CN108103198B - One kind blood plasma miRNA marker relevant to cancer of pancreas auxiliary diagnosis and its application - Google Patents
One kind blood plasma miRNA marker relevant to cancer of pancreas auxiliary diagnosis and its application Download PDFInfo
- Publication number
- CN108103198B CN108103198B CN201810147643.7A CN201810147643A CN108103198B CN 108103198 B CN108103198 B CN 108103198B CN 201810147643 A CN201810147643 A CN 201810147643A CN 108103198 B CN108103198 B CN 108103198B
- Authority
- CN
- China
- Prior art keywords
- mir
- cancer
- mirna
- blood plasma
- pancreas
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Pathology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Hospice & Palliative Care (AREA)
- Biophysics (AREA)
- Oncology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention discloses one kind blood plasma miRNA marker relevant to cancer of pancreas auxiliary diagnosis and its application, which is one of miR-122-5p, miR-125b-5p, miR-192-5p, miR-193b-3p, miR-221-3p and miR-27b-3p or a variety of.Blood plasma miRNA as novel biomarker, have the characteristics that stability it is good, it is minimally invasive it is easy obtain, sensitivity and specificity it is high.The development and utilization of this kind of molecular marker will provide new direction for the diagnosis of the various diseases including tumour and further treatment.This research by it is more targeted obtain with clinical diagnosis potential and predict prognostic capabilities cancer of pancreas blood plasma miRNA marker.Research confirms reliability and repeatability of this group of miRNA as the noninvasive marker of diagnosis of pancreatic cancer.
Description
Technical field
The invention belongs to genetic engineering and oncologies, are related to a kind of blood plasma relevant to cancer of pancreas auxiliary diagnosis
MiRNA marker and its application.
Background technique
Cancer of pancreas (PC) is current Chinese the sixth-largest, and the reason of global the seventh-largest cancer mortality.The poor prognosis of the disease,
5 years overall survival (OS) be lower than 5%.Though systemic chemotherapy can extend the life cycle of Pancreas cancer patients, operation excision is still only
One recoverable treatment method.However, early stage is in when the Pancreas cancer patients only less than 10% are diagnosed, it is most of to suffer from
Person loses operative chance due to neoplasm staging relatively late.Early detection and intervention are to improve the long-term final result of Pancreas cancer patients
Key Strategy.Therefore, many researchs concentrate on the biomarker and molecular target of cancer of pancreas, it is desirable to increase the life of patient
It deposits.In clinical practice, serum CA 19-9 (CA19-9) can be used as the biology mark of cancer of pancreas detection and monitoring neoplastic state
Will object.But CA19-9 does not show enough sensibility and specificities, especially early stage patient in diagnosis of pancreatic cancer.It is benign
The raising of false positive existing for obstruction of biliary tract or chronic pancreatitis may also limit its effect in clinic.Therefore, urgent at present
It needs more novel reliable biomarkers to detect cancer of pancreas in favor of early intervention, extends the life cycle of patient.
Microrna (miRNAs) is small non-coding RNA molecule of a kind of length in 22 or so nucleotide, by turning
Regulate and control the various vital movement processes of wide participation, generation, invasion and transfer including tumour etc. after record.The study found that miRNA
Expression there is different degrees of upper reconciliation to lower in tumour, for its can the tumor markers emerging as one kind establish base
Plinth.2008, Mitchell detected free miRNA in peripheral blood, it is found that it can be stable in the presence of in peripheral blood, and
And it can be used as the noninvasive marker of diagnosing tumour.There is now research confirms circulation miRNA in gastric cancer, lung cancer, breast cancer, knot
Potential diagnostic value in the tumours such as the carcinoma of the rectum.But due to research method and it is included in the difference of crowd, causes result of study endless
It is complete consistent.Therefore, this research and utilization Exiqon miRNA qPCR panel chip and the method based on qRT-PCR, by right
The research of the cancer of pancreas blood plasma of large sample, it is intended to find the blood plasma miRNA that there is potential diagnostic value to cancer of pancreas.And to these
Expression of the miRNA in Pancreatic Adenocarcinoma and in the blood plasma excretion body of periphery is verified, and further to define itself and cancer of pancreas
Relationship.Effect simultaneously for these blood plasma miRNAs in prediction patient's prognosis is further studied.If according to this kind of
MiRNA designs the diagnostic kit for being directed to cancer of pancreas, it will the treatment level for pushing China's cancer of pancreas, is also future to pancreas
The further research of cancer provides thinking.
Summary of the invention
The purpose of the present invention is to provide a kind of blood plasma miRNA markers relevant to cancer of pancreas auxiliary diagnosis.
Another object of the present invention is to provide above-mentioned blood plasma miRNA markers and its primer to examine in preparation cancer of pancreas auxiliary
Disconnected kit and the application in the drug of preparation treatment cancer of pancreas.
Another object of the present invention is to provide kit and drug for cancer of pancreas auxiliary diagnosis and treatment.
Another object of the present invention is to provide kits and drug that prediction prognosis and treatment is assisted for cancer of pancreas.
The purpose of the present invention can be achieved through the following technical solutions:
A kind of blood plasma miRNA marker relevant to cancer of pancreas auxiliary diagnosis, the marker are miR-122-5p
(uggagugugacaaugguguuug),miR-125b-5p(ucccugagacccuaacuuguga),miR-192-5p
(cugaccuaugaauugacagcc),miR-193b-3p(aacuggcccucaaagucccgcu)miR-221-3p
(agcuacauugucugcuggguuuc) and one of miR-27b-3p (uucacaguggcuaaguucugc) or a variety of.It should
Blood plasma miRNA marker is preferably miR-122-5p, miR-125b-5p, miR-192-5p, miR-193b-3p, miR-221-3p
With the combination of two or more in miR-27b-3p, further preferably miR-122-5p, miR-125b-5p, miR-
Combination composed by six kinds of miRNA of 192-5p, miR-193b-3p, miR-221-3p and miR-27b-3p.
Application of the above-mentioned blood plasma miRNA marker in auxiliary diagnosis cancer of pancreas.
Above-mentioned blood plasma miRNA marker is in preparation cancer of pancreas auxiliary diagnostic box or treats answering in pancreatic cancer drug
With.
A kind of primer of blood plasma miRNA marker relevant to cancer of pancreas auxiliary diagnosis, the primer include miR-122-5p,
One of miR-125b-5p, miR-192-5p, miR-193b-3p, miR-221-3p and miR-27b-3p or a variety of miRNA
Primer；Preferably comprising miR-122-5p, miR-125b-5p in blood plasma miRNA, miR-192-5p, miR-193b-3p,
The primer of two or more miRNA in miR-221-3p and miR-27b-3p；Further preferably comprising in blood plasma miRNA
Six kinds of miRNA of miR-122-5p, miR-125b-5p, miR-192-5p, miR-193b-3p, miR-221-3p and miR-27b-3p
Primer.
Application of the above-mentioned primer in auxiliary diagnosis cancer of pancreas or preparation cancer of pancreas auxiliary diagnostic box.
A kind of cancer of pancreas auxiliary diagnostic box contains miR-122-5p, miR- in blood plasma miRNA in the kit
One of 125b-5p, miR-192-5p, miR-193b-3p, miR-221-3p and miR-27b-3p or a variety of miRNA's draws
Object；Preferably containing miR-122-5p, miR-125b-5p, miR-192-5p, miR-193b-3p, miR- in blood plasma miRNA
The primer of two or more miRNA in 221-3p and miR-27b-3p；Further preferably containing miR- in blood plasma miRNA
Six kinds of miRNA's of 122-5p, miR-125b-5p, miR-192-5p, miR-193b-3p, miR-221-3p and miR-27b-3p draws
Object.
It further include the common reagent of round pcr in the kit.
The kit can also include that PCR reacts common agents, such as reverse transcriptase, buffer, dNTPs, MgCl2, DEPC
Water and Taq enzyme etc.；Standard items and/or reference substance can also be contained.
Blood plasma miRNA marker miR-122-5p, miR-125b- relevant to diagnosis of pancreatic cancer according to the present invention
The sequence of every kind of miRNA in 5p, miR-192-5p, miR-193b-3p, miR-221-3p and miR-27b-3p discloses,
But each miRNA marker is combined and needs those skilled in the art to pay creation as cancer of pancreas auxiliary diagnosis marker
Property labour.The amplimer of each miRNA marker can be bought by market and be obtained, blood plasma used in the embodiment of the present invention
The primer of miRNA marker is the specific miRNA stem ring RT-PCR primer purchased from production synthesized by the Rui Bo company of Guangzhou.
Specifically, the technical solution that the present invention solves the problems, such as includes: the sample storehouse and data that (1) establishes unified standard
Library: standard compliant blood sample is acquired with S.O.P. (SOP), system collects complete demographic data and clinical money
Material.(2) blood plasma miRNA differential expression spectrum analysis: analyzing the blood plasma miRNA of differential expression in cancer of pancreas and normal control population,
And further large sample multistage verifying is carried out to differential expression miRNAs.(3) by multistage verifying, these are specified
The ability of miRNA diagnosis of pancreatic cancer.(4) development of blood plasma miRNA diagnostic kit: according to Pancreas cancer patients and normal population blood
Differential expression miRNA in slurry develops miRNAs diagnostic kit, realizes the noninvasive auxiliary diagnosis to Pancreas cancer patients.(5) divide
Analyse the ability of these blood plasma miRNAs prediction Pancreas cancer patients prognosis.(6) these miRNA are analyzed in Pancreatic Adenocarcinoma and excretion
Expression in body discloses the relationship of these miRNA and cancer of pancreas, relevant to these miRNA may control to develop in the future
The drug for treating cancer of pancreas provides foundation.
The present inventor acquires standard compliant blood sample with S.O.P. (SOP), and system collects complete population
Data, clinical data, and use Exiqon miRNA qPCR panel chip and qRT-PCR method etc..
The experimental method specifically studied mainly includes following components:
1. research samples selection: just controlling, row is performed the operation and chemicotherapy intervention and the patient for being confirmed as cancer of pancreas through pathology.
Normal control is the normal population to check UP in hospital.
2.Exiqon miRNA qPCR panel chip primary dcreening operation: blood plasma mixing sample is carried out using TRIZOL-LS reagent
RNA is extracted, and is carried out qRT-PCR operation and obtained primary dcreening operation result.
3. training set, test set: carrying out RNA extraction to each plasma sample using AM1556 kit (ABI company), lead to
It crosses reverse transcription reaction and obtains cDNA sample, PCR primer is added and SYBR Green fluorescent dye carries out PCR reaction.Pass through comparison
The Ct value of standard items obtains the miRNA content in sample.
4. extracting the RNA in cancer of pancreas and cancer beside organism using TRIZOL-LS reagent, (SBI is public for ExoQuick kit
Department) and AM1556 kit (ABI company) extract the RNA in excretion body, by the method for qRT-PCR, detection miRNA is being organized
And the differential expression in excretion body.
5. statistical analysis: using χ2It examines, paired t-test and non-parametric rank sum test compare miRNA expression and exist
Difference in different study groups.The diagnostic value of blood plasma miRNA is confirmed by calculating ROC curve analysis.KM curve, log-rank
It examines and COX regression analysis confirms the ability that blood plasma miRNA predicts Pancreas cancer patients prognosis.
Study group of the present invention carries out the expression point of system by the miRNA in the periphery blood plasma to Patients with Pancreatic Cancer at present
Analysis, it has now been found that one group 6 with clinical diagnosis potential cancer of pancreas blood plasma microRNA marker (miR-122-5p,
MiR-125b-5p, miR-192-5p, miR-193b-3p, miR-221-3p and miR-27b-3p).
Beneficial effects of the present invention:
1. compared to traditional tumor markers, blood plasma miRNA as novel biomarker, have stability it is good,
Minimally invasive easy acquisition, sensitivity and specific high feature.The development and utilization of this kind of molecular marker will be for including tumour
The diagnosis of various diseases and further treatment provide new direction.
2. researcher is by Exiqon miRNAqPCR panel chip and the absolute quantitation method based on qRT-PCR, right
Differential expression miRNA in cancer of pancreas and normal control population's blood plasma carries out tight, multistage verifying and evaluation.Confirm this
Reliability and repeatability of the group miRNA as the noninvasive marker of diagnosis of pancreatic cancer.
3. further determined the ability of blood plasma miRNA prediction cancer of pancreas prognosis by survival analysis.
Detailed description of the invention
Fig. 1: experiment flow figure
Fig. 2: highly expressed 6 miRNA in cancer of pancreas blood plasma
Fig. 3: ROC curve analysis is carried out to miRNA obtained.
Wherein, A: the intersection of training set and test set；B: training set；C: test set；D: additional authentication collection.
ROC curve analysis of the numerical value of Fig. 4: 6 blood plasma miRNAs fitting in different patients by stages.
Wherein, situation of the numerical value of A:6 blood plasma miRNA fitting in each group；B: early stage patient ROC curve；C: advanced stage
Patient's ROC curve
Fig. 5: KM tracing analysis is carried out to miRNA obtained.
Wherein, A:miR-125b-5p；The numerical value of B:6 blood plasma miRNA fitting；C:miR-125b-5p is in early stage patient
In；D:miR-125b-5p is late in patient.
Expression of Fig. 6: 6 miRNA in Pancreas cancer patients tissue
Specific embodiment
Inventor had collected a large amount of cancer of pancreas from No.1 Attached Hospital, Nanjing Medical Univ in 2010 to 2014 and suffers from
The venous plasma sample of person and normal Check-up crowd, by the arrangement to sample data, therefrom selected 216 cancers of pancreas and
The sample of 220 normal controls is as Exiqon miRNA qPCR panel chip primary dcreening operation and a series of subsequent qRT-PCR verifyings
Laboratory sample.44 Pancreatic Adenocarcinomas and 44 cancer beside organisms have also been left and taken simultaneously.Selected patients blood plasma's sample comes
From Yu Chuzhi, row operation and chemicotherapy intervention and the patient that cancer of pancreas is confirmed as through pathology.And system acquisition these samples
This demographic data, clinical data.
Referring to flow chart (Fig. 1), 20 cancer of pancreas samples have been randomly choosed from cancer of pancreas and normal control plasma sample
Sheet and 10 normal controls, and it has been mixed into 2 cancer of pancreas blood plasma mixing samples and 1 normal mixing sample (one respectively
A mixing sample is converged the sample for forming 2ml by 10 200ul plasma samples).Exiqon is carried out to this 3 mixing samples
MiRNA qPCR panel chip primary dcreening operation and analysis, explanation of the specific steps referring to Exiqon miRNA qPCR panel chip
Book:
1. blood plasma extracts
Plasma sample is taken out, 3000xg is centrifuged 5min and removes some fragments and some insoluble components after sample thaws.Transfer
Supernatant after 750ul TRIZOL-LS is added, acutely shakes 5s into new 1.5ml pipe.
2. two-phase laminated flow
Sample is incubated for 5 minutes in 15 to 30 DEG C after homogenate.It is added in the sample of the TRIZOL-LS reagent homogenate of every 1ml
The chloroform of 0.2ml covers tightly pipe lid.Manually acutely after oscillation tube body 15 seconds, 15 to 30 DEG C are incubated for 2 to 3 minutes.13,000g at 4 DEG C
Centrifugation 15 minutes.
3.RNA precipitating
Water phase is transferred in new centrifuge tube.Water phase is mixed with isopropanol to precipitate RNA therein, and the amount of isopropanol is added
Are as follows: add the isopropanol of 0.5ml and the glycogen of 5ul in the sample of 1ml TRIZOL-LS reagent homogenate.It 4 DEG C of standing half an hour, allows
RNA is precipitated as far as possible.It is centrifuged 15 minutes in 4 DEG C of 13,000g.
4.RNA cleaning
Supernatant is removed, at least the 75% of 1ml (v/v) ethyl alcohol is added in the sample of every 1ml TRIZOL-LS reagent homogenate,
Clean RNA precipitate.10 minutes are stood, then 10000g is centrifuged 5 minutes at 4 DEG C.
5. re-dissolving RNA precipitate
Ethanol solution is removed, air drying RNA precipitate 5-10 minutes, water of the addition without RNA enzyme was blown and beaten several repeatedly with rifle
It is secondary, then it is incubated for 10 minutes for 55 to 60 DEG C.
6. measuring concentration:
Usually lead to~5 μ g RNA/50ml blood plasma.
7.cDNA synthesis
(1) it dilutes template ribonucleic acid: 20-25ng template ribonucleic acid being diluted to 14ul (final concentration of 1.492- using DEPC water
1.786ng/μl)。
(2) prepare reaction solution: 5 × Reaction Buffer and DEPC water being placed in and is dissolved on ice, and shakes mixing.
Enzyme mix is placed in -20 DEG C of ice chests, flicks mixing before use and is placed on ice.All reagents use after being centrifuged.
(3) reaction solution is configured: the reaction solution in configuration following table
(4) it mixes and is centrifuged reagent: being centrifuged after concussion or suction mixing reaction solution, to guarantee that all solution are thoroughly mixed
Uniformly.
(5) reverse transcription reaction and heat inactivation: reaction solution is incubated after sixty minutes in 42 DEG C, incubates 5 minutes in 95 DEG C to lose
Reverse transcriptase living.
8.Real-Time PCR
Reagent:
Nuclease free water(Exiqon)
SYBRTM Green master mix(Exiqon)
CDNA template
ROX(Invitrogen)
miRNA PCR ARRAY(Exiqon)
Instrument:
ABI PRISM7900system(Applied Biosystems)
(1) prepare Real-time PCR reagent: by the cDNA template of preparation, DEPC water and SYBRTM Green master
Mix is placed in be dissolved 15-20 minutes on ice.
(2) it dilutes cDNA template: the cDNA template nuclease free water that RT reaction obtains is diluted 110 times
(for example, 2180ul nuclease free water is added into 20 μ l reaction solutions).
(3) all reaction reagents are mixed:
A. after PCR plate being simply centrifuged, sealer is removed.
B. 110 times of diluted cDNA templates are mixed with 2 × SYBR Green master mix according to 1:1 volume ratio.
C. it is inverted and mixes reaction solution and be centrifuged
D., mixed reaction solution is added to each hole in plate
E. PCR plate is sealed again
(4) PCR plate simple, low temperature is centrifuged
(5) Real-time PCR amplification and dissolution Real-time PCR amplification: are carried out according to the reaction condition in following table
Tracing analysis.
Real-time PCR cycle condition is as follows:
Data analysis: Δ Δ Ct method is used
Carry out primary data analysis using the subsidiary software of PCR instrument, obtain original Cq value (Cp or Ct, not according to instrument
It may be different with title).
It is proposed that analyzing software (www.exiqon.com/mirna-pcr-analysis) logarithm using GenEx qPCR
According to the standard of progress and deep data analysis.
A. the Δ Ct of each passageway related genes in each processing group is calculated.
Δ Ct (group 1)=1 array of average Ct-average of HK genes ' Ct for group
Δ Ct (group 2)=2 array of average Ct-average of HK genes ' Ct for group
B. the Δ Δ Ct of each gene in 2 PCR Array (or two groups) is calculated.
Δ Δ Ct=Δ Ct (group 2)-Δ Ct (group 1)
Remarks: usually group 1 is control, and group 2 is experimental group.
C. pass through 2- Δ Δ Ct calculating group 2 and the differential expression for organizing 1 corresponding gene.
After chip primary dcreening operation, obtain such as 35 differential expression miRNA (2 cancer of pancreas blood plasma mixing samples in following table
In relative to normal sample be above 1.5 times of differences).
The 32 differential expression miRNA obtained for primary dcreening operation are (plus 4 miRNA:miR-146a-5p, miR- in document
155-5p, miR-181b-5p and miR-196a-5p；Totally 36 miRNA), by training set, test set and additional authentication collection, adopt
It is verified with the method based on qRT-PCR, specific steps are as follows:
1. blood plasma RNA extracts: selecting ABI company blood plasma RNA extracts kit (AM1556), illustrate referring to kit, often
A sample draws 200ul and extracts RNA, and is finally dissolved with 100ul DEPC water.
The preparation of 2.cDNA:
1) reverse transcription experiment is carried out using 50 μ L reaction systems
The above reaction system mixes, and after brief centrifugation, is reacted with following procedure:
2) following reactant is added in reaction system again after above-mentioned reaction
3.qPCR
1) 5 μ L reaction systems are used, are tested in the following proportions
Reaction system mixes, and after brief centrifugation, is placed in real-time PCR, is reacted with following procedure:
Solubility curve is added after reaction.
Data analysis: using miR-103a-3p as internal reference, using 2-ΔΔCtMethod relative quantification method.It is soft using SPSS 16.0
Part is for statistical analysis, has obtained one group and has been unanimously in cancer of pancreas blood plasma highly expressed 6 in training set and test set
MiRNA:miR-122-5p, miR-125b-5p, miR-192-5p, miR-193b-3p, miR-221-3p and miR-27b-3p (
P value is both less than 0.05, Fig. 2 in training set and test set).As the molecular marker of Fig. 3, this 6 miRNA composition can be good at
Differentiating pancreatic cancer patient and normal population.Additional training set then further demonstrates the reliability of result.This this 6 simultaneously
The molecular marker of miRNA composition can obviously distinguish Pancreas cancer patients and normal control (Fig. 4) in early patients with terminal.
Study group analyzes the ability of the prediction prognosis of blood plasma miRNA, it is found that miR-125-5p and 6 blood plasma miRNA is quasi-
The predictable prognosis of the numerical value of conjunction, and miR-125b-5p all has prognosis meaning (such as Fig. 5) in early stage and patients with terminal.
The expression of this 6 miRNA excretion bodies in Pancreatic Adenocarcinoma and blood plasma, pancreas are further had detected after study group
Adenocarcinoma tissue extracts RNA and utilizes TRIZOL, and excretion body extracts kit is ExoQuick kit (SBI company).200ul blood plasma
After the excretion body 200ul DEPC water extracted is resuspended, excretion body RNA is carried out using AM1556 kit (ABI company)
It extracts, step is the same as blood plasma RNA extraction process.
It is found with non-parametric test analysis, miR-125b-5p, miR-192-5p, miR-193b-3p, miR-221-3p
It is higher than cancer beside organism (Fig. 6) with expression of the miR-27b-3p in Pancreatic Adenocarcinoma.And miR-122-5p, miR-193b-3p
Normal population (such as following table) is apparently higher than with expression of the miR-221-3p in cancer of pancreas blood plasma excretion body.
Expression of 6 miRNA in blood plasma excretion body
| miRNA | Cases | Controls | FC | P value |
| miR-122-5p | -2.49±2.03 | -0.96±1.12 | 2.88 | 0.002 |
| miR-125b-5p | -0.92±0.63 | -1.06±0.59 | 0.91 | 0.46 |
| miR-192-5p | -2.63±1.3 | -2.75±2.04 | 0.92 | 0.605 |
| miR-193b-3p | 3.04±1.67 | 3.87±1.44 | 1.77 | 0.032 |
| miR-221-3p | -2.43±0.64 | -2.8±0.67 | 0.77 | 0.025 |
| miR-27b-3p | 0.41±0.97 | 0.11±0.94 | 0.81 | 0.218 |
Kit includes a collection of blood plasma miRNA qRT-PCR primer, can also there is common examination needed for corresponding round pcr
Agent, such as: reverse transcriptase, buffer, dNTPs, MgCl2, DEPC water, fluorescence probe, RNase inhibitor, Taq enzyme etc. can basis
The experimental method that specifically uses is selected, these common agents be all it is well known to those skilled in the art, in addition it can there is standard
Product and control (normal person's sample of such as quantitative markization).The value of this kit is only to need blood plasma without other groups
Tissue samples carry out auxiliary diagnosis samples sources trouble by the expression contents of miRNA in the Fluorometric assay plasma sample most simplified
A possibility that suffering from cancer of pancreas of person.Blood plasma miRNA is easy to detect, and quantitative accurate, greatly improves the sensibility of medical diagnosis on disease
And specificity, therefore this kit is put into and is practiced, it can help to instruct diagnosis and further individualized treatment.
Claims (3)
1. miR-122-5p, miR-125b-5p, miR-192-5p, miR-193b-3p, miR-221-3p in quantitative detection blood plasma
Reagent with six kinds of miRNA expressions of miR-27b-3p is preparing the application in cancer of pancreas auxiliary diagnostic box.
2. application according to claim 1, which is characterized in that include specific amplification miR-122- in the kit
The primer of six kinds of miRNA of 5p, miR-125b-5p, miR-192-5p, miR-193b-3p, miR-221-3p and miR-27b-3p.
3. application according to claim 2, which is characterized in that it further include reverse transcriptase in the kit, buffer,
DNTPs, MgCl2, DEPC water, fluorescence probe, RNA enzyme inhibitor and Taq enzyme.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810147643.7A CN108103198B (en) | 2018-02-13 | 2018-02-13 | One kind blood plasma miRNA marker relevant to cancer of pancreas auxiliary diagnosis and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810147643.7A CN108103198B (en) | 2018-02-13 | 2018-02-13 | One kind blood plasma miRNA marker relevant to cancer of pancreas auxiliary diagnosis and its application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108103198A CN108103198A (en) | 2018-06-01 |
| CN108103198B true CN108103198B (en) | 2019-10-01 |
Family
ID=62205741
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810147643.7A Active CN108103198B (en) | 2018-02-13 | 2018-02-13 | One kind blood plasma miRNA marker relevant to cancer of pancreas auxiliary diagnosis and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108103198B (en) |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109897855A (en) * | 2019-04-28 | 2019-06-18 | 武汉市中心医院 | A kind of serum miRNA marker and its application in the cancer of pancreas early diagnosis that pancreatitis mediates |
| CN112639124A (en) * | 2019-08-02 | 2021-04-09 | 株式会社东芝 | Analytical method and kit |
| WO2021124455A1 (en) * | 2019-12-17 | 2021-06-24 | 株式会社 東芝 | Analytical method and kit |
| CN111850109A (en) * | 2020-07-30 | 2020-10-30 | 武汉市皮诺飞生物科技有限公司 | miR-122-5p as renal fibrosis noninvasive diagnosis marker neutralization detection kit |
| WO2024047914A1 (en) * | 2022-08-31 | 2024-03-07 | Kabushiki Kaisha Toshiba | Analysis method, kit, and detection device for cancer diagnosis by means of microrna expression |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2586455B1 (en) * | 2006-01-05 | 2014-06-25 | The Ohio State University Research Foundation | MicroRNA expressions abnormalities in pancreatic endocrine and acinar tumors |
| CN104704122A (en) * | 2012-04-20 | 2015-06-10 | 艾珀特玛治疗公司 | miRNA modulators of thermogenesis |
| CN102876676B (en) * | 2012-09-24 | 2014-09-24 | 南京医科大学 | Blood serum/blood plasma micro ribonucleic acid (miRNA) marker relevant with pancreatic cancer and application thereof |
| WO2014171730A1 (en) * | 2013-04-17 | 2014-10-23 | Lg Electronics Inc. | Method for extracting biomarker for diagnosing pancreatic cancer, computing device therefor, biomarker for diagnosing pancreatic cancer and device for diagnosing pancreatic cancer including the same |
-
2018
- 2018-02-13 CN CN201810147643.7A patent/CN108103198B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN108103198A (en) | 2018-06-01 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108103198B (en) | One kind blood plasma miRNA marker relevant to cancer of pancreas auxiliary diagnosis and its application | |
| CN108624695B (en) | One kind circulation miRNA marker relevant to thyroid papillary carcinoma auxiliary diagnosis and its application | |
| CN105950753B (en) | One kind blood plasma miRNA marker relevant to adenocarcinoma of lung auxiliary diagnosis and its application | |
| CN105603101B (en) | Detect application of the system of 8 miRNA expression quantity in diagnosis or auxiliary diagnosis of hepatoma product is prepared | |
| CN109609633A (en) | One kind serum miRNA marker relevant to Computer-aided Diagnosis of Breast Cancer and its application | |
| CN106119392A (en) | A kind of serum miRNA marker relevant to esophageal squamous cell carcinoma auxiliary diagnosis and application thereof | |
| CN106119393B (en) | Plasma miRNA marker related to esophageal squamous carcinoma auxiliary diagnosis and application thereof | |
| CN109055557A (en) | One kind serum miRNA marker relevant to cancer of pancreas auxiliary diagnosis and its application | |
| CN106701964A (en) | Serum exosome miRNA biological marker and kit for early diagnosis of gastric cancer | |
| CN109609634A (en) | One kind circulation miRNA marker relevant to carcinoma of endometrium auxiliary diagnosis and its application | |
| CN108531586A (en) | A kind of relevant cycle miRNA marker and its application on X chromosome of and Computer-aided Diagnosis of Breast Cancer | |
| CN106119347B (en) | The primer and kit of colorectal cancer transfer detection based on serum exosomal microRNAs | |
| CN109593852A (en) | One kind serum miRNA marker relevant to nasopharyngeal carcinoma auxiliary diagnosis and its application | |
| CN108929910A (en) | One kind serum miRNA marker relevant to adenocarcinoma of lung auxiliary diagnosis and its application | |
| CN109593851A (en) | One kind blood plasma miRNA marker relevant to Computer-aided Diagnosis of Breast Cancer and its application | |
| CN108103199A (en) | A kind of Xun Huan miRNA marker relevant with oophoroma auxiliary diagnosis and its application | |
| CN107746886B (en) | One kind blood plasma miRNA marker relevant to colorectal cancer auxiliary diagnosis and its application | |
| CN110257514A (en) | A kind of new cancer of the esophagus blood miRNA marker and its application | |
| CN107723365B (en) | One kind blood plasma miRNA marker relevant to lung squamous cancer auxiliary diagnosis and its application | |
| CN106086178A (en) | A kind of serum miRNA marker relevant to gastric cancer auxiliary diagnosis and application thereof | |
| CN106367477A (en) | Serum miRNA marker related to auxiliary diagnosis of colorectal cancer, and application thereof | |
| CN106350582A (en) | Serum miRNA marker related to auxiliary diagnosis for squamous lung cell carcinoma and application thereof | |
| CN109022586A (en) | One kind blood plasma miRNA marker relevant to cervical carcinoma auxiliary diagnosis and its application | |
| CN106086226A (en) | A kind of blood plasma miRNA mark relevant to IgA nephropathy auxiliary diagnosis and application thereof | |
| CN109536612A (en) | One kind blood plasma miRNA marker relevant to nasopharyngeal carcinoma auxiliary diagnosis and its application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |