CN107723366B - One kind serum miRNA marker relevant to cardia cancer auxiliary diagnosis and its application - Google Patents
One kind serum miRNA marker relevant to cardia cancer auxiliary diagnosis and its application Download PDFInfo
- Publication number
- CN107723366B CN107723366B CN201710810622.4A CN201710810622A CN107723366B CN 107723366 B CN107723366 B CN 107723366B CN 201710810622 A CN201710810622 A CN 201710810622A CN 107723366 B CN107723366 B CN 107723366B
- Authority
- CN
- China
- Prior art keywords
- mir
- mirna
- serum
- cardia cancer
- cancer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
Abstract
The present invention discloses one kind serum miRNA marker relevant to cardia cancer auxiliary diagnosis and its application, which is one of miR-200a-3p, miR-296-5p, miR-132-3p, miR-485-3p and miR-22-5p or a variety of.Serum miRNA as novel biomarker, have the characteristics that stability it is good, it is minimally invasive it is easy obtain, sensitivity and specificity it is high.The development and utilization of this kind of molecular marker will provide new direction for the diagnosis of the various diseases including tumour and further treatment.This research is by the more targeted cardia cancer-serum miRNA marker obtained with clinical diagnosis potential.Research confirms reliability and repeatability of this group of miRNA as the noninvasive marker of diagnosis cardia cancer.
Description
Technical field
The invention belongs to genetic engineering and oncologies, are related to a kind of serum relevant to cardia cancer auxiliary diagnosis
MiRNA marker and its application.
Background technique
Gastric cancer (Gastric cancer, GC) is one of global incidence and the higher malignant tumour of the death rate.Gastric cancer master
To be located at two positions: cardia (proximal end, stomach oesophagus intersection) and non-cardia (stomach bottom, body of stomach, distal end).Classified according to AEG, stomach
Cardia carcinogenesis is under esophagogastric junction within the scope of about 2cm.Gastric cardiac gland cancer (Gastric cardia
Adenocarcinoma, GCA) be stomach cardia cancer major histological type.It has apparent epidemiology, histopathology
Type and biological characteristics have significant difference with non-cardia gastric cancer and the cancer of the esophagus.In China, the disease incidence of GCA is about 50/10
Ten thousand, part up to 190/10000.Since patients with cardiac cancer early clinical manifestation is without obvious specificity, early diagnosed in China
Rate is lower, and most of medical patients with cardiac cancer already belongs to advanced stage.Currently, mucous membrane biopsy is the goldstandard for diagnosing GCA under scope.
Due to its expensive price and invasion, it is difficult to popularize in China.And since scope detection depends on examiner's experience, and have
Certain wound risk, also resulting in can not promote.The most commonly used tumor markers of clinical application at present, such as carcinomebryonic antigen
(CEA) and Carbohydrate Antigen 19-9 (CA19-9), also lack certain sensitivity and specificity.With genomics, protein science
And the development of the biotechnologys such as metabolism group, more and more biomarkers have been found or study.Thus, it is found that new
The marker that cardia cancer can be early diagnosed is within sight, to promote cardia cancer early intervention and treatment, extends the life of patient
Deposit the phase.
Microrna (miRNAs) is small non-coding RNA molecule of a kind of length in 22 or so nucleotide, by turning
Regulate and control the various vital movement processes of wide participation, generation, invasion and transfer including tumour etc. after record.The study found that miRNA
Expression there is different degrees of upper reconciliation to lower in tumour, for its can the tumor markers emerging as one kind establish base
Plinth.2008, Mitchell detected free miRNA in peripheral blood, it is found that it can be stable in the presence of in peripheral blood, and
And it can be used as the noninvasive marker of diagnosing tumour.There is now research confirms circulation miRNA in gastric cancer, lung cancer, breast cancer, knot
Potential diagnostic value in the tumours such as the carcinoma of the rectum.But due to research method and it is included in the difference of crowd, causes result of study endless
It is complete consistent.Therefore, this research and utilization Exiqon miRNA qPCR panel chip and the absolute quantitation method based on qRT-PCR,
Pass through the research of the cardia cancer-serum to large sample, it is intended to find the serum miRNA that there is potential diagnostic value to cardia cancer.And
Expression to these miRNA in cardiac carcinoma tissue and in Peripheral Blood excretion body is verified, further to define its with
The relationship of cardia cancer.If being directed to the diagnostic kit of cardia cancer according to this kind of miRNA design, it will push China's cardia cancer
Treatment level also provides thinking to the further research of cardia cancer for future.
Summary of the invention
The purpose of the present invention is to provide a kind of serum miRNA markers relevant to cardia cancer auxiliary diagnosis.
Another object of the present invention is to provide above-mentioned serum miRNA markers and its primer to examine in preparation cardia cancer auxiliary
Disconnected kit and the application in the drug of preparation treatment cardia cancer.
Another object of the present invention is to provide kit and drug for cardia cancer auxiliary diagnosis and treatment.
The purpose of the present invention can be achieved through the following technical solutions:
A kind of serum miRNA marker relevant to cardia cancer auxiliary diagnosis, the marker are miR-200a-3p
(UAACACUGUCUGGUAACGAUGU),miR-296-5p(AGGGCCCCCCCUCAAUCCUGU),miR-132-3p
(UAACAGUCUACAGCCAUGGUCG), miR-485-3p (GUCAUACACGGCUCUCCUCUCU) and miR-22-5p
One of (AGUUCUUCAGUGGCAAGCUUUA) or it is a variety of.The serum miRNA marker be preferably miR-200a-3p,
The combination of two or more in miR-296-5p, miR-132-3p, miR-485-3p and miR-22-5p, further preferably
For group composed by five kinds of miRNA of miR-200a-3p, miR-296-5p, miR-132-3p, miR-485-3p and miR-22-5p
It closes.
Application of the above-mentioned serum miRNA marker in auxiliary diagnosis cardia cancer.
Application of the above-mentioned serum miRNA marker in preparation cardia cancer auxiliary diagnostic box.
Application of the above-mentioned serum miRNA marker in preparation treatment cardia cancer drug.
A kind of primer of serum miRNA marker relevant to cardia cancer auxiliary diagnosis, the primer include miR-200a-
The primer of one of 3p, miR-296-5p, miR-132-3p, miR-485-3p and miR-22-5p or a variety of miRNA；It is preferred that
To include in miR-200a-3p, miR-296-5p, miR-132-3p, miR-485-3p and miR-22-5p in serum miRNA two
The primer of kind or two or more miRNA；Further preferably comprising miR-200a-3p, miR-296-5p in serum miRNA,
The primer of five kinds of miRNA of miR-132-3p, miR-485-3p and miR-22-5p.
Application of the above-mentioned primer in auxiliary diagnosis cardia cancer or preparation cardia cancer auxiliary diagnostic box.
A kind of cardia cancer auxiliary diagnostic box contains miR-200a-3p, miR- in serum miRNA in the kit
The primer of one of 296-5p, miR-132-3p, miR-485-3p and miR-22-5p or a variety of miRNA；Preferably contain blood
In clear miRNA two kinds or two kinds in miR-200a-3p, miR-296-5p, miR-132-3p, miR-485-3p and miR-22-5p
The primer of the above miRNA；Further preferably containing miR-200a-3p, miR-296-5p in serum miRNA, miR-132-3p,
The primer of five kinds of miRNA of miR-485-3p and miR-22-5p.
It further include the common reagent of round pcr in the kit.Such as reverse transcriptase, buffer, dNTPs, MgCl2, DEPC
Water and Taq enzyme etc.；Standard items and/or reference substance can also be contained.
Serum miRNA marker miR-200a-3p, miR-296- relevant to cardia cancer diagnosis according to the present invention
The sequence of every kind of miRNA in 5p, miR-132-3p, miR-485-3p and miR-22-5p discloses, but by each miRNA
Marker is combined needs those skilled in the art to make the creative labor as cardia cancer auxiliary diagnosis marker.Respectively
The amplimer of miRNA marker can be bought by market and be obtained, serum miRNA marker used in the embodiment of the present invention
Primer be specific miRNA stem ring RT-PCR primer purchased from production synthesized by the Rui Bo company of Guangzhou.
Specifically, the technical solution that the present invention solves the problems, such as includes: the sample storehouse and data that (1) establishes unified standard
Library: standard compliant blood sample is acquired with S.O.P. (SOP), system collects complete demographic data and clinical money
Material.(2) serum miRNA differential expression spectrum analysis: analyzing the serum miRNA of differential expression in cardia cancer and normal control population,
And further large sample multistage verifying is carried out to differential expression miRNAs.(3) by multistage verifying, these are specified
The ability of miRNA diagnosis cardia cancer.(4) development of serum miRNA diagnostic kit: according to patients with cardiac cancer and normal population blood
Differential expression miRNA in clear develops miRNAs diagnostic kit, realizes the noninvasive auxiliary diagnosis to patients with cardiac cancer.(5) divide
Expression of these miRNA in cardiac carcinoma tissue and excretion body is analysed, the relationship of these miRNA and cardia cancer is disclosed, is
The drug offer foundation that relevant to these miRNA may treat cardia cancer is provided in the future.
The present inventor acquires standard compliant blood sample with S.O.P. (SOP), and system collects complete population
Data, clinical data, and use Exiqon miRNA qPCR panel chip and qRT-PCR method etc..
The experimental method specifically studied mainly includes following components:
1. research samples selection: just controlling, row is performed the operation and chemicotherapy intervention and the patient for being confirmed as cardia cancer through pathology.
Normal control is the normal population to check UP in hospital.
2.Exiqon miRNA qPCR panel chip primary dcreening operation: serum mixing sample is carried out using TRIZOL-LS reagent
RNA is extracted, and is carried out qRT-PCR operation and obtained primary dcreening operation result.
3. training set, test set: carrying out RNA extraction to each serum sample using AM1556 kit (ABI company), lead to
It crosses reverse transcription reaction and obtains cDNA sample, PCR primer is added and SYBR Green fluorescent dye carries out PCR reaction.Pass through comparison
The Ct value of standard items obtains the miRNA content in sample.
4. extracting the RNA in cardia cancer and cancer beside organism using TRIZOL-LS reagent, (SBI is public for ExoQuick kit
Department) and AM1556 kit (ABI company) extract the RNA in excretion body, by the method for qRT-PCR, detection miRNA is being organized
And the differential expression in excretion body.
5. statistical analysis: using χ2It examines, paired t-test and non-parametric rank sum test compare miRNA expression and exist
Difference in different study groups.The diagnostic value of serum miRNA is confirmed by calculating ROC curve analysis.
Study group of the present invention carries out the expression point of system by the miRNA in the Peripheral Blood to cardia cancer patient at present
Analysis, it has now been found that one group 5 with clinical diagnosis potential cardia cancer-serum microRNA marker (miR-200a-3p,
MiR-296-5p, miR-132-3p, miR-485-3p and miR-22-5p).
Beneficial effects of the present invention:
1. compared to traditional tumor markers, serum miRNA as novel biomarker, have stability it is good,
Minimally invasive easy acquisition, sensitivity and specific high feature.The development and utilization of this kind of molecular marker will be for including tumour
The diagnosis of various diseases and further treatment provide new direction.
2. researcher is by Exiqon miRNA qPCR panel chip and the absolute quantitation method based on qRT-PCR, right
Differential expression miRNA in cardia cancer and normal control population's serum carries out tight, multistage verifying and evaluation.Confirm this
Reliability and repeatability of the group miRNA as the noninvasive marker of diagnosis cardia cancer.
Detailed description of the invention
Fig. 1: experiment flow figure
Fig. 2: 5 miRNA of high expression in cardia cancer-serum
Fig. 3: ROC curve analysis is carried out to miRNA obtained.
A: the intersection of training set and test set；B: training set；C: test set.
Expression of Fig. 4: 5 miRNA in cardiac carcinoma tissue
Expression of Fig. 5: 5 miRNA in patients with cardiac cancer serum excretion body
Specific embodiment
Inventor had collected a large amount of cardia cancer from No.1 Attached Hospital, Nanjing Medical Univ in 2014 to 2015 and suffers from
The Venous serum sample of person and normal Check-up crowd have therefrom selected 102 cardia cancers and 84 by the arrangement to sample data
The sample of example normal control is verified as Exiqon miRNA qPCR panel chip primary dcreening operation and a series of subsequent qRT-PCR
Laboratory sample.24 cardiac carcinoma tissues and 24 cancer beside organisms have also been left and taken simultaneously.Selected patients serum's sample standard deviation comes from
Yu Chuzhi, not row operation and chemicotherapy intervention and the patient that cardia cancer is confirmed as through pathology.And system acquisition these samples
Demographic data, clinical data.
Referring to flow chart (Fig. 1), 30 cardia cancer samples have been randomly choosed from cardia cancer and normal control serum sample
Sheet and 10 normal controls, and it has been mixed into 3 cardia cancer-serum mixing samples and 1 normal mixing sample (one respectively
A mixing sample is converged the sample for forming 2ml by 10 200ul serum samples).Exiqon is carried out to this 4 mixing samples
MiRNA qPCR panel chip primary dcreening operation and analysis, explanation of the specific steps referring to Exiqon miRNA qPCR panel chip
Book:
1. serum extracts
Blood serum sample is taken out, 3000x g is centrifuged 5min and removes some fragments and some insoluble components after sample thaws.Transfer
Supernatant after 750ul TRIZOL-LS is added, acutely shakes 5s into new 1.5ml pipe.
2. two-phase laminated flow
Sample is incubated for 5 minutes in 15 to 30 DEG C after homogenate.It is added in the sample of the TRIZOL-LS reagent homogenate of every 1ml
The chloroform of 0.2ml covers tightly pipe lid.Manually acutely after oscillation tube body 15 seconds, 15 to 30 DEG C are incubated for 2 to 3 minutes.13,000g at 4 DEG C
Centrifugation 15 minutes.
3.RNA precipitating
Water phase is transferred in new centrifuge tube.Water phase is mixed with isopropanol to precipitate RNA therein, and the amount of isopropanol is added
Are as follows: add the isopropanol of 0.5ml and the glycogen of 5ul in the sample of 1ml TRIZOL-LS reagent homogenate.It 4 DEG C of standing half an hour, allows
RNA is precipitated as far as possible.It is centrifuged 15 minutes in 4 DEG C of 13,000g.
4.RNA cleaning
Supernatant is removed, at least the 75% of 1ml (v/v) ethyl alcohol is added in the sample of every 1ml TRIZOL-LS reagent homogenate,
Clean RNA precipitate.10 minutes are stood, then 10000g is centrifuged 5 minutes at 4 DEG C.
5. re-dissolving RNA precipitate
Ethanol solution is removed, air drying RNA precipitate 5-10 minutes, water of the addition without RNA enzyme was blown and beaten several repeatedly with rifle
It is secondary, then it is incubated for 10 minutes for 55 to 60 DEG C.
6. measuring concentration:
Usually lead to~5 μ g RNA/50ml serum.
7.cDNA synthesis
(1) it dilutes template ribonucleic acid: 20-25ng template ribonucleic acid being diluted to 14ul (final concentration of 1.492- using DEPC water
1.786ng/μl)。
(2) prepare reaction solution: 5 × Reaction Buffer and DEPC water being placed in and is dissolved on ice, and shakes mixing.
Enzyme mix is placed in -20 DEG C of ice chests, flicks mixing before use and is placed on ice.All reagents use after being centrifuged.
(3) reaction solution is configured: the reaction solution in configuration following table
(4) it mixes and is centrifuged reagent: being centrifuged after concussion or suction mixing reaction solution, to guarantee that all solution are thoroughly mixed
Uniformly.
(5) reverse transcription reaction and heat inactivation: reaction solution is incubated after sixty minutes in 42 DEG C, incubates 5 minutes in 95 DEG C to lose
Reverse transcriptase living.
8.Real-Time PCR
Reagent:
Nuclease free water(Exiqon)
SYBRTMGreen master mix(Exiqon)
CDNA template
ROX(Invitrogen)
miRNA PCR ARRAY(Exiqon)
Instrument:
ABI PRISM7900system(Applied Biosystems)
(1) prepare Real-time PCR reagent: by the cDNA template of preparation, DEPC water and SYBRTMGreen master
Mix is placed in be dissolved 15-20 minutes on ice.
(2) it dilutes cDNA template: the cDNA template nuclease free water that RT reaction obtains is diluted 110 times
(for example, 2180ul nuclease free water is added into 20 μ l reaction solutions).
(3) all reaction reagents are mixed:
A. after PCR plate being simply centrifuged, sealer is removed.
B. 110 times of diluted cDNA templates are mixed with 2 × SYBR Green master mix according to 1:1 volume ratio.
C. it is inverted and mixes reaction solution and be centrifuged
D., mixed reaction solution is added to each hole in plate
E. PCR plate is sealed again
(4) PCR plate simple, low temperature is centrifuged
(5) Real-time PCR amplification and dissolution Real-time PCR amplification: are carried out according to the reaction condition in following table
Tracing analysis.
Real-time PCR cycle condition is as follows:
Data analysis: Δ Δ Ct method is used
Carry out primary data analysis using the subsidiary software of PCR instrument, obtain original Cq value (Cp or Ct, not according to instrument
It may be different with title).
It is proposed that analyzing software (www.exiqon.com/mirna-pcr-analysis) logarithm using GenEx qPCR
According to the standard of progress and deep data analysis.
A. the Δ Ct of each passageway related genes in each processing group is calculated.
Δ Ct (group 1)=average Ct-average of HK genes ' Ct for group 1array
Δ Ct (group 2)=average Ct-average of HK genes ' Ct for group 2array
B. the Δ Δ Ct of each gene in 2 PCR Array (or two groups) is calculated.
Δ Δ Ct=Δ Ct (group 2)-Δ Ct (group 1)
Remarks: usually group 1 is control, and group 2 is experimental group.
C. pass through 2- Δ Δ Ct calculating group 2 and the differential expression for organizing 1 corresponding gene.
After chip primary dcreening operation, obtain such as 35 differential expression miRNA (3 cardia cancer-serum mixing samples in following table
In relative to normal sample be above 1.5 times of differences).
For 35 differential expression miRNA that primary dcreening operation obtains, by training set and test set, using based on qRT-PCR's
Absolute quantitation method is verified, specific steps are as follows:
1. serum RNA is extracted: selecting ABI company serum RNA extracts kit (AM1556), illustrate referring to kit, often
A sample draws 200ul and extracts RNA, and is finally dissolved with 100ul DEPC water.
The preparation of 2.cDNA:
1) reverse transcription experiment is carried out using 50 μ L reaction systems
The above reaction system mixes, and after brief centrifugation, is reacted with following procedure:
2) following reactant is added in the backward reaction system of above-mentioned reaction
3.qPCR
1) 5 μ L reaction systems are used, are tested in the following proportions
Reaction system mixes, and after brief centrifugation, is placed in real-time PCR, is reacted with following procedure:
Solubility curve is added after reaction.
Data analysis: the Ct value by comparing the standard items of various concentration can calculate acquisition often after converging into standard curve
The absolute concentration of miRNA in a sample.It is for statistical analysis using 16.0 software of SPSS, obtained one group in training set and
Highly expressed 5 miRNA:miR-200a-3p, miR-296-5p, miR-132- in cardia cancer-serum are unanimously in test set
3p, miR-485-3p and miR-22-5p (P value is both less than 0.05, Fig. 2 in training set and test set).By this 5 miRNA,
The ROC curve of each sample can be calculated.Such as Fig. 3, the molecular marker of this 5 miRNA composition can be good at distinguishing cardia
Cancer patient and normal population.
The expression of this 5 miRNA excretion bodies in cardiac carcinoma tissue and serum is further had detected after study group, it is beautifully adorned
Door cancerous tissue extracts RNA and utilizes TRIZOL, and excretion body extracts kit is ExoQuick kit (SBI company).200ul serum
After the excretion body 200ul DEPC water extracted is resuspended, excretion body RNA is carried out using AM1556 kit (ABI company)
It extracts, step is the same as serum RNA extraction process.
Find that miR-200a-3p, miR-296-5p, miR-485-3p and miR-22-5p exist with non-parametric test analysis
Expression in cardiac carcinoma tissue is higher than cancer beside organism (Fig. 4).But expression of this 5 miRNA in cardia cancer-serum excretion body
It does not find to be apparently higher than normal population (Fig. 5).
Kit includes a collection of serum miRNA qRT-PCR primer, can also there is common examination needed for corresponding round pcr
Agent, such as: reverse transcriptase, buffer, dNTPs, MgCl2, DEPC water, fluorescence probe, RNase inhibitor, Taq enzyme etc. can basis
The experimental method that specifically uses is selected, these common agents be all it is well known to those skilled in the art, in addition it can there is standard
Product and control (normal person's sample of such as quantitative markization).The value of this kit is only to need serum without other groups
Tissue samples carry out auxiliary diagnosis samples sources trouble by the expression contents of miRNA in the Fluorometric assay serum sample most simplified
A possibility that suffering from cardia cancer of person.Serum miRNA is easy to detect, and quantitative accurate, greatly improves the sensibility of medical diagnosis on disease
And specificity, therefore this kit is put into and is practiced, it can help to instruct diagnosis and further individualized treatment.
Claims (3)
1. miR-200a-3p, miR-296-5p, miR-132-3p, miR-485-3p and miR-22-5p five in quantitative detection serum
Application of the reagent of kind miRNA expression in preparation cardia cancer auxiliary diagnostic box.
2. application according to claim 1, which is characterized in that include specific amplification miR- in the kit
The primer of five kinds of miRNA of 200a-3p, miR-296-5p, miR-132-3p, miR-485-3p and miR-22-5p.
3. application according to claim 2, which is characterized in that further include in the kit reverse transcriptase, buffer,
dNTPs、MgCl2, DEPC water, fluorescence probe, RNA enzyme inhibitor and Taq enzyme.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710810622.4A CN107723366B (en) | 2017-09-11 | 2017-09-11 | One kind serum miRNA marker relevant to cardia cancer auxiliary diagnosis and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710810622.4A CN107723366B (en) | 2017-09-11 | 2017-09-11 | One kind serum miRNA marker relevant to cardia cancer auxiliary diagnosis and its application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107723366A CN107723366A (en) | 2018-02-23 |
| CN107723366B true CN107723366B (en) | 2019-10-01 |
Family
ID=61205080
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710810622.4A Active CN107723366B (en) | 2017-09-11 | 2017-09-11 | One kind serum miRNA marker relevant to cardia cancer auxiliary diagnosis and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107723366B (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101182577A (en) * | 2007-11-19 | 2008-05-21 | 宁波大学 | Tiny RNA detecting probe used for stomach organization and detection method thereof |
| CN101622348A (en) * | 2006-12-08 | 2010-01-06 | 奥斯瑞根公司 | Gene and the approach regulated as the miR-20 of targets for therapeutic intervention |
| CN106086178A (en) * | 2016-06-16 | 2016-11-09 | 朱伟 | A kind of serum miRNA marker relevant to gastric cancer auxiliary diagnosis and application thereof |
| CN107109470A (en) * | 2014-08-07 | 2017-08-29 | 新加坡科技研究局 | MiRNA biomarker for diagnosis of gastric cancer |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20080076674A1 (en) * | 2006-07-06 | 2008-03-27 | Thomas Litman | Novel oligonucleotide compositions and probe sequences useful for detection and analysis of non coding RNAs associated with cancer |
-
2017
- 2017-09-11 CN CN201710810622.4A patent/CN107723366B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101622348A (en) * | 2006-12-08 | 2010-01-06 | 奥斯瑞根公司 | Gene and the approach regulated as the miR-20 of targets for therapeutic intervention |
| CN101182577A (en) * | 2007-11-19 | 2008-05-21 | 宁波大学 | Tiny RNA detecting probe used for stomach organization and detection method thereof |
| CN107109470A (en) * | 2014-08-07 | 2017-08-29 | 新加坡科技研究局 | MiRNA biomarker for diagnosis of gastric cancer |
| CN106086178A (en) * | 2016-06-16 | 2016-11-09 | 朱伟 | A kind of serum miRNA marker relevant to gastric cancer auxiliary diagnosis and application thereof |
Non-Patent Citations (1)
| Title |
|---|
| "DARPP32促胃癌血管生成机制及胃癌中miRNA差异表达谱发现研究";陈政;《中国博士学位论文全文数据库》;20170115;正文第62-69,71页，表1，图5 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107723366A (en) | 2018-02-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108624695B (en) | One kind circulation miRNA marker relevant to thyroid papillary carcinoma auxiliary diagnosis and its application | |
| CN108103198B (en) | One kind blood plasma miRNA marker relevant to cancer of pancreas auxiliary diagnosis and its application | |
| CN105950753B (en) | One kind blood plasma miRNA marker relevant to adenocarcinoma of lung auxiliary diagnosis and its application | |
| CN105603101B (en) | Detect application of the system of 8 miRNA expression quantity in diagnosis or auxiliary diagnosis of hepatoma product is prepared | |
| CN109609633A (en) | One kind serum miRNA marker relevant to Computer-aided Diagnosis of Breast Cancer and its application | |
| CN106119393B (en) | Plasma miRNA marker related to esophageal squamous carcinoma auxiliary diagnosis and application thereof | |
| CN109055557A (en) | One kind serum miRNA marker relevant to cancer of pancreas auxiliary diagnosis and its application | |
| CN106119392B (en) | Serum miRNA marker related to esophageal squamous carcinoma auxiliary diagnosis and application thereof | |
| CN110423819A (en) | A kind of participation Human colorectal carcinoma proliferation and drug resistant lncRNA and its application | |
| CN109609634A (en) | One kind circulation miRNA marker relevant to carcinoma of endometrium auxiliary diagnosis and its application | |
| CN106834470A (en) | Purposes of the miRNA in cancer diagnosing kit is prepared | |
| CN108531586A (en) | A kind of relevant cycle miRNA marker and its application on X chromosome of and Computer-aided Diagnosis of Breast Cancer | |
| CN109929932A (en) | Application in blood in two kinds of long-chain non-coding RNA Combining diagnosis esophageal squamous cell carcinomas | |
| CN109593851A (en) | One kind blood plasma miRNA marker relevant to Computer-aided Diagnosis of Breast Cancer and its application | |
| CN106119347B (en) | The primer and kit of colorectal cancer transfer detection based on serum exosomal microRNAs | |
| CN109593852A (en) | One kind serum miRNA marker relevant to nasopharyngeal carcinoma auxiliary diagnosis and its application | |
| CN108929910A (en) | One kind serum miRNA marker relevant to adenocarcinoma of lung auxiliary diagnosis and its application | |
| CN108103199A (en) | A kind of Xun Huan miRNA marker relevant with oophoroma auxiliary diagnosis and its application | |
| CN107723365B (en) | One kind blood plasma miRNA marker relevant to lung squamous cancer auxiliary diagnosis and its application | |
| CN107746886B (en) | One kind blood plasma miRNA marker relevant to colorectal cancer auxiliary diagnosis and its application | |
| CN106987633A (en) | A kind of primer and kit for detecting colorectal cancer serum secretion type lncRNAs | |
| CN107723366B (en) | One kind serum miRNA marker relevant to cardia cancer auxiliary diagnosis and its application | |
| CN109022586A (en) | One kind blood plasma miRNA marker relevant to cervical carcinoma auxiliary diagnosis and its application | |
| CN106086178A (en) | A kind of serum miRNA marker relevant to gastric cancer auxiliary diagnosis and application thereof | |
| CN106350582A (en) | Serum miRNA marker related to auxiliary diagnosis for squamous lung cell carcinoma and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |