CN109593852A - One kind serum miRNA marker relevant to nasopharyngeal carcinoma auxiliary diagnosis and its application - Google Patents
One kind serum miRNA marker relevant to nasopharyngeal carcinoma auxiliary diagnosis and its application Download PDFInfo
- Publication number
- CN109593852A CN109593852A CN201811580584.9A CN201811580584A CN109593852A CN 109593852 A CN109593852 A CN 109593852A CN 201811580584 A CN201811580584 A CN 201811580584A CN 109593852 A CN109593852 A CN 109593852A
- Authority
- CN
- China
- Prior art keywords
- mir
- mirna
- nasopharyngeal carcinoma
- serum
- marker
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/136—Screening for pharmacological compounds
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Pathology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Hospice & Palliative Care (AREA)
- Biophysics (AREA)
- Oncology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention discloses one kind serum miRNA marker relevant to nasopharyngeal carcinoma cancer auxiliary diagnosis and its application, which is let-7b-5p, miR-140-3p, miR-192-5p, one of miR-223-3p and miR-24-3p or a variety of.Serum miRNA is as novel biomarker, good, the minimally invasive easy acquisition with stability, sensitivity and specific high feature.The development and utilization of this kind of molecular marker will provide new direction for the diagnosis of the various diseases including tumour and further treatment.This research is by the more targeted serum in patients with nasopharyngeal miRNA marker obtained with clinical diagnosis potential.Research confirms reliability and repeatability of this group of miRNA as the noninvasive marker of diagnosis of nasopharyngeal carcinoma.
Description
Technical field
The invention belongs to genetic engineering and oncologies, are related to a kind of serum relevant to nasopharyngeal carcinoma cancer auxiliary diagnosis
MiRNA marker and its application.
Background technique
Nasopharyngeal carcinoma (Nasopharyngeal carcinoma, NPC) is the malignant tumour for betiding nasopharyngeal mucosal epithelium.Though
So compared to other kinds of malignant tumour, the global incidence of nasopharyngeal carcinoma is not high, but its disease incidence has apparent race
And areal variation.According to World Health Organization, there are 80% Nasopharyngeal Carcinoma Patients in the whole world in China, especially in SOUTHERN CHINA
Area.Currently, radiotherapy is the preferred treatment method of nasopharyngeal carcinoma, there is high cure rate to early stage patient, has been obviously improved whole
Body survival rate.But it is when many patient disease early stages and asymptomatic, and it has been in middle and advanced stage when medical, the treatment to radiation alone
It imitates poor, is unfavorable for the control of disease.The research for the molecule and Clinical symptoms of nasopharyngeal carcinoma deepens continuously at present, nasopharynx microscopy
It looks into, pathologic finding, imageological examination all become the important means of Clinical screening.Recent study discovery, ebv infection with
Generation, the development of nasopharyngeal carcinoma are closely related, and the detection of Epstein-Barr virus antibody or viral DNA can help early detection people at highest risk.
But these methods perhaps excessively rely on tester's experience and perhaps have invasive and unsuitable routine screening or price too
Height can not be promoted or detection sensitivity and specificity are there are also to be strengthened.Therefore, there is an urgent need to develop new reliable non-intrudings
Property early diagnosis marker, promote early intervention and treatment, extend the life cycle of patient.
Microrna (Micro ribonucleic acids, miRNAs) is the discovery that recently in these years great discovery
One.Mature miRNA is a kind of evolution conservative, small non-coding RNA molecule of the length in 18-25 nucleotide.It was found that
MiRNA can be in the gene of post-transcriptional level 1/3 or more body of regulation, to participate in numerous pathological processes of body.miRNA
Expression have temporal and tissue specificity.Meanwhile some miRNA can participate in specific physiological and pathological and spy
Different lysis.Therefore, certain special miRNA can be used as the diseases such as certain physiological and pathologicals and certain diseases such as tumour
The marker of disease.2008, Mitchell detected free miRNA in peripheral blood, it is found that it is outer it can be stable in the presence of
All blood, and can be as the noninvasive marker of diagnosing tumour.This research discovery has pulled open global numerous researchers and has started to visit
Curtain of the Suo Xunhuan miRNA as noninvasive marker.Existing research confirms that circulation miRNA is including lung cancer, gastric cancer, mammary gland
Potential diagnostic value in cancer, colorectal cancer.The diagnostic value research for circulation miRNA in nasopharyngeal carcinoma is not filled at present
Point, and due to research method and it is included in the difference of crowd, each result of study is not fully consistent.Therefore, this research and utilization
Exiqon miRNA qPCR panel chip and relative quantification method based on qRT-PCR, pass through the nasopharyngeal carcinoma blood to large sample
Clear research, it is intended to find the serum miRNA that there is potential diagnostic value to nasopharyngeal carcinoma.And to these miRNA in nasopharyngeal carcinoma group
It knits and verifies and compare with the expression in different Clinical symptoms patients serums, further to define its pass with nasopharyngeal carcinoma
System and diagnostic value.If being directed to the diagnostic kit of nasopharyngeal carcinoma according to this kind of miRNA design, it will push China's nasopharyngeal carcinoma
Treatment level also provides thinking to the further research of nasopharyngeal carcinoma for future.
Summary of the invention
The purpose of the present invention is to provide a kind of serum miRNA markers relevant to nasopharyngeal carcinoma auxiliary diagnosis.
Another object of the present invention is to provide above-mentioned serum miRNA markers and its primer to examine in preparation nasopharyngeal carcinoma auxiliary
Disconnected kit and the application in the drug of preparation treatment nasopharyngeal carcinoma.
Another object of the present invention is to provide kit and drug for nasopharyngeal carcinoma auxiliary diagnosis and treatment.
The purpose of the present invention can be achieved through the following technical solutions:
A kind of serum miRNA marker relevant to nasopharyngeal carcinoma auxiliary diagnosis, the marker are let-7b-5p
(ugagguaguagguugugugguu),miR-140-3p(uaccacaggguagaaccacgg),miR-192-5p
(cugaccuaugaauugacagcc), miR-223-3p (ugucaguuugucaaauacccca) and miR-24-3p
One of (uggcucaguucagcaggaacag) or it is a variety of.The serum miRNA marker is preferably let-7b-5p, miR-
Two kinds or two or more of combination, further preferably let- in 140-3p, miR-192-5p, miR-223-3p and miR-24-3p
Combination composed by five kinds of miRNA of 7b-5p, miR-140-3p, miR-192-5p, miR-223-3p and miR-24-3p.
Application of the above-mentioned serum miRNA marker in auxiliary diagnosis nasopharyngeal carcinoma.
Above-mentioned serum miRNA marker is in preparation nasopharyngeal carcinoma auxiliary diagnostic box or treats answering in medicine for nasopharyngeal
With.
A kind of primer of serum miRNA marker relevant to nasopharyngeal carcinoma auxiliary diagnosis, the primer include let-7b-5p,
The primer of one of miR-140-3p, miR-192-5p, miR-223-3p and miR-24-3p or a variety of miRNA；Preferably wrap
In miRNA containing serum two kinds or two in let-7b-5p, miR-140-3p, miR-192-5p, miR-223-3p and miR-24-3p
The primer of the above miRNA；It further preferably include let-7b-5p, miR-140-3p, miR-192-5p in serum miRNA,
The primer of five kinds of miRNA of miR-223-3p and miR-24-3p.
Application of the above-mentioned primer in auxiliary diagnosis nasopharyngeal carcinoma or preparation nasopharyngeal carcinoma auxiliary diagnostic box.
A kind of nasopharyngeal carcinoma auxiliary diagnostic box contains let-7b-5p, miR-140- in serum miRNA in the kit
The primer of one of 3p, miR-192-5p, miR-223-3p and miR-24-3p or a variety of miRNA；Preferably contain serum
Two or more in let-7b-5p in miRNA, miR-140-3p, miR-192-5p, miR-223-3p and miR-24-3p
The primer of miRNA；Further preferably containing let-7b-5p, miR-140-3p, miR-192-5p, miR- in serum miRNA
The primer of five kinds of miRNA of 223-3p and miR-24-3p.
It further include the common reagent of round pcr or/and the common reagent of immunohistochemistry technique in the kit.
The kit can also include that PCR reacts common agents, such as reverse transcriptase, buffer, dNTPs, MgCl2, DEPC
Water and Taq enzyme etc.；Standard items and/or reference substance can also be contained.
Serum miRNA marker let-7b-5p, miR-140-3p relevant to nasopharyngeal carcinoma diagnosis according to the present invention,
The sequence of every kind of miRNA in miR-192-5p, miR-223-3p and miR-24-3p discloses, but each miRNA is indicated
Object is combined needs those skilled in the art to make the creative labor as nasopharyngeal carcinoma auxiliary diagnosis marker.Each miRNA mark
The amplimer of will object can be bought by market and be obtained, the primer of serum miRNA marker used in the embodiment of the present invention
For the specific miRNA stem ring RT-PCR primer purchased from production synthesized by the Rui Bo company of Guangzhou.
Specifically, the technical solution that the present invention solves the problems, such as includes: the sample storehouse and data that (1) establishes unified standard
Library: standard compliant blood sample is acquired with S.O.P. (SOP), system collects complete demographic data and clinical money
Material.(2) serum miRNA differential expression spectrum analysis: analyzing the serum miRNA of differential expression in nasopharyngeal carcinoma and normal control population,
And further large sample multistage verifying is carried out to differential expression miRNAs.(3) by multistage verifying, these are specified
The ability of miRNA diagnosis of nasopharyngeal carcinoma.(4) development of serum miRNA diagnostic kit: according in nasopharyngeal carcinoma and normal population serum
Differential expression miRNA develop miRNAs diagnostic kit, realize to the noninvasive auxiliary diagnosis of Nasopharyngeal Carcinoma Patients.(4) this is analyzed
Expression of a little miRNA in tissues of nasopharyngeal carcinoma and different clinical pathologic characteristic patients serums, discloses these miRNA and nose
The relationship of pharynx cancer, for future develop may it is relevant to these miRNA treatment nasopharyngeal carcinoma drug foundation is provided.
The present inventor acquires standard compliant blood sample with S.O.P. (SOP), and system collects complete population
Data, clinical data, and use Exiqon miRNA qPCR panel chip and qRT-PCR method etc..
The experimental method specifically studied mainly includes following components:
1. research samples selection: just control, row perform the operation and chemicotherapy intervention and after through pathology be confirmed as nasopharyngeal carcinoma
Patient.Normal control is the normal population to check UP in hospital.
2.Exiqon miRNA qPCR panel chip primary dcreening operation: serum mixing sample is carried out using TRIZOL-LS reagent
RNA is extracted, and is carried out qRT-PCR operation and obtained primary dcreening operation result.
3. training set, verifying collection and additional authentication collection: using AM1556 kit (ABI company) to each serum sample
RNA extraction is carried out, cDNA sample is obtained by reverse transcription reaction, PCR primer is added and SYBR Green fluorescent dye carries out PCR
Reaction.By comparing the Ct value of standard items, the miRNA content in sample is obtained.
4. extracting the RNA in nasopharyngeal carcinoma and normal nasal mucosa using TRIZOL-LS reagent, pass through the side of qRT-PCR
Method, the differential expression of detection miRNA in the tissue.
5. statistical analysis: using χ2It examines, paired t-test and non-parametric rank sum test compare miRNA expression and exist
Difference in different study groups.The diagnostic value of serum miRNA is confirmed by calculation risk value and ROC curve analysis.
Study group of the present invention carries out the expression point of system by the miRNA in the Peripheral Blood to nasopharyngeal cancer patient at present
Analysis, it has now been found that one group 5 serum in patients with nasopharyngeal microRNA marker (let-7b-5p, miR- with clinical diagnosis potential
140-3p, miR-192-5p, miR-223-3p and miR-24-3p).
Beneficial effects of the present invention:
1. compared to traditional tumor markers, serum miRNA as novel biomarker, have stability it is good,
Minimally invasive easy acquisition, sensitivity and specific high feature.The development and utilization of this kind of molecular marker will be for including tumour
The diagnosis of various diseases and further treatment provide new direction.
2. researcher is by Exiqon miRNA qPCR panel chip and the relative quantification method based on qRT-PCR, right
Differential expression miRNA in nasopharyngeal carcinoma and normal control population's serum carries out tight, multistage verifying and evaluation.Confirm this
Reliability and repeatability of the group miRNA as the noninvasive marker of diagnosis of nasopharyngeal carcinoma.
3. researcher has found that miR-192-5p and miR-24-3p expresses one in the expression and serum in tissues of nasopharyngeal carcinoma
It causes, and the expression of let-7b-5p and miR-140-3p in tissues of nasopharyngeal carcinoma is opposite with expression in serum, it is shown that these
Close relation between miRNA and nasopharyngeal carcinoma.Meanwhile compared to normal person, in the patients with nasopharyngeal carcinoma of the Epstein-Barr virus positive
Let-7b-5p, miR-140-3p, miR-223-3p and miR-24-3p expression are significant to be increased, and the expression of miR-192-5p is significant
It reduces；Compared to normal person, the expression of this 5 kinds of miRNA is all significantly increased in the patients with nasopharyngeal carcinoma of Epstein-Barr virus feminine gender；This
Outside, in Epstein-Barr virus Nasopharyngeal Carcinoma Patients with Negative patients serum, let-7b-5p, miR-140-3p, the table of miR-192-5p and miR-24-3p
It is significantly raised up to compared to Epstein-Barr virus positive patient.These results by these miRNA of future studies for nasopharyngeal carcinoma mechanism with
And new thinking is provided for the treatment of nasopharyngeal carcinoma for these miRNA.
Detailed description of the invention
Fig. 1: experiment flow figure
Fig. 2: highly expressed 5 miRNA in serum in patients with nasopharyngeal
Fig. 3: ROC curve analysis is carried out to miRNA obtained
A: training set；B: verifying collection；C: external certificate collection；D: the intersection of training set, verifying collection and external certificate collection
Expression of Fig. 4: 5 miRNA in tissues of nasopharyngeal carcinoma
Expression of Fig. 5: 5 miRNA in Epstein-Barr virus positive or negative patients with nasopharyngeal carcinoma
Specific embodiment
Inventor collected in 2014 to 2016 from No.1 Attached Hospital, Nanjing Medical Univ and Jiangsu Prov. Tumour Hospital
The Venous serum sample of a large amount of Nasopharyngeal Carcinoma Patients and normal Check-up crowd is therefrom selected by the arrangement to sample data
The sample of 208 nasopharyngeal carcinoma and 238 normal controls is as Exiqon miRNAqPCR panel chip primary dcreening operation and subsequent one
The laboratory sample of serial qRT-PCR verifying.48 nasopharyngeal carcinoma tumor tissues and 32 normal nasal mucosas have also been left and taken simultaneously.
Selected patients serum's sample standard deviation from just control, row operation and chemicotherapy intervention and after through pathology be confirmed as nasopharynx
The patient of cancer.And the system acquisition demographic data of these samples, clinical data.
Referring to flow chart (Fig. 1), 20 nasopharyngeal carcinoma samples have been randomly choosed from nasopharyngeal carcinoma and normal control serum sample
Sheet and 10 normal controls, and it has been mixed into 2 serum in patients with nasopharyngeal mixing samples and 1 normal mixing sample (one respectively
A mixing sample is converged the sample for forming 2ml by 10 200ul serum samples).Exiqon is carried out to this 3 mixing samples
MiRNA qPCR panel chip primary dcreening operation and analysis, explanation of the specific steps referring to Exiqon miRNA qPCR panel chip
Book:
1. serum extracts
Blood serum sample is taken out, 3000x g is centrifuged 5min and removes some fragments and some insoluble components after sample thaws.Transfer
Supernatant after 750ul TRIZOL-LS is added, acutely shakes 5s into new 1.5ml pipe.
2. two-phase laminated flow
Sample is incubated for 5 minutes in 15 to 30 DEG C after homogenate.It is added in the sample of the TRIZOL-LS reagent homogenate of every 1ml
The chloroform of 0.2ml covers tightly pipe lid.Manually acutely after oscillation tube body 15 seconds, 15 to 30 DEG C are incubated for 2 to 3 minutes.13,000g at 4 DEG C
Centrifugation 15 minutes.
3.RNA precipitating
Water phase is transferred in new centrifuge tube.Water phase is mixed with isopropanol to precipitate RNA therein, and the amount of isopropanol is added
Are as follows: add the isopropanol of 0.5ml and the glycogen of 5ul while 1ml TRIZOL-LS reagent is added when each sample homogenization.4 DEG C quiet
Half an hour is set, RNA is allowed to be precipitated as far as possible.It is centrifuged 15 minutes in 4 DEG C of 13,000g.
4.RNA cleaning
Supernatant is removed, at least the 75% of 1ml (v/v) ethyl alcohol is added in the sample of every 1ml TRIZOL-LS reagent homogenate,
Clean RNA precipitate.10 minutes are stood, then 10000g is centrifuged 5 minutes at 4 DEG C.
5. re-dissolving RNA precipitate
Ethanol solution is removed, air drying RNA precipitate 5-10 minutes, water of the addition without RNA enzyme was blown and beaten several repeatedly with rifle
It is secondary, then it is incubated for 10 minutes for 55 to 60 DEG C.
6. measuring concentration:
Usually lead to~5 μ g RNA/50ml serum.
7.cDNA synthesis
(1) it dilutes template ribonucleic acid: 20-25ng template ribonucleic acid being diluted to 14ul (final concentration of 1.492- using DEPC water
1.786ng/μl)。
(2) prepare reaction solution: 5 × Reaction Buffer and DEPC water being placed in and is dissolved on ice, and shakes mixing.
Enzyme mix is placed in -20 DEG C of ice chests, flicks mixing before use and is placed on ice.All reagents use after being centrifuged.
(3) reaction solution is configured: the reaction solution in configuration following table
(4) it mixes and is centrifuged reagent: being centrifuged after concussion or suction mixing reaction solution, to guarantee that all solution are thoroughly mixed
Uniformly.
(5) reverse transcription reaction and heat inactivation: reaction solution is incubated after sixty minutes in 42 DEG C, incubates 5 minutes in 95 DEG C to lose
Reverse transcriptase living.
8.Real-Time PCR
Reagent:
Nuclease free water(Exiqon)
SYBRTMGreen master mix(Exiqon)
CDNA template
ROX(Invitrogen)
miRNA PCR ARRAY(Exiqon)
Instrument:
ABI PRISM7900system(Applied Biosystems)
(1) prepare Real-time PCR reagent: by the cDNA template of preparation, DEPC water and SYBRTM Green master
Mix is placed in be dissolved 15-20 minutes on ice.
(2) it dilutes cDNA template: the cDNA template nuclease free water that RT reaction obtains is diluted 110 times
(for example, 2180ul nuclease free water is added into 20 μ l reaction solutions).
(3) all reaction reagents are mixed:
A. after PCR plate being simply centrifuged, sealer is removed.
B. 110 times of diluted cDNA templates are mixed with 2 × SYBR Green master mix according to 1:1.
C. it is inverted and mixes reaction solution and be centrifuged
D., mixed reaction solution is added to each hole in plate
E. PCR plate is sealed again
(4) PCR plate simple, low temperature is centrifuged
(5) Real-time PCR amplification and dissolution Real-time PCR amplification: are carried out according to the reaction condition in following table
Tracing analysis.
Real-time PCR cycle condition is as follows:
Data analysis: Δ Δ Ct method is used
Carry out primary data analysis using the subsidiary software of PCR instrument, obtain original Cq value (Cp or Ct, not according to instrument
It may be different with title).
It is proposed that analyzing software (www.exiqon.com/mirna-pcr-analysis) logarithm using GenEx qPCR
According to the standard of progress and deep data analysis.
A. the Δ Ct of each passageway related genes in each processing group is calculated.
Δ Ct (group 1)=average Ct-average of HK genes ' Ct for group 1array
Δ Ct (group 2)=average Ct-average of HK genes ' Ct for group 2array
B. the Δ Δ Ct of each gene in 2 PCR Array (or two groups) is calculated.
Δ Δ Ct=Δ Ct (group 2)-Δ Ct (group 1)
Remarks: usually group 1 is control, and group 2 is experimental group.
C. with the differential expression crossed 2- Δ Δ Ct calculating group 2 with organize 1 corresponding gene.
After chip primary dcreening operation, obtain such as 30 differential expression miRNA (2 serum in patients with nasopharyngeal mixing samples in following table
It has been more than 1.5 times of differences relative to normal sample).
30 differential expression miRNA that primary dcreening operation obtains are used by training set, verifying collection and additional authentication collection
Relative quantification method based on qRT-PCR is verified, specific steps are as follows:
1. serum RNA is extracted: selecting ABI company serum RNA extracts kit (AM1556), illustrate referring to kit, often
A sample draws 200ul and extracts RNA, and is finally dissolved with 100ul DEPC water.
The preparation of 2.cDNA:
1) reverse transcription experiment is carried out using 50 μ L reaction systems
The above reaction system mixes, and after brief centrifugation, is reacted with following procedure:
2) following reactant is added in reaction system again after above-mentioned reaction
3.qPCR
1) 5 μ L reaction systems are used, are tested in the following proportions
2) reaction system mixes, and after brief centrifugation, is placed in real-time PCR, is reacted with following procedure:
Solubility curve is added after reaction.
Data analysis: it is for statistical analysis using 22.0 software of SPSS, one group has been obtained in training set, and verifying is concentrated all
Be unanimously in serum in patients with nasopharyngeal high expression 5 miRNA:let-7b-5p, miR-140-3p, miR-192-5p, miR-223-3p and
MiR-24-3p (in training set, verifying concentrates P value to be both less than 0.05, Fig. 2).By this 5 miRNA, each sample can be calculated
ROC curve, the molecular marker of such as Fig. 3, this 5 miRNA composition can be good at distinguishing Nasopharyngeal Carcinoma Patients and normal population.
Additional training set then further demonstrates the reliability (Fig. 3) of result.
This 5 miRNA are further had detected after study group in the expression of tissues of nasopharyngeal carcinoma, tissues of nasopharyngeal carcinoma extracts RNA
Utilize TRIZOL.
It is found with non-parametric test analysis, the expression and blood of miR-192-5p and miR-24-3p in tissues of nasopharyngeal carcinoma
Expression is consistent in clear, and the expression of let-7b-5p and miR-140-3p in tissues of nasopharyngeal carcinoma (figure opposite with expression in serum
4)。
Meanwhile compared to normal person, let-7b-5p, miR-140-3p in the patients with nasopharyngeal carcinoma of the Epstein-Barr virus positive,
MiR-223-3p and miR-24-3p expression is significant to be increased, and the expression of miR-192-5p significantly reduces；Compared to normal person, EB
The expression of this 5 kinds of miRNA is all significantly increased in viral negative patients with nasopharyngeal carcinoma；In addition, Epstein-Barr virus Nasopharyngeal Carcinoma Patients with Negative is suffered from
In person's serum, let-7b-5p, miR-140-3p, it is aobvious that miR-192-5p compares Epstein-Barr virus positive patient with the expression of miR-24-3p
Write up-regulation (Fig. 5).
Kit includes a collection of serum miRNA qRT-PCR primer, can also there is common examination needed for corresponding round pcr
Agent, such as: reverse transcriptase, buffer, dNTPs, MgCl2, DEPC water, fluorescence probe, RNase inhibitor, Taq enzyme etc. can basis
The experimental method that specifically uses is selected, these common agents be all it is well known to those skilled in the art, in addition it can there is standard
Product and control (normal person's sample of such as quantitative markization).The value of this kit is only to need serum without other groups
Tissue samples carry out auxiliary diagnosis samples sources trouble by the expression contents of miRNA in the Fluorometric assay serum sample most simplified
A possibility that suffering from nasopharyngeal carcinoma of person.Serum miRNA is not only stable, easy to detect, and quantitative accurate, greatly improves medical diagnosis on disease
Sensibility and specificity, therefore this kit is put into and is practiced, can help to instruct diagnosis and further individuation to control
It treats.
Claims (8)
1. a kind of serum miRNA marker relevant to nasopharyngeal carcinoma auxiliary diagnosis, it is characterised in that the marker is let-7b-
One of 5p, miR-140-3p, miR-192-5p, miR-223-3p and miR-24-3p or a variety of.
2. serum miRNA marker according to claim 1, it is characterised in that the serum miRNA marker is let-7b-
Two kinds or two or more of combination, preferably let- in 5p, miR-140-3p, miR-192-5p, miR-223-3p and miR-24-3p
Combination composed by five kinds of miRNA of 7b-5p, miR-140-3p, miR-192-5p, miR-223-3p and miR-24-3p.
3. application of the serum miRNA marker of any of claims 1 or 2 in auxiliary diagnosis nasopharyngeal carcinoma.
4. serum miRNA marker of any of claims 1 or 2 is in preparation nasopharyngeal carcinoma auxiliary diagnostic box or treatment nasopharyngeal carcinoma
Application in drug.
5. a kind of primer of serum miRNA marker relevant to nasopharyngeal carcinoma auxiliary diagnosis, it is characterised in that the primer includes
One of let-7b-5p, miR-140-3p, miR-192-5p, miR-223-3p and miR-24-3p or a variety of miRNA's draws
Object；It preferably include serum let-7b-5p, miR-140-3p, miR-192-5p, two kinds in miR-223-3p and miR-24-3p
Or two or more miRNA primer；Further preferably comprising let-7b-5p, miR-140-3p, miR-192- in serum miRNA
The primer of five kinds of miRNA of 5p, miR-223-3p and miR-24-3p.
6. application of the primer described in claim 5 in auxiliary diagnosis nasopharyngeal carcinoma or preparation nasopharyngeal carcinoma auxiliary diagnostic box.
7. a kind of nasopharyngeal carcinoma auxiliary diagnostic box, it is characterised in that contain let-7b-5p in serum miRNA in the kit,
The primer of one of miR-140-3p, miR-192-5p, miR-223-3p and miR-24-3p or a variety of miRNA；Preferably contain
Have in serum miRNA two kinds or two in let-7b-5p, miR-140-3p, miR-192-5p, miR-223-3p and miR-24-3p
Kind or more miRNA primer；Further preferably contain let-7b-5p, miR-140-3p, miR-192-5p in serum miRNA,
The primer of five kinds of miRNA of miR-223-3p and miR-24-3p.
8. diagnostic kit according to claim 7, it is characterised in that further include that round pcr commonly tries in the kit
Agent or/and the common reagent of immunohistochemistry technique.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811580584.9A CN109593852B (en) | 2018-12-24 | 2018-12-24 | Serum miRNA marker related to nasopharyngeal carcinoma auxiliary diagnosis and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811580584.9A CN109593852B (en) | 2018-12-24 | 2018-12-24 | Serum miRNA marker related to nasopharyngeal carcinoma auxiliary diagnosis and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109593852A true CN109593852A (en) | 2019-04-09 |
| CN109593852B CN109593852B (en) | 2022-03-08 |
Family
ID=65964253
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811580584.9A Active CN109593852B (en) | 2018-12-24 | 2018-12-24 | Serum miRNA marker related to nasopharyngeal carcinoma auxiliary diagnosis and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109593852B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110951870A (en) * | 2020-01-03 | 2020-04-03 | 中国人民解放军总医院 | Application of miRNA expression quantity in predicting therapeutic effect of clopidogrel |
| CN111308076A (en) * | 2020-04-22 | 2020-06-19 | 福建省肿瘤医院（福建省肿瘤研究所、福建省癌症防治中心） | Application of ubiquitin ligase RNF38 as nasopharyngeal carcinoma marker |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103025890A (en) * | 2010-04-06 | 2013-04-03 | 卡里斯生命科学卢森堡控股 | Circulating biomarkers for disease |
| CN105308189A (en) * | 2013-04-15 | 2016-02-03 | 瑞泽恩制药公司 | Markers of tumor cell response to anti-cancer therapy |
| CN106636079A (en) * | 2015-10-30 | 2017-05-10 | 益善生物技术股份有限公司 | Nasopharyngeal carcinoma microRNA detection kit |
-
2018
- 2018-12-24 CN CN201811580584.9A patent/CN109593852B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103025890A (en) * | 2010-04-06 | 2013-04-03 | 卡里斯生命科学卢森堡控股 | Circulating biomarkers for disease |
| CN105308189A (en) * | 2013-04-15 | 2016-02-03 | 瑞泽恩制药公司 | Markers of tumor cell response to anti-cancer therapy |
| CN106636079A (en) * | 2015-10-30 | 2017-05-10 | 益善生物技术股份有限公司 | Nasopharyngeal carcinoma microRNA detection kit |
Non-Patent Citations (2)
| Title |
|---|
| WANG,S.等: "Hsa-miR-24-3p increases nasopharyngeal carcinoma radiosensitivity by targeting both the 3"UTR and 5"UTR of Jab1/CSN5", 《ONCOGENE》 * |
| YE,S.B. 等: "Tumor-derived exosomes promote tumor progression and T-cell dysfunction through the regulation of enriched exosomal microRNAs in human nasopharyngeal carcinoma", 《ONCOTARGET》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110951870A (en) * | 2020-01-03 | 2020-04-03 | 中国人民解放军总医院 | Application of miRNA expression quantity in predicting therapeutic effect of clopidogrel |
| CN111308076A (en) * | 2020-04-22 | 2020-06-19 | 福建省肿瘤医院（福建省肿瘤研究所、福建省癌症防治中心） | Application of ubiquitin ligase RNF38 as nasopharyngeal carcinoma marker |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109593852B (en) | 2022-03-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108624695B (en) | One kind circulation miRNA marker relevant to thyroid papillary carcinoma auxiliary diagnosis and its application | |
| CN105950753B (en) | One kind blood plasma miRNA marker relevant to adenocarcinoma of lung auxiliary diagnosis and its application | |
| CN108103198B (en) | One kind blood plasma miRNA marker relevant to cancer of pancreas auxiliary diagnosis and its application | |
| CN109609633A (en) | One kind serum miRNA marker relevant to Computer-aided Diagnosis of Breast Cancer and its application | |
| CN105603101B (en) | Detect application of the system of 8 miRNA expression quantity in diagnosis or auxiliary diagnosis of hepatoma product is prepared | |
| CN106119393B (en) | Plasma miRNA marker related to esophageal squamous carcinoma auxiliary diagnosis and application thereof | |
| CN106119392B (en) | Serum miRNA marker related to esophageal squamous carcinoma auxiliary diagnosis and application thereof | |
| CN109055557A (en) | One kind serum miRNA marker relevant to cancer of pancreas auxiliary diagnosis and its application | |
| CN109609634A (en) | One kind circulation miRNA marker relevant to carcinoma of endometrium auxiliary diagnosis and its application | |
| CN108531586A (en) | A kind of relevant cycle miRNA marker and its application on X chromosome of and Computer-aided Diagnosis of Breast Cancer | |
| CN102534008A (en) | SNP (Single Nucleotide Polymorphism) marker correlated to assistant diagnosis of noncardia cancer and application thereof | |
| CN109593852A (en) | One kind serum miRNA marker relevant to nasopharyngeal carcinoma auxiliary diagnosis and its application | |
| CN108929910A (en) | One kind serum miRNA marker relevant to adenocarcinoma of lung auxiliary diagnosis and its application | |
| CN109593851A (en) | One kind blood plasma miRNA marker relevant to Computer-aided Diagnosis of Breast Cancer and its application | |
| CN106119347B (en) | The primer and kit of colorectal cancer transfer detection based on serum exosomal microRNAs | |
| CN110257514A (en) | A kind of new cancer of the esophagus blood miRNA marker and its application | |
| CN109536612A (en) | One kind blood plasma miRNA marker relevant to nasopharyngeal carcinoma auxiliary diagnosis and its application | |
| CN108103199A (en) | A kind of Xun Huan miRNA marker relevant with oophoroma auxiliary diagnosis and its application | |
| CN107723365B (en) | One kind blood plasma miRNA marker relevant to lung squamous cancer auxiliary diagnosis and its application | |
| CN107746886B (en) | One kind blood plasma miRNA marker relevant to colorectal cancer auxiliary diagnosis and its application | |
| CN106350582B (en) | Serum miRNA marker related to lung squamous carcinoma auxiliary diagnosis and application thereof | |
| CN106086178B (en) | Serum miRNA marker related to gastric cancer auxiliary diagnosis and application thereof | |
| CN106367477A (en) | Serum miRNA marker related to auxiliary diagnosis of colorectal cancer, and application thereof | |
| CN109022586A (en) | One kind blood plasma miRNA marker relevant to cervical carcinoma auxiliary diagnosis and its application | |
| WO2021159562A1 (en) | Circulating mirna and carcino-embryonic mirna marker related to pan-tumor auxiliary diagnosis, and use thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |