CN107746886A - A kind of blood plasma miRNA mark related to colorectal cancer auxiliary diagnosis and its application - Google Patents
A kind of blood plasma miRNA mark related to colorectal cancer auxiliary diagnosis and its application Download PDFInfo
- Publication number
- CN107746886A CN107746886A CN201710810621.XA CN201710810621A CN107746886A CN 107746886 A CN107746886 A CN 107746886A CN 201710810621 A CN201710810621 A CN 201710810621A CN 107746886 A CN107746886 A CN 107746886A
- Authority
- CN
- China
- Prior art keywords
- mir
- mirna
- blood plasma
- colorectal cancer
- primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/136—Screening for pharmacological compounds
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Pathology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Hospice & Palliative Care (AREA)
- Biophysics (AREA)
- Oncology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention discloses a kind of blood plasma miRNA mark related to colorectal cancer auxiliary diagnosis and its application, and the mark is the one or more in miR 103a 3p, miR 127 3p, miR 151a 5p, miR 17 5p, miR 181a 5p, miR 18a 5p and miR 18b 5p.Blood plasma miRNA has the characteristics of good, minimally invasive, easy acquisition of stability, sensitivity and specificity are high as new biomarker.The utilization of this kind of molecular marker will provide new direction for the diagnosis of the various diseases including tumour and further treatment.This research is by the more targeted plasma of colorectal cancer miRNA labels drawn with clinical diagnosis potential.Research confirms reliabilities and repeatability of this group of miRNA as the noninvasive label of diagnosis colorectal cancer.
Description
Technical field
The invention belongs to genetic engineering and oncology, is related to a kind of blood plasma related to colorectal cancer auxiliary diagnosis
MiRNA marker and its application.
Background technology
Colorectal cancer (Colorectal, CRC) is one of global incidence and the higher malignant tumour of the death rate.In
State, the death rate of colorectal cancer still occupy the 5th, tumour.In terms of life cycle, the five year survival rate of early stage colorectal cancer patients can
To reach more than 90%, and IV phases patient only has the survival rate slightly larger than 10%.At present, because economic condition and crowd receive water
Flat, China can not yet promote the early stage colorectal cancer examination project based on colonoscopy.And because colonoscopy detection is dependent on inspection
The person's of looking into experience, and have certain wound risk, also resulting in promote.The most commonly used tumor markers of clinical practice at present,
Such as carcinomebryonic antigen (CEA) and CA19-9 (CA19-9), and fecal occult blood experiment (FOBT) examination colorectal cancer, lack
Weary certain sensitivity and specificity.It is more next with the development of the biotechnologys such as genomics, protein science and metabolism group
More biomarkers has been observed that or studied.Thus, it is found that the new label that can early diagnose colorectal cancer is in a few days
It can treat, so as to promote colorectal cancer early intervention and treatment, extend the life cycle of patient.
Microrna (miRNAs) is small non-coding RNA molecule of a kind of length in the nucleotides of 22 or so, and it is by turning
Regulate and control the various vital movement processes of wide participation after record, include generation, invasion and attack and the transfer etc. of tumour.Research finds, miRNA
Expression there is different degrees of upper mediation to lower in tumour, can establish base as a kind of emerging tumor markers for it
Plinth.2008, Mitchell detected free miRNA in peripheral blood, it is found that it can be stable in the presence of in peripheral blood, and
And can be as the noninvasive mark of diagnosing tumour.There is now research confirms circulation miRNA in stomach cancer, lung cancer, breast cancer etc.
Potential diagnostic value in tumour.But due to research method and the difference of crowd is included, causes result of study not quite identical.Cause
This, this research and utilization Exiqon miRNA qPCR panel chips and the absolute quantitation method based on qRT-PCR, by big
The research of the plasma of colorectal cancer of sample, it is intended to which finding has the blood plasma miRNA of potential diagnostic value to colorectal cancer.And to this
A little expression of the miRNA in Colorectal Carcinoma and in the blood plasma excretion body of periphery are verified, further to define itself and knot
The relation of the carcinoma of the rectum.If according to this kind of miRNA designs for the diagnostic kit of colorectal cancer, it will promote China's colorectal cancer
Treatment level, also provide thinking for further research of the future to colorectal cancer.
The content of the invention
It is an object of the invention to provide a kind of blood plasma miRNA mark related to colorectal cancer auxiliary diagnosis.
Another object of the present invention is to provide above-mentioned blood plasma miRNA mark and its primer to prepare colorectal cancer auxiliary
Diagnostic kit and the application in the medicine for preparing treatment colorectal cancer.
A further object of the present invention is to provide a kind of kit and medicine for being used for colorectal cancer auxiliary diagnosis and treatment.
The purpose of the present invention can be achieved through the following technical solutions：
A kind of blood plasma miRNA mark related to colorectal cancer auxiliary diagnosis, the mark are miR-103a-3
(AGCAGCAUUGUACAGGGCUAUGA), miR-127-3p (UCGGAUCCGUCUGAGCUUGGCU), miR-151a-5p
(UCGAGGAGCUCACAGUCUAGU), miR-17-5p (CAAAGUGCUUACAGUGCAGGUAG), miR-181a-5p
(AACAUUCAACGCUGUCGGUGAGU), miR-18a-5p (UAAGGUGCAUCUAGUGCAGAUAG and miR-18b-5p
(UAAGGUGCAUCUAGUGCAGUUAG) one or more in.The blood plasma miRNA mark be preferably miR-103a-3p,
Two kinds or two in miR-127-3p, miR-151a-5p, miR-17-5p, miR-181a-5p, miR-18a-5p and miR-18b-5p
The combination of the kind above, more preferably miR-103a-3p, miR-127-3p, miR-151a-5p, miR-17-5p, miR-
The combination that seven kinds of miRNA of 181a-5p, miR-18a-5p and miR-18b-5p are formed.
Application of the above-mentioned blood plasma miRNA mark in auxiliary diagnosis colorectal cancer.
Application of the above-mentioned blood plasma miRNA mark in colorectal cancer auxiliary diagnostic box is prepared.
Above-mentioned blood plasma miRNA mark is preparing the application in treating colorectal cancer medicine.
A kind of primer of the blood plasma miRNA mark related to colorectal cancer auxiliary diagnosis, the primer include miR-103a-
One in 3p, miR-127-3p, miR-151a-5p, miR-17-5p, miR-181a-5p, miR-18a-5p and miR-18b-5p
The primer of kind or a variety of miRNA；Preferably include blood plasma miRNA in miR-103a-3p, miR-127-3p, miR-151a-5p,
Two or more miRNA primer in miR-17-5p, miR-181a-5p, miR-18a-5p and miR-18b-5p；Enter one
Step is preferably to include blood plasma miR-103a-3p, miR-127-3p, miR-151a-5p, miR-17-5p, miR-181a-5p, miR-
Seven kinds of miRNA of 18a-5p and miR-18b-5p primer.
Application of the above-mentioned primer in auxiliary diagnosis colorectal cancer or preparation colorectal cancer auxiliary diagnostic box.
A kind of colorectal cancer auxiliary diagnostic box, miR-103a-3p, miR- in blood plasma miRNA are contained in the kit
One or more in 127-3p, miR-151a-5p, miR-17-5p, miR-181a-5p, miR-18a-5p and miR-18b-5p
MiRNA primer；Preferably contain miR-103a-3p, miR-127-3p, miR-151a-5p, miR-17- in blood plasma miRNA
Two or more miRNA primer in 5p, miR-181a-5p, miR-18a-5p and miR-18b-5p；More preferably
Contain miR-103a-3p, miR-127-3p, miR-151a-5p, miR-17-5p, miR-181a-5p, miR- in blood plasma miRNA
Seven kinds of miRNA of 18a-5p and miR-18b-5p primer.
Also include the reagent that round pcr is commonly used in the kit.Such as reverse transcriptase, buffer solution, dNTPs, MgCl2, DEPC
Water and Taq enzyme etc.；Standard items and/or reference substance can also be contained.
Blood plasma miRNA mark miR-103a-3p, miR-127- related to diagnosis of colorectal carcinoma involved in the present invention
The sequence of every kind of miRNA in 3p, miR-151a-5p, miR-17-5p, miR-181a-5p, miR-18a-5p and miR-18b-5p
Row are disclosed, but each miRNA marker is combined needs this area skill as colorectal cancer auxiliary diagnosis mark
Art personnel pay creative work.The amplimer of each miRNA marker can be bought by market and be obtained, the embodiment of the present invention
The primer of the middle blood plasma miRNA mark used is purchased from the specific miRNA stem rings RT- produced synthesized by the Rui Bo companies of Guangzhou
PCR primer.
Specifically, the technical scheme of the present invention solved the problems, such as includes：(1) sample storehouse and data of unified standard are established
Storehouse：Standard compliant blood sample, the complete demographic data of systematic collection and clinical money are gathered with S.O.P. (SOP)
Material.(2) blood plasma miRNA differential expression spectrum analysis：Analyze the blood plasma of differential expression in colorectal cancer and normal control population
MiRNA, and further large sample multistage checking is carried out to differential expression miRNAs.(3) by multistage checking, this is specified
The ability of a little miRNA diagnosis colorectal cancers.(4) development of blood plasma miRNA diagnostic kit：According to colorectal cancer patients and normally
Differential expression miRNA exploitation miRNAs diagnostic kits in crowd's blood plasma, realize and the noninvasive auxiliary of colorectal cancer patients are examined
It is disconnected.(4) expressions of these miRNA in Colorectal Carcinoma and excretion body is analyzed, discloses these miRNA and Colon and rectum
The relation of cancer, the medicine that treatment colorectal cancer that may be related to these miRNA is developed for future provide foundation.
The present inventor gathers standard compliant blood sample, the complete population of systematic collection with S.O.P. (SOP)
Data, clinical data, and employ Exiqon miRNA qPCR panel chips and qRT-PCR methods etc..
The experimental method specifically studied mainly includes following components：
1. study samples selection：Just control, row operation and chemicotherapy intervention and the trouble that colorectal cancer is confirmed as through pathology
Person.Normal control is the normal population to be checked UP in hospital.
2.Exiqon miRNA qPCR panel chip primary dcreening operations：Blood plasma mixing sample is carried out using TRIZOL-LS reagents
RNA is extracted, and is carried out qRT-PCR operations and obtained primary dcreening operation result.
3. training set, test set and additional authentication collection：Each plasma sample is entered using AM1556 kits (ABI companies)
Row RNA is extracted, and obtains cDNA samples by reverse transcription reaction, it is anti-that addition PCR primer and SYBR Green fluorescent dyes enter performing PCR
Should.By comparing the Ct values of standard items, the miRNA contents in sample are drawn.
4. utilize the RNA in AM1975 kits (ABI companies) extraction colorectal cancer and cancer beside organism, ExoQuick reagents
RNA in box (SBI companies) and AM1556 kits (ABI companies) extraction excretion body, passes through qRT-PCR method, detection
Differential expressions of the miRNA in tissue and excretion body.
5. statistical analysis：With χ2Examine, paired t-test and non-parametric rank sum test compare miRNA expressions and existed
Difference in different seminar.The diagnostic value of blood plasma miRNA is confirmed by calculating ROC curve analysis.
Seminar of the present invention carries out the expression point of system by the miRNA in the periphery blood plasma to Patients with Colorectal Cancer at present
Analysis, it has now been found that one group 7 there is clinical diagnosis potential plasma of colorectal cancer microRNA labels (miR-103a-3p,
MiR-127-3p, miR-151a-5p, miR-17-5p, miR-181a-5p, miR-18a-5p and miR-18b-5p).
Beneficial effects of the present invention：
1. compared to traditional tumor markers, blood plasma miRNA as new biomarker, have stability it is good,
It is minimally invasive, it is easy obtain, sensitivity and specificity it is high the characteristics of.The utilization of this kind of molecular marker are by for including tumour
The diagnosis of various diseases and further treatment provide new direction.
2. researcher is by Exiqon miRNA qPCR panel chips and the absolute quantitation method based on qRT-PCR, right
Differential expression miRNA in colorectal cancer and normal control population's blood plasma carries out tight, multistage checking and evaluation.Confirm
Reliabilities and repeatability of this group of miRNA as the noninvasive label of diagnosis colorectal cancer.
3. researcher find expression of the miR-17-5p and miR-151a-5p in Colorectal Carcinoma also with table in blood plasma
Up to consistent, it is shown that the close relation between this group of miRNA and colorectal cancer.MiR-17-5p, miR-181a-5p, miR- simultaneously
Expression of the 18a-5p and miR-18b-5p in blood plasma excretion body is also above normal control.These results will give future studies
These miRNA provide new thinking for the mechanism of colorectal cancer and for treatments of these miRNA for colorectal cancer.
Brief description of the drawings
Fig. 1：Experiment flow figure
Fig. 2：7 miRNA of high expression in plasma of colorectal cancer
Fig. 3：ROC curve analysis is carried out to the miRNA obtained.
A：The intersection of training set and test set；B：Training set；C：Test set.D：Additional authentication collection
Fig. 4：Expressions of 7 miRNA in Colorectal Carcinoma
Fig. 5：Expressions of 7 miRNA in colorectal cancer patients blood plasma excretion body
Embodiment
Inventor have collected substantial amounts of colorectal cancer in 2013 to 2015 from No.1 Attached Hospital, Nanjing Medical Univ
Patient and the venous plasma sample of normal Check-up crowd, by the arrangement to sample data, it therefrom have selected 139 colorectal cancers
Tested with the sample of 132 normal controls as Exiqon miRNA qPCR panel chips primary dcreening operations and a series of follow-up qRT-PCR
The laboratory sample of card.24 Colorectal Carcinomas and 24 cancer beside organisms are also left and taken simultaneously.Selected patients blood plasma's sample
Both from just control, row operation and chemicotherapy intervention and the patient for confirming as through pathology colorectal cancer.And system acquisition
The demographic data of these samples, clinical data.
With reference to flow chart (Fig. 1), 30 Colon and rectums have been randomly choosed from colorectal cancer and normal control plasma sample
Cancer sample and 10 normal controls, and 3 plasma of colorectal cancer mixing samples and 1 normal aggregate sample have been mixed into respectively
This (mixing sample is converged the sample for forming 2ml by 10 200ul plasma samples).This 4 mixing samples are carried out
Exiqon miRNA qPCR panel chips primary dcreening operations and analysis, specific steps are with reference to Exiqon miRNA qPCR panel chips
Specification：
1. blood plasma extracts
Plasma sample is taken out, 3000x g centrifuge 5min and remove some fragments and some insoluble components after sample thaws.Transfer
Supernatant after adding 750ul TRIZOL-LS, acutely shakes 5s into new 1.5ml pipes.
2. two-phase laminated flow
Sample is incubated 5 minutes in 15 to 30 DEG C after homogenate.Added in the sample that TRIZOL-LS reagents per 1ml are homogenized
0.2ml chloroform, covers tightly lid.Acutely after 15 seconds, 15 to 30 DEG C are incubated 2 to 3 minutes vibration body manually.13,000g at 4 DEG C
Centrifugation 15 minutes.
3.RNA is precipitated
Aqueous phase is transferred in new centrifuge tube.Aqueous phase is mixed with isopropanol to precipitate RNA therein, adds the amount of isopropanol
For：Add 0.5ml isopropanol and 5ul glycogen in the sample of 1ml TRIZOL-LS reagents homogenate.4 DEG C of standing half an hour, allow
RNA is separated out as far as possible.Centrifuged 15 minutes in 4 DEG C of 13,000g.
4.RNA is cleaned
Supernatant is removed, at least the 75% of 1ml (v/v) ethanol is added in the sample per the homogenate of 1ml TRIZOL-LS reagents,
Clean RNA precipitate.10 minutes are stood, then 10000g is centrifuged 5 minutes at 4 DEG C.
5. RNA precipitate is dissolved again
Remove ethanol solution, air drying RNA precipitate 5-10 minutes, add no RNase water blown and beaten repeatedly with rifle it is several
Secondary, then 55 to 60 DEG C are incubated 10 minutes.
6. measure concentration：
Usually lead to~5 μ g RNA/50ml blood plasma.
7.cDNA is synthesized
(1) template ribonucleic acid is diluted：20-25ng template ribonucleic acids are diluted to 14ul (final concentration of 1.492- using DEPC water
1.786ng/μl)。
(2) reaction solution is prepared：5 × Reaction Buffer and DEPC water is placed in and dissolved on ice, and shakes mixing.
Enzyme mix are placed in -20 DEG C of ice chests, are placed on ice after mixing is flicked before use.All reagents use after centrifuging.
(3) reaction solution is configured：Configure the reaction solution in following table
(4) mix and centrifuge reagent：Concussion or suction centrifuge after mixing reaction solution, to ensure that all solution are thoroughly mixed
Uniformly.
(5) reverse transcription reaction and heat inactivation：By reaction solution after 42 DEG C incubate 60 minutes, 5 minutes are incubated in 95 DEG C to lose
Reverse transcriptase living.
8.Real-Time PCR
Reagent：
Nuclease free water(Exiqon)
SYBRTMGreen master mix(Exiqon)
CDNA templates
ROX(Invitrogen)
miRNA PCR ARRAY(Exiqon)
Instrument：
ABI PRISM7900system(Applied Biosystems)
(1) Real-time PCR reagents are prepared：By the cDNA templates of preparation, DEPC water and SYBRTMGreen master
Mix is placed in dissolving 15-20 minutes on ice.
(2) cDNA templates are diluted：The cDNA templates that RT reactions obtain are diluted 110 times with nuclease free water
(for example, 2180ul nuclease free water are added into 20 μ l reaction solutions).
(3) all reaction reagents are mixed：
A. after PCR plate is simply centrifuged, sealer is removed.
B. by 110 times of cDNA templates diluted and 2 × SYBR Green master mix according to 1：1 volume mixture.
C. it is inverted and mixes reaction solution and centrifuge
D. each hole mixed reaction solution added in plate
E. PCR plate is sealed again
(4) PCR plate simple, low temperature is centrifuged
(5) Real-time PCR are expanded：Reaction condition in following table carries out Real-time PCR amplifications and dissolving
Tracing analysis.
Real-time PCR cycles condition such as following table：
Data analysis：Using Δ Δ Ct methods
Carry out primary data analysis using the subsidiary software of PCR instrument device, obtain original Cq values (Cp or Ct, according to instrument not
May be different with title).
It is proposed that use GenEx qPCR analysis softwares (www.exiqon.com/mirna-pcr-analysis) logarithm
According to the standard of progress and deep data analysis.
A. the Δ Ct of each passageway related genes in each treatment group is calculated.
Δ Ct (group 1)=average Ct-average of HK genes ' Ct for group 1array
Δ Ct (group 2)=average Ct-average of HK genes ' Ct for group 2array
B. the Δ Δ Ct of each gene in 2 PCR Array (or two groups) is calculated.
Δ Δ Ct=Δs Ct (group 2)-Δ Ct (group 1)
Remarks：Generally group 1 is control, and group 2 is experimental group.
C. 2- Δ Δ Ct calculating group 2 and the differential expression for organizing 1 corresponding gene are passed through.
After chip primary dcreening operation, obtain such as 44 differential expression miRNA (3 plasma of colorectal cancer aggregate samples in following table
1.5 times of differences have been above relative to normal sample) in this.
Obtained for primary dcreening operation 44 differential expression miRNA (miRNA of 35 high expression, the miRNA of 6 low expressions with
And 3 previous literatures reported the miRNA of differential expression), by training set, test set and additional authentication collection, using based on
QRT-PCR absolute quantitation method is verified, is concretely comprised the following steps：
1. blood plasma RNA extracts：From ABI companies blood plasma RNA extracts kit (AM1556), illustrate with reference to kit, often
Individual sample draws 200ul and carries out extraction RNA, and is finally dissolved with 100ul DEPC water.
2.cDNA preparation：
1) reverse transcription experiment is carried out using 50 μ L reaction systems
Above reaction system mixes, and after brief centrifugation, is reacted with following procedure：
2) following reactant is added in the backward reaction system of above-mentioned reaction
3.qPCR
1) 5 μ L reaction systems are used, are tested in the following proportions
Reaction system mixes, and after brief centrifugation, is positioned in real-time PCR, is reacted with following procedure：
Reaction adds solubility curve after terminating.
Data analysis：By the Ct values for the standard items for comparing various concentrations, acquisition can be calculated often after converging into standard curve
The absolute concentration of miRNA in individual sample.Statistical analysis is carried out using the softwares of SPSS 16.0, has obtained one group in training set, survey
Examination collection concentrates 7 miRNA of consistent high expression in plasma of colorectal cancer with additional authentication：miR-103a-3p、miR-127-
3p, miR-151a-5p, miR-17-5p, miR-181a-5p, miR-18a-5p and miR-18b-5p (training set, test set and
Checking concentrates P values to be both less than 0.05, Fig. 2).By this 7 miRNA, the ROC curve of each sample can be calculated.Such as Fig. 3, this 7
The molecular marker of individual miRNA compositions can be good at distinguishing colorectal cancer patients and normal population.
The expression of this 7 miRNA excretion bodies in Colorectal Carcinoma and blood plasma is further have detected after seminar,
Colorectal Carcinoma extraction RNA utilizes AM1975 kits (ABI companies), and excretion body extracts kit is ExoQuick kits
(SBI companies).After the excretion body 200ul DEPC water that 200ul blood plasma is extracted is resuspended, AM1556 kits (ABI is utilized
Company) excretion body RNA to be extracted, step is the same as blood plasma RNA extraction process.
Found with non-parametric test analysis, the expression of miR-17-5p and miR-151a-5p in Colorectal Carcinoma will
Higher than cancer beside organism (Fig. 4).MiR-181a-5p, miR-17-5p, miR-18a-5p and miR-18b-5p are in plasma of colorectal cancer
Expression in excretion body is also apparently higher than normal population (Fig. 5).
Kit includes a collection of blood plasma miRNA qRT-PCR primers, can also there is the conventional examination needed for corresponding round pcr
Agent, such as：Reverse transcriptase, buffer solution, dNTPs, MgCl2, DEPC water, fluorescence probe, RNase inhibitor, Taq enzyme etc., can basis
The experimental method specifically used is selected, and these common agents are all well known to those skilled in the art, it can in addition contain there is standard
Product and control (normal person's sample of such as quantitative markization).The value of this kit is only to need blood plasma without other groups
Tissue samples, by the expression contents of miRNA in the Fluorometric assay plasma sample most simplified, carry out the auxiliary diagnosis samples sources and suffer from
The possibility for suffering from colorectal cancer of person.Blood plasma miRNA is easy to detect, and quantitative accurate, greatly improves the sensitivity of medical diagnosis on disease
Property and specificity, therefore this kit is put into and put into practice, can help to instruct diagnosis and further individualized treatment.
Claims (10)
1. a kind of blood plasma miRNA mark related to colorectal cancer auxiliary diagnosis, it is characterised in that the mark is miR-
In 103a-3p, miR-127-3p, miR-151a-5p, miR-17-5p, miR-181a-5p, miR-18a-5p and miR-18b-5p
One or more.
2. blood plasma miRNA mark according to claim 1, it is characterised in that the blood plasma miRNA mark is miR-
In 103a-3p, miR-127-3p, miR-151a-5p, miR-17-5p, miR-181a-5p, miR-18a-5p and miR-18b-5p
Two or more combination.
3. blood plasma miRNA mark according to claim 2, it is characterised in that the blood plasma miRNA mark is miR-
103a-3p, miR-127-3p, miR-151a-5p, miR-17-5p, miR-181a-5p, miR-18a-5p and miR-18b-5p seven
Kind miRNA combination.
4. application of the blood plasma miRNA mark described in claim 1,2 or 3 in auxiliary diagnosis colorectal cancer.
5. the answering in colorectal cancer auxiliary diagnostic box is prepared of the blood plasma miRNA mark described in claim 1,2 or 3
With.
6. the blood plasma miRNA mark described in claim 1,2 or 3 is preparing the application in treating colorectal cancer medicine.
7. a kind of primer of the blood plasma miRNA mark related to colorectal cancer auxiliary diagnosis, it is characterised in that the primer includes
MiR-103a-3p, miR-127-3p, miR-151a-5p, miR-17-5p, miR-181a-5p, miR-18a-5p and miR-18b-
The primer of one or more miRNA in 5p；Preferably comprising blood plasma miR-103a-3p, miR-127-3p, miR-151a-5p,
Two or more miRNA primer in miR-17-5p, miR-181a-5p, miR-18a-5p and miR-18b-5p；Enter one
Step is preferably to include miR-103a-3p, miR-127-3p, miR-151a-5p, miR-17-5p, miR-181a- in blood plasma miRNA
Seven kinds of miRNA of 5p, miR-18a-5p and miR-18b-5p primer.
8. primer the answering in auxiliary diagnosis colorectal cancer or preparation colorectal cancer auxiliary diagnostic box described in claim 7
With.
9. a kind of colorectal cancer auxiliary diagnostic box, it is characterised in that contain miR-103a- in blood plasma miRNA in the kit
One in 3p, miR-127-3p, miR-151a-5p, miR-17-5p, miR-181a-5p, miR-18a-5p and miR-18b-5p
The primer of kind or a variety of miRNA；Preferably contain blood plasma miR-103a-3p, miR-127-3p, miR-151a-5p, miR-17-
Two or more miRNA primer in 5p, miR-181a-5p, miR-18a-5p and miR-18b-5p；More preferably
Contain miR-103a-3p, miR-127-3p, miR-151a-5p, miR-17-5p, miR-181a-5p, miR- in blood plasma miRNA
Seven kinds of miRNA of 18a-5p and miR-18b-5p primer.
10. diagnostic kit according to claim 9, it is characterised in that also include what round pcr was commonly used in the kit
Reagent.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710810621.XA CN107746886B (en) | 2017-09-11 | 2017-09-11 | One kind blood plasma miRNA marker relevant to colorectal cancer auxiliary diagnosis and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710810621.XA CN107746886B (en) | 2017-09-11 | 2017-09-11 | One kind blood plasma miRNA marker relevant to colorectal cancer auxiliary diagnosis and its application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107746886A true CN107746886A (en) | 2018-03-02 |
| CN107746886B CN107746886B (en) | 2019-10-01 |
Family
ID=61255598
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710810621.XA Active CN107746886B (en) | 2017-09-11 | 2017-09-11 | One kind blood plasma miRNA marker relevant to colorectal cancer auxiliary diagnosis and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107746886B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109385423A (en) * | 2018-10-02 | 2019-02-26 | 华中农业大学 | Regulate and control the small molecule of mycobacterium tuberculosis inducing macrophage inflammatory response |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101389770A (en) * | 2006-01-05 | 2009-03-18 | 俄亥俄州立大学研究基金会 | Microrna-based methods and compositions for the diagnosis, prognosis and treatment of solid cancers |
| WO2012048236A1 (en) * | 2010-10-08 | 2012-04-12 | Baylor Research Institute | Micrornas (mirna) as biomakers for the identification of familial and non-familial colorectal cancer |
| CN104145024A (en) * | 2011-10-21 | 2014-11-12 | 巴塞罗那临床医院 | Plasma microRNAs for the detection of early colorectal cancer |
| CN105018594A (en) * | 2015-04-27 | 2015-11-04 | 广州医科大学附属第三医院 | Early-diagnosis marker for colorectal cancer and related kit |
| CN106367477A (en) * | 2016-08-25 | 2017-02-01 | 朱伟 | Serum miRNA marker related to auxiliary diagnosis of colorectal cancer, and application thereof |
-
2017
- 2017-09-11 CN CN201710810621.XA patent/CN107746886B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101389770A (en) * | 2006-01-05 | 2009-03-18 | 俄亥俄州立大学研究基金会 | Microrna-based methods and compositions for the diagnosis, prognosis and treatment of solid cancers |
| WO2012048236A1 (en) * | 2010-10-08 | 2012-04-12 | Baylor Research Institute | Micrornas (mirna) as biomakers for the identification of familial and non-familial colorectal cancer |
| CN104145024A (en) * | 2011-10-21 | 2014-11-12 | 巴塞罗那临床医院 | Plasma microRNAs for the detection of early colorectal cancer |
| CN105018594A (en) * | 2015-04-27 | 2015-11-04 | 广州医科大学附属第三医院 | Early-diagnosis marker for colorectal cancer and related kit |
| CN106367477A (en) * | 2016-08-25 | 2017-02-01 | 朱伟 | Serum miRNA marker related to auxiliary diagnosis of colorectal cancer, and application thereof |
Non-Patent Citations (1)
| Title |
|---|
| 胡秀秀等: ""microRNA在结直肠癌诊断、治疗及预后中的研究进展"", 《临床检验杂志》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109385423A (en) * | 2018-10-02 | 2019-02-26 | 华中农业大学 | Regulate and control the small molecule of mycobacterium tuberculosis inducing macrophage inflammatory response |
| CN109385423B (en) * | 2018-10-02 | 2021-09-21 | 华中农业大学 | Small molecule for regulating and controlling mycobacterium tuberculosis induced macrophage inflammatory response |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107746886B (en) | 2019-10-01 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108103198B (en) | One kind blood plasma miRNA marker relevant to cancer of pancreas auxiliary diagnosis and its application | |
| CN108624695B (en) | One kind circulation miRNA marker relevant to thyroid papillary carcinoma auxiliary diagnosis and its application | |
| CN105950753B (en) | One kind blood plasma miRNA marker relevant to adenocarcinoma of lung auxiliary diagnosis and its application | |
| CN105603101B (en) | Detect application of the system of 8 miRNA expression quantity in diagnosis or auxiliary diagnosis of hepatoma product is prepared | |
| CN106119393B (en) | Plasma miRNA marker related to esophageal squamous carcinoma auxiliary diagnosis and application thereof | |
| CN109609633B (en) | Serum miRNA marker related to breast cancer auxiliary diagnosis and application thereof | |
| CN106119392B (en) | Serum miRNA marker related to esophageal squamous carcinoma auxiliary diagnosis and application thereof | |
| CN109055557B (en) | Serum miRNA marker related to pancreatic cancer auxiliary diagnosis and application thereof | |
| CN108531586A (en) | A kind of relevant cycle miRNA marker and its application on X chromosome of and Computer-aided Diagnosis of Breast Cancer | |
| CN109609634B (en) | Circulating miRNA marker related to endometrial cancer auxiliary diagnosis and application thereof | |
| CN108103199A (en) | A kind of Xun Huan miRNA marker relevant with oophoroma auxiliary diagnosis and its application | |
| CN106119347B (en) | The primer and kit of colorectal cancer transfer detection based on serum exosomal microRNAs | |
| CN109593852B (en) | Serum miRNA marker related to nasopharyngeal carcinoma auxiliary diagnosis and application thereof | |
| CN109593851B (en) | Plasma miRNA marker related to breast cancer auxiliary diagnosis and application thereof | |
| CN108929910B (en) | Serum miRNA marker related to lung adenocarcinoma auxiliary diagnosis and application thereof | |
| CN107746886B (en) | One kind blood plasma miRNA marker relevant to colorectal cancer auxiliary diagnosis and its application | |
| CN106367477A (en) | Serum miRNA marker related to auxiliary diagnosis of colorectal cancer, and application thereof | |
| CN106086178A (en) | A kind of serum miRNA marker relevant to gastric cancer auxiliary diagnosis and application thereof | |
| CN107723365B (en) | One kind blood plasma miRNA marker relevant to lung squamous cancer auxiliary diagnosis and its application | |
| CN106350582A (en) | Serum miRNA marker related to auxiliary diagnosis for squamous lung cell carcinoma and application thereof | |
| CN106086226A (en) | A kind of blood plasma miRNA mark relevant to IgA nephropathy auxiliary diagnosis and application thereof | |
| WO2021159562A1 (en) | Circulating mirna and carcino-embryonic mirna marker related to pan-tumor auxiliary diagnosis, and use thereof | |
| CN109536612B (en) | Plasma miRNA marker related to nasopharyngeal carcinoma auxiliary diagnosis and application thereof | |
| CN109022586A (en) | One kind blood plasma miRNA marker relevant to cervical carcinoma auxiliary diagnosis and its application | |
| CN107723366B (en) | One kind serum miRNA marker relevant to cardia cancer auxiliary diagnosis and its application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |