiments
The purpose of invention also may be implemented in contract sample.
Beneficial effects of the present invention are verified by following embodiment:
Embodiment below facilitates a better understanding of the present invention, but does not limit the present invention.Experiment in following embodiments
Method is unless otherwise specified conventional method.Test material as used in the following examples is unless otherwise specified certainly
Conventional biochemical reagent company is commercially available.% in following embodiments is unless otherwise specified mass percentage.With
Quantitative test in lower embodiment, is respectively provided with three repeated experiments, results are averaged.
The acquisition process of embodiment 1, pilose antler young pilose antler skin PC-1090
1) material obtains: experiment material therefor is the Northeast Wapiti pilose antler young pilose antler skin tissue in the rapid growth phase about 70 days
(shown in Fig. 2).Pilose antler apical meristem is cut into the sheet that thickness is less than 0.5cm with the scissors of disinfection immediately after saw is fine and soft, is put immediately
Enter to be equipped in the protection liquid (RNAlater) for preventing RNA from degrading, be placed in low temperature storage box and takes back laboratory preservation.
2) extraction of mRNA: 30mg is weighed after laboratory to be saved to the fine and soft skin tissue separation of pilose antler, in superclean bench
Quickly chopping is placed in sterile 1.5mL test tube, utilizes QIAGEN company (Germany) kit DNeasy Blood&Tissue Kit
(Cat.No.69504) total serum IgE in pilose antler young pilose antler skin is extracted, and the total serum IgE of extraction is finally dissolved in the water of RNAse-free
In, the total serum IgE of extraction all has higher quality (OD260nm/OD280nm:1.75-1.86) by spectrophotomelric assay.
3) it is logical that the total serum IgE of extraction pilose antler young pilose antler skin small RNA high-flux sequence: is delivered to Lian Chuan company, the U.S. (Hangzhou)
It crosses Illumina miRNA Solexa microarray dataset and carries out the pilose antler young pilose antler skin tissue library small RNAs progress high-flux sequence
Afterwards, data processing is carried out with ACGT101-miRv4.2 (LC Sciences) software.
4) acquisition of the new miRNAPC-1090 of pilose antler young pilose antler skin: the library small RNA of pilose antler young pilose antler skin tissue is carried out respectively
Sequence initial data is obtained after Solexa deep sequencing and carries out comprehensive analysis, obtains a kind of new miRNA, PC-1090, sequence is not
The miRNAs precursor (pre-miRNAs) for arriving miRBase ox can be compared, but measuring sequence (known maturation body) can compare
Onto genome, and the genome sequence extended can form qualified hairpin structure.
5) one of target gene of PC-1090 microRNA target prediction: is predicted by TargetScan to adjust fine and soft skin rapid growth
Key transcription factor SOX9.
Embodiment 2, PC-1090 can be lowered on a cellular level promotees the key factor S OX9 expression of cell Proliferation
1) PC-1090 is synthesized: PC-1090 sequence is delivered to Shanghai Ji Ma company synthesis mimics and corresponding
Negative Control(NC)。
2) construct SOX9-3 ' UTR-pMIR-REPORT carrier: sequence alignment analysis learns various modes biology Sox9mRNA
3 ' the areas UTR have potential PC-1090seed sequence (small letter underlines sequence) is complementary to combine conserved positions (sequence in frame)
(shown in Fig. 3).Therefore, the present embodiment is inserted into pMIR- according to the segment that 339bp has been cloned in the 3 ' areas UTR of mouse SOX9
In REPORT (Applied Biosystems company, the U.S.) carrier, wherein Insert Fragment includes the mutual of PC-1090 seed sequence
Complementary series, Insert Fragment (as shown in Seq ID No:2) are as follows:
caatgttttcagccatagacctttgggtctgcctggactgtatgtggatgtgtgcgtgtgttgtgaca
cgggacaacacatgcctctgcaagtgtgtgtgccgtggatagccccttggctgctctcctgcagagagacatcgga
cagaccttaattcttactcactgctgtggctggagagtataaggaatgctttttctttttttctttctttctttct
tttttttttttaagacagcagtctttttttttaatttaaaaaaaaaaagatatattaacagttttagaagtcagta
gaataaaaccttaaagcgttcttataatatggcatctttcgcg。
PMIR-REPORT carrier is that the target sequence by a miRNA of ABI company (U.S.) design is inserted into polyclonal position
In point, the luciferase protein Luciferase report carrier of pMIR-REPORT can be used to qualitative and quantitative measurement miRNA
Function.As PC-1090mimics and SOX9-3 ' UTR-pMIR-REPORT carrier cotransfection cells when, if Luciferase egg
White expression is lowered, and illustrates that PC-1090 has downward effect to SOX9 expression.
3) cell culture: 293T cell and U2OS cell are purchased from the American Type Culture Collection committee, Chinese Academy of Sciences cell
Library, culture medium: 293T cell culture medium is DMEM (Gibco, the U.S.), and U2OS cell culture medium is McCoy's 5A
(Modified) (Gibco, the U.S.) Medium, add 10% fetal calf serum (Gibco, the U.S.) and 100U/mL's is dual anti-
(Invetrogen company, the U.S.).37 DEG C are placed in, is cultivated under 5% carbon dioxide conditions.
4) transfection is detected with Western: cell is with 8 × 105A/hole kind is cultivated 36 hours, cell on 6 well culture plates
Convergence degree reaches 70%-80%, is to mediate with Lipofectmin3000 (Invetrogen company, the U.S.), by the PC- of synthesis
1090 mimics and SOX9-3 ' UTR-pMIR-REPORT carrier transfects U2OS cell, 293T cell, the weight of transfection
Group plasmid amount is the hole 2ug/.Cell is received after 40~48 hours, it is pre- using the PAGE of 4%-12% after carrying out denaturation treatment to albumen
Glue (Invitrogen company, the U.S.) electrophoresis.It is small with the TBST mixed liquor closing 2 of 5% skimmed milk power after turning nitrocellulose membrane
When, then nitrocellulose membrane respectively in SOX9 primary antibody (Santa Cruz Biotechnology company, the U.S.) (Fig. 4) or
Be incubated for 2 hours in Luciferase primary antibody (Santa Cruz Biotechnology company, the U.S.) (Fig. 5) or more, fluorescence mark
It is incubated for 1 hour in the secondary antibody (Licor Bioscience, the U.S.) of note, with GAPDH, (Santa Cruz Biotechnology is public
Department, the U.S.) it is internal reference, Odyssey infrared laser imaging system sweeps film.Testing result shows that PC-1090 effectively lowers SOX9's
Expression (Fig. 4,5 shown in).
Embodiment 3, PC-1090 have the function of to inhibit cell Proliferation on a cellular level
1) cell culture and transfection: Hela cell is purchased from Chinese Academy of Sciences's American Type Culture Collection committee cell bank, training
Support base be DMEM (Gibco, the U.S.), cultural method in embodiment 2 3).Cell transfecting is with 4 in embodiment 2).
2) cytoactive detection: Hela is transfected using CCK-8 (the green skies in Shanghai) kit detection PC-1090mimic/NC
Proliferative conditions after cell carried out counting statistics to the cell after transfection every 24 hours.Testing result shows compared to the control group
(NC), the Hela cell Proliferation of PC-1090mimics is suppressed (shown in Fig. 6).
Claims (1)
1. a kind of application for the microRNA for adjusting pilose antler young pilose antler skin fast-growth, it is characterised in that it, which is prepared, inhibits cell Proliferation
Drug；The microRNA of the adjusting pilose antler young pilose antler skin fast-growth is fine and soft from Northeast Wapiti (Cervus elaphus) pilose antler
Skin, name are as follows: PC-5p-1090, sequence CACUGACUGGCUCAGCGUGUGCCU；The inhibition cell Proliferation is logical
The transcription factor SOX9 expression for inhibiting to promote cell Proliferation is crossed to complete.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610794787.2A CN106244593B (en) | 2016-08-31 | 2016-08-31 | It is a kind of adjust pilose antler young pilose antler skin fast-growth microRNA and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610794787.2A CN106244593B (en) | 2016-08-31 | 2016-08-31 | It is a kind of adjust pilose antler young pilose antler skin fast-growth microRNA and its application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106244593A CN106244593A (en) | 2016-12-21 |
| CN106244593B true CN106244593B (en) | 2019-04-30 |
Family
ID=58081189
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610794787.2A Active CN106244593B (en) | 2016-08-31 | 2016-08-31 | It is a kind of adjust pilose antler young pilose antler skin fast-growth microRNA and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106244593B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111690645A (en) * | 2019-03-13 | 2020-09-22 | 东北林业大学 | MicroRNA derived from cartilaginous antler and application thereof |
| CN112210554A (en) * | 2019-07-11 | 2021-01-12 | 东北林业大学 | CNBP-mediated microRNA derived from pilose antler and application thereof |
| CN115896103A (en) * | 2021-09-30 | 2023-04-04 | 东北林业大学 | RBPMS-mediated microRNA of pilose antler and application thereof |
-
2016
- 2016-08-31 CN CN201610794787.2A patent/CN106244593B/en active Active
Non-Patent Citations (3)
| Title |
|---|
| KJ179845.1;Zheng,D. et al;《GenBank》;20140409;全文 |
| miRNA-93-5p对VEGF 的转录调控及其与梅花鹿茸细胞增殖的关系;李璐等;《东北林业大学学报》;20141106;第42卷(第11期);摘要及第148页表2 |
| 马鹿（Cervus elaphus）鹿茸快速生长期生长点软骨和茸皮组织microRNA表达谱研究;陈艳霞;《中国博士论文全文数据库》;20170215;A006-55 |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106244593A (en) | 2016-12-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Tano et al. | MALAT-1 enhances cell motility of lung adenocarcinoma cells by influencing the expression of motility-related genes | |
| Makki et al. | Identification of novel Hoxa1 downstream targets regulating hindbrain, neural crest and inner ear development | |
| CN108753836A (en) | A kind of gene regulation or editing system using RNA interference mechanisms | |
| CN102656268A (en) | Development of universal cancer drugs and vaccines | |
| CN108368487A (en) | The excretion body of nucleic acid is packed | |
| CN111035648B (en) | Application of long-chain non-coding RNAGAS5 in preparation of medicine for promoting nerve regeneration and repairing nerve injury | |
| EP2374884A2 (en) | Human miRNAs isolated from mesenchymal stem cells | |
| CN111154763B (en) | Application of long-chain non-coding RNA lncMGPF in regulation and control of pig muscle development function | |
| CN106244593B (en) | It is a kind of adjust pilose antler young pilose antler skin fast-growth microRNA and its application | |
| CN106350519A (en) | MicroRNA for adjusting rapid growth of cornua cervi pantotrichum cartilage and application thereof | |
| Li et al. | Downregulation of miR‑98 contributes to hypoxic pulmonary hypertension by targeting ALK1 | |
| Jin et al. | Oar-miR-432 regulates fat differentiation and promotes the expression of BMP2 in ovine preadipocytes | |
| CN113186306A (en) | miRNA related to skin hair follicle maturation of sheep and application thereof | |
| CN101705227B (en) | SiRNA for inhibiting human AP-2alpha gene expression and anti-cervical cancer application thereof | |
| CN109394779A (en) | A kind of miR-183 instrumentality of liver cell and its application adjusted in liver cell drug is treated in preparation | |
| CN110279706B (en) | Application of hnRNPC gene C1 and/or C2 subtype as drug target in screening anti-cancer drugs | |
| CN112210554A (en) | CNBP-mediated microRNA derived from pilose antler and application thereof | |
| CN113995768A (en) | Application of oligonucleotide in inhibiting multiple tissue organ cell damage caused by new coronavirus | |
| CN111690645A (en) | MicroRNA derived from cartilaginous antler and application thereof | |
| CN115896103A (en) | RBPMS-mediated microRNA of pilose antler and application thereof | |
| EP4023229A1 (en) | Sirna capable of inhibiting expression of mcm7 gene, composition, and application thereof | |
| CN112941183B (en) | Application of non-coding gene miR-187-5p in primary liver cancer diagnosis and treatment | |
| CN112921093B (en) | Application of lnc-AGO2 functional expression inhibitor in preparation of medicine for treating breast cancer | |
| CN112852965B (en) | Application of lnc-ZNF100-5 functional expression inhibitor in preparation of medicine for treating breast cancer | |
| CN112980957B (en) | Target hsa _ circ _0001326 for inhibiting non-small cell lung cancer metastasis and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |