CN106119392A - A kind of serum miRNA marker relevant to esophageal squamous cell carcinoma auxiliary diagnosis and application thereof - Google Patents
A kind of serum miRNA marker relevant to esophageal squamous cell carcinoma auxiliary diagnosis and application thereof Download PDFInfo
- Publication number
- CN106119392A CN106119392A CN201610723653.1A CN201610723653A CN106119392A CN 106119392 A CN106119392 A CN 106119392A CN 201610723653 A CN201610723653 A CN 201610723653A CN 106119392 A CN106119392 A CN 106119392A
- Authority
- CN
- China
- Prior art keywords
- mir
- mirna
- squamous cell
- cell carcinoma
- serum
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
Abstract
The present invention discloses a kind of serum miRNA marker that auxiliary diagnosis is relevant to esophageal squamous cell carcinoma and application thereof, and this mark is miR 20b 5p, miR 28 3p, miR 192 one or more in 3p and miR 296 5p of 5p, miR 223.Serum miRNA as novel biomarker, has good stability, Wicresoft easily obtains, susceptiveness and the high feature of specificity.This kind of molecular marker develop by for the various diseases including tumor diagnosis and further treatment new direction is provided.This research draws have the esophageal squamous cell carcinoma serum miRNA label of clinical diagnosis potential by more targeted.Research confirms that this group miRNA is as the reliability of noinvasive label of diagnosis esophageal squamous cell carcinoma and repeatability.
Description
Technical field
The invention belongs to genetic engineering and oncology, relate to a kind of serum relevant to esophageal squamous cell carcinoma auxiliary diagnosis
MiRNA marker and application thereof.
Background technology
The esophageal carcinoma is common malignant tumor of digestive tract.The mortality rate of esophageal cancer in China occupies the 4th, tumor, and 2015 about
4.8 ten thousand esophageal carcinoma new cases and 3.8 ten thousand esophageal carcinoma are had to be correlated with lethal patient.China's esophageal squamous cell carcinoma case accounts for esophageal carcinoma sum
90%, although current diagnosis method, peri-operation period strategy and chemicotherapy means constantly improve, patients with esophageal squamous cell carcinoma postoperative recurrence
Shift risk the biggest, and five year survival rate is only 15%-25%.Owing to patients with esophageal squamous cell carcinoma early clinical manifestation is without bright
Aobvious specificity, major part patient has been in tumor middle and advanced stage when making a definite diagnosis, and therefore, early diagnosis early intervention can be improved effectively
The prognosis of patient and life quality.The Main Diagnosis measure of esophageal squamous cell carcinoma at present includes: imaging examination, endoscopy and disease
Diagnosis of science, but iconography and endoscopy have certain radiation and wound risk.Tumor markers conventional clinically, as
Carcinoembryonic antigen (CEA) and squamous cell carcinoma-related antigen (SCC) etc., also lack certain susceptiveness and specificity.Thus, it is found that
New can the label of early diagnosis esophageal squamous cell carcinoma thus promote that esophageal squamous cell carcinoma early intervention and treatment have important clinic
Meaning.
Microrna (miRNAs) is the class length little non-coding RNA molecule at the nucleotide of about 22, and it is by turning
Regulate and control the various vital movement processes of wide participation after record, including tumor generation, attack and transfer etc..Research finds, miRNA
Expression have in tumor in various degree upper mediation lower, base can have been established as a kind of emerging tumor markers for it
Plinth.2008, Mitchell detected free miRNA in peripheral blood, found that it can be stable in the presence of in peripheral blood, and
And can be as the noinvasive mark of diagnosing tumour.There is now research and confirm that circulation miRNA (includes esophageal squamous cell in kinds of tumors
Cancer) in potential diagnostic value.But it is the most less about the larger samples miRNA pedigree research of esophageal squamous cell carcinoma.Therefore, originally
Research and utilization Exiqon miRNA qPCR panel chip and relative quantification method based on qRT-PCR, by large sample
The research of esophageal squamous cell carcinoma serum, it is intended to find the serum miRNA that esophageal squamous cell carcinoma is had potential diagnostic value.And to these
The expression that miRNA secretes in body in esophageal squamous cell carcinoma tissue and outside Peripheral Blood is verified, further to define itself and esophagus
The relation of scale cancer.If being directed to the diagnostic kit of esophageal squamous cell carcinoma according to this kind of miRNA design, it will promote China's esophageal squamous cell carcinoma
Treatment level, also provide thinking in the future research further to esophageal squamous cell carcinoma.
Summary of the invention
It is an object of the invention to provide a kind of serum miRNA marker relevant to esophageal squamous cell carcinoma auxiliary diagnosis.
Another object of the present invention is to provide above-mentioned serum miRNA marker and primer thereof in preparation esophageal squamous cell carcinoma auxiliary
Diagnostic kit and the application in the medicine of preparation treatment esophageal squamous cell carcinoma.
A further object of the present invention is to provide the test kit diagnosing for esophageal squamous cell carcinoma auxiliary and treating and medicine.
The purpose of the present invention can be achieved through the following technical solutions:
A kind of serum miRNA marker relevant to esophageal squamous cell carcinoma auxiliary diagnosis, this mark is miR-20b-5p
(CAAAGUGCUCAUAGUGCAGGUAG)、miR-28-3p(CACUAGAUUGUGAGCUCCUGGA)、miR-192-5p
(CUGACCUAUGAAUUGACAGCC), miR-223-3p (UGUCAGUUUGUCAAAUACCCCA) and miR-296-5p
(AGGGCCCCCCCUCAAUCCUGU) one or more in, such as the group of miR-20b-5p, miR-28-3p and miR-192-5p
Close, or miR-296-5p.This serum miRNA marker is preferably miR-10b-5p, miR-132-3p, miR-185-5p, miR-
Two or more combination in 195-5p, miR-20a-3p and miR-296-5p, more preferably miR-10b-5p,
The combination that five kinds of miRNA of miR-132-3p, miR-185-5p, miR-195-5p, miR-20a-3p and miR-296-5p are formed.
The application in auxiliary diagnosis esophageal squamous cell carcinoma of the above-mentioned serum miRNA marker.
Above-mentioned serum miRNA marker is in preparation esophageal squamous cell carcinoma auxiliary diagnostic box or treatment esophageal squamous cell carcinoma medicine
Application.
The primer of a kind of serum miRNA marker relevant to esophageal squamous cell carcinoma auxiliary diagnosis, this primer comprises miR-20b-
The primer of one or more miRNA in 5p, miR-28-3p, miR-192-5p, miR-223-3p and miR-296-5p；Preferably
For comprising in serum miRNA in miR-20b-5p, miR-28-3p, miR-192-5p, miR-223-3p and miR-296-5p two kinds
Or the primer of two or more miRNA；More preferably comprise miR-20b-5p, miR-28-3p, miR-in serum miRNA
The primer of five kinds of miRNA of 192-5p, miR-223-3p and miR-296-5p.
The application in auxiliary diagnosis esophageal squamous cell carcinoma or preparation esophageal squamous cell carcinoma auxiliary diagnostic box of the above-mentioned primer.
A kind of esophageal squamous cell carcinoma auxiliary diagnostic box, this test kit be used for detecting serum miR-20b-5p, miR-28-3p,
One or more miRNA in miR-192-5p, miR-223-3p and miR-296-5p；It is preferably used for detecting serum miR-
Two or more miRNA in 20b-5p, miR-28-3p, miR-192-5p, miR-223-3p and miR-296-5p；Enter
One step is preferably used for detecting miR-20b-5p, miR-28-3p, miR-192-5p, miR-223-3p and the miR-in serum
Five kinds of miRNA of 296-5p.
A kind of esophageal squamous cell carcinoma auxiliary diagnostic box, containing miR-20b-5p, miR-in serum miRNA in this test kit
The primer of one or more miRNA in 28-3p, miR-192-5p, miR-223-3p and miR-296-5p；It is preferably containing blood
In clear miRNA in miR-20b-5p, miR-28-3p, miR-192-5p, miR-223-3p and miR-296-5p two kinds or two kinds with
The primer of upper miRNA；More preferably contain miR-20b-5p, miR-28-3p, miR-192-5p, miR-in serum miRNA
The primer of five kinds of miRNA of 223-3p and miR-296-5p.
This test kit can also include round pcr common agents, such as reverse transcriptase, buffer, dNTPs, MgCl2, DEPC
Water and Taq enzyme etc.；Standard substance and/or reference substance can also be contained.
Serum miRNA marker miR-20b-5p relevant to oesophagus squama cancer diagnosis involved in the present invention, miR-28-
The sequence of every kind of miRNA in 3p, miR-192-5p, miR-223-3p and miR-296-5p is the most disclosed, but by each miRNA
Mark is combined needing those skilled in the art to pay creative work as esophageal squamous cell carcinoma auxiliary diagnosis marker.Respectively
The amplimer of miRNA marker all can be bought by market and obtain, the serum miRNA marker used in the embodiment of the present invention
Primer be purchased from synthesized by the Rui Bo company of Guangzhou produce specificity miRNA stem ring RT-PCR primer.
Specifically, the present invention solves the technical scheme of problem and includes: (1) sets up sample storehouse and the data of unified standard
Storehouse: gather standard compliant blood sample with S.O.P. (SOP), demographic data and clinic that systematic collection is complete provide
Material.(2) serum miRNA differential expression analysis of spectrum: analyze the serum of differential expression in esophageal squamous cell carcinoma and normal control population
MiRNA, and differential expression miRNAs is carried out the checking of further large sample multistage.(3) by multistage checking, this is specified
The ability of a little miRNA diagnosis esophageal squamous cell carcinomaes.(4) development of serum miRNA diagnostic kit: according to patients with esophageal squamous cell carcinoma with normal
Differential expression miRNA in crowd's serum develops miRNAs diagnostic kit, it is achieved examine the noinvasive auxiliary of patients with esophageal squamous cell carcinoma
Disconnected.(4) analyze these miRNA and in esophageal squamous cell carcinoma tissue and secrete outward the expression in body, disclose these miRNA and esophageal squamous cell
The relation of cancer, provides foundation for developing the medicine for the treatment of esophageal squamous cell carcinoma that may be relevant to these miRNA in the future.
The present inventor gathers standard compliant blood sample with S.O.P. (SOP), the population that systematic collection is complete
Data, clinical data, and have employed Exiqon miRNA qPCR panel chip and qRT-PCR method etc..
The experimental technique studied specifically mainly includes following components:
1. research samples selection: just control, row operation and chemicotherapy intervention and confirm as the trouble of esophageal squamous cell carcinoma through pathology
Person.Normal control is the normal population checked UP in hospital.
2.Exiqon miRNA qPCR panel chip primary dcreening operation: utilize TRIZOL-LS reagent that serum mixing sample is carried out
RNA extracts, and carries out qRT-PCR operation acquisition primary dcreening operation result.
3. training set, checking collection and additional authentication collection: utilize AM1556 test kit (ABI company) to each serum sample
Carry out RNA extraction, obtain cDNA sample by reverse transcription reaction, add PCR primer and SYBR Green fluorescent dye carries out PCR
Reaction.By the Ct value of comparison standard substance, draw the miRNA content in sample.
4. utilize RNA, ExoQuick test kit (the SBI public affairs that TRIZOL-LS reagent extracts in esophageal squamous cell carcinoma and cancer beside organism
Department) and AM1556 test kit (ABI company) extract and outer secrete the RNA in body, by the method for qRT-PCR, detection miRNA is organizing
The differential expression in body is secreted outside and.
5. statistical analysis: use χ2Inspection, paired t-test and nonparametric rank test are compared miRNA expression and are existed
Difference in different seminar.The diagnostic value of serum miRNA is confirmed by calculating ROC curve analysis.
Seminar of the present invention divides by the miRNA in the Peripheral Blood of esophageal squamous cell carcinoma patient carries out the expression of system at present
Analysis, it has now been found that one group 5 esophageal squamous cell carcinoma serum microRNA labels with clinical diagnosis potential (miR-20b-5p,
MiR-28-3p, miR-192-5p, miR-223-3p and miR-296-5p).
Beneficial effects of the present invention:
1. compared to traditional tumor markers, serum miRNA as novel biomarker, have good stability,
Wicresoft easily obtains, susceptiveness and the high feature of specificity.Developing for including tumor of this kind of molecular marker
The diagnosis of various diseases and further treatment provide new direction.
2. researcher passes through Exiqon miRNA qPCR panel chip and relative quantification method based on qRT-PCR, right
Differential expression miRNA in esophageal squamous cell carcinoma and normal control population's serum carries out checking tight, multistage and evaluation.Confirm
This group miRNA is as the reliability of noinvasive label of diagnosis esophageal squamous cell carcinoma and repeatability.
3. researcher find miR-20b-5p, miR-28-3p and miR-192-5p expression in esophageal squamous cell carcinoma tissue with
Expressing consistent in serum, miR-296-5p secretes the expression in body outside serum and is also above normal control simultaneously, it is shown that this
Close relation between group miRNA and esophageal squamous cell carcinoma.These results by these miRNA of future studies for the machine of esophageal squamous cell carcinoma
Make and for these miRNA, esophageal squamous cell carcinoma treated to the thinking providing new.
Accompanying drawing explanation
Fig. 1: experiment flow figure
Fig. 2: 5 miRNA of high expressed in esophageal squamous cell carcinoma serum
Fig. 3: the miRNA obtained is carried out ROC curve analysis
The intersection that A: training set collects with checking；B: training set；C: checking collection；D: external certificate collection.
Fig. 4: 5 miRNA expression in esophageal squamous cell carcinoma tissue
Fig. 5: 5 miRNA secrete the expression in body outside patients with esophageal squamous cell carcinoma serum
Detailed description of the invention
Inventor in 2013 to 2015 years from No.1 Attached Hospital, Nanjing Medical Univ and Changzhou First People's Hospital
Have collected the Venous serum sample of substantial amounts of patients with esophageal squamous cell carcinoma and normal Check-up crowd, by the arrangement to sample data, from
In have selected the sample of 200 example esophageal squamous cell carcinomaes and 188 example normal controls as Exiqon miRNA qPCR panel chip primary dcreening operation
Laboratory sample with follow-up a series of qRT-PCR checking.36 example esophageal squamous cell carcinoma tissue and 36 example cancer beside organisms are the most also left and taken.
Selected patients serum's sample standard deviation come from just control, row operation and chemicotherapy intervention and confirm as esophageal squamous cell carcinoma through pathology
Patient.And the system acquisition demographic data of these samples, clinical data.
With reference to flow chart (Fig. 1), from esophageal squamous cell carcinoma and normal control serum sample, 30 example esophageal squamous cells are randomly choosed
Cancer sample and 10 example normal controls, and it has been mixed into 3 example esophageal squamous cell carcinoma serum mixing sample and 1 normal aggregate sample respectively
This (mixing sample is converged the sample forming 2ml by 10 example 200ul serum samples).This 4 example mixing sample is carried out
Exiqon miRNA qPCR panel chip primary dcreening operation and analysis, concrete steps are with reference to Exiqon miRNA qPCR panel chip
Description:
1. serum extracting
Taking out blood serum sample, after sample thaws, 3000x g is centrifuged 5min and removes some fragments and some insoluble component.Transfer
250ul supernatant, in new 1.5ml pipe, after adding 750ul TRIZOL-LS, acutely shakes 5s.
2. two-phase laminated flow
After homogenate, sample hatches 5 minutes in 15 to 30 DEG C.The sample of the TRIZOL-LS reagent homogenate of every 1ml adds
The chloroform of 0.2ml, covers tightly lid.The most acutely vibration body is after 15 seconds, hatches 2 to 3 minutes for 15 to 30 DEG C.13,000g at 4 DEG C
Centrifugal 15 minutes.
3.RNA precipitates
Aqueous phase is transferred in new centrifuge tube.Aqueous phase mixes with isopropanol to precipitate RNA therein, adds the amount of isopropanol
For: the sample of 1ml TRIZOL-LS reagent homogenate adds the isopropanol of 0.5ml and the glycogen of 5ul.4 DEG C stand half an hour, allow
RNA separates out as far as possible.It is centrifuged 15 minutes in 4 DEG C of 13,000g.
4.RNA cleans
Remove supernatant, the sample of every 1ml TRIZOL-LS reagent homogenate add 75% (v/v) ethanol of at least 1ml,
Clean RNA precipitate.Standing 10 minutes, then 10000g is centrifuged 5 minutes at 4 DEG C.
The most again RNA precipitate is dissolved
Remove ethanol solution, air drying RNA precipitate 5-10 minute, add the water rifle without RNase and repeatedly blow and beat several
Secondary, then hatch 10 minutes for 55 to 60 DEG C.
6. measurement concentration:
Usually lead to～5 μ g RNA/50ml serum.
7.cDNA synthesizes
(1) dilution template ribonucleic acid: use DEPC water that 20-25ng template ribonucleic acid is diluted to 14ul (final concentration of 1.492-
1.786ng/μl)。
(2) reactant liquor is prepared: 5 × Reaction Buffer and DEPC water are placed in and are dissolved on ice, and shakes mixing.
Enzyme mix is placed in-20 DEG C of ice chests, flicks mixing and be placed on ice before using.Use after all reagent are all centrifugal.
(3) configuration reactant liquor: the reactant liquor in configuration following table
(4) mix and be centrifuged reagent: centrifugal, to ensure that all solution is thoroughly mixed after shaking or aspirating mixing reactant liquor
Uniformly.
(5) reverse transcription reaction and heat inactivation: by reactant liquor after 42 DEG C of incubations 60 minutes, in 95 DEG C of incubations 5 minutes to lose
Reverse transcriptase alive.
8.Real-Time PCR
Reagent:
Nuclease free water(Exiqon)
SYBRTM Green master mix(Exiqon)
CDNA template
ROX(Invitrogen)
miRNA PCR ARRAY(Exiqon)
Instrument:
ABI PRISM7900system(Applied Biosystems)
(1) Real-time PCR reagent is prepared: by the cDNA template of preparation, DEPC water and SYBRTM Green master
Mix is placed in and dissolves 15-20 minute on ice.
(2) dilution cDNA template: cDNA template nuclease free water RT reaction obtained dilutes 110 times
(such as, in 20 μ l reactant liquors, adding 2180ul nuclease free water).
(3) all reaction reagents are mixed:
A., after PCR plate being simply centrifuged, sealer is removed.
B. the cDNA template that 110 times dilute is mixed according to 1:1 volume ratio with 2 × SYBR Green master mix.
C. it is inverted mixing reactant liquor and is centrifuged
D. mixed reaction solution is added each hole in plate
The most again PCR plate is sealed
(4) PCR plate simple, low temperature is centrifuged
(5) Real-time PCR amplification: carry out Real-time PCR amplification and dissolving according to the reaction condition in following table
Tracing analysis.
Real-time PCR cycle condition such as following table:
Data analysis: use Δ Δ Ct method
The subsidiary software of PCR instrument device is used to carry out primary data analysis, it is thus achieved that and original Cq value (Cp or Ct, according to instrument not
May be different with title).
It is proposed that use GenEx qPCR to analyze software (www.exiqon.com/mirna-pcr-analysis) logarithm
According to carrying out standard and deep data analysis.
A. the Δ Ct of each passageway related genes in each process group is calculated.
Δ Ct (group 1)=average Ct average of HK genes ' Ct for group 1array
Δ Ct (group 2)=average Ct average of HK genes ' Ct for group 2array
B. the Δ Δ Ct of each gene in 2 PCR Array (or two groups) is calculated.
Δ Δ Ct=Δ Ct (group 2)-Δ Ct (group 1)
Remarks: generally group 1 is comparison, and group 2 is experimental group.
C. by the differential expression of 2-Δ Δ Ct calculating group 2 with group 1 corresponding gene.
36 differential expression miRNA (3 esophageal squamous cell carcinoma serum aggregate samples after chip primary dcreening operation, in having obtained such as following table
1.5 times of differences have been above it relative to normal sample) in Ben.
36 the differential expression miRNA obtained for primary dcreening operation, by training set, checking collection and additional authentication collection, use base
Relative quantification method in qRT-PCR is verified, concretely comprises the following steps:
1. serum RNA extracts: selecting ABI company serum RNA to extract test kit (AM1556), reference reagent box illustrates, often
Individual sample is drawn 200ul and is carried out extracting RNA, and finally dissolves with 100ul DEPC water.
The preparation of 2.cDNA:
1) 50 μ L reaction systems are used to carry out reverse transcription experiment
Above reaction system mixes, and after brief centrifugation, reacts with follow procedure:
2) again reaction system adds following reactant after above-mentioned reaction
3.qPCR
1) use 5 μ L reaction systems, test in the following proportions
Reaction system mixes, and after brief centrifugation, is positioned in real-time PCR, reacts with follow procedure:
Reaction adds solubility curve after terminating.
Data analysis: the relative concentration of the miRNA obtained in each sample can be calculated by Δ Δ Ct method.Utilize
SPSS16.0 software carries out statistical analysis, has obtained one group and has all been unanimously in esophageal squamous cell carcinoma serum height in training set and checking concentration
5 miRNA:miR-20b-5p, miR-28-3p, miR-192-5p, miR-223-3p and miR-296-5p expressing are (in training
P value both less than 0.05, Fig. 2 is concentrated in collection and checking).By these 5 miRNA, the ROC curve of each sample can be calculated.Such as figure
3, the molecular marker of these 5 miRNA compositions can be good at distinguishing patients with esophageal squamous cell carcinoma and normal population.
Have detected these 5 miRNA after seminar further and secrete the expression of body in esophageal squamous cell carcinoma tissue and serum China and foreign countries,
Esophageal squamous cell carcinoma tissue is extracted RNA and is utilized TRIZOL, and secrete outward body extracting test kit is ExoQuick test kit (SBI company).200ul
Serum extracted outer secrete body 200ul DEPC water resuspended after, utilize AM1556 test kit (ABI company) externally to secrete body RNA
Extracting, step extracts process with serum RNA.
Using non parametric tests to analyze to find, miR-20b-5p, miR-28-3p and miR-192-5p are in esophageal squamous cell carcinoma tissue
In expression be higher than cancer beside organism (Fig. 4).MiR-296-5p secrete outside esophageal squamous cell carcinoma serum the expression in body also apparently higher than
Normal population (Fig. 5).
Test kit includes a collection of serum miRNA qRT-PCR primer, it is also possible to have the conventional examination needed for corresponding round pcr
Agent, such as: reverse transcriptase, buffer, dNTPs, MgCl2, DEPC water, fluorescent probe, RNase inhibitor, Taq enzyme etc., can basis
The concrete experimental technique used is selected, and these common agents are all well known to those skilled in the art, it can in addition contain there is standard
Product and comparison (such as normal person's sample etc. of quantitative markization).The value of this test kit is to have only to serum without other group
Tissue samples, by the expression contents of miRNA in the Fluorometric assay serum sample simplified most, assists this samples sources of diagnosis to suffer from
The probability suffering from esophageal squamous cell carcinoma of person.Serum miRNA is easy to detect, and quantitatively accurate, is greatly improved the sensitivity of medical diagnosis on disease
Property and specificity, therefore this test kit is put into practice, can help to instruct diagnosis and further individualized treatment.
Claims (9)
1. a serum miRNA marker relevant to esophageal squamous cell carcinoma auxiliary diagnosis, it is characterised in that this serum miRNA marker
For one or more in miR-20b-5p, miR-28-3p, miR-192-5p, miR-223-3p and miR-296-5p.
Serum miRNA marker the most according to claim 1, it is characterised in that this serum miRNA marker is miR-
Two or more combination in 20b-5p, miR-28-3p, miR-192-5p, miR-223-3p and miR-296-5p, preferably
The group formed by five kinds of miRNA of miR-20b-5p, miR-28-3p, miR-192-5p, miR-223-3p and miR-296-5p
Close.
3. the application in auxiliary diagnosis esophageal squamous cell carcinoma of the serum miRNA marker described in claim 1 or 2.
4. the serum miRNA marker described in claim 1 or 2 is at preparation esophageal squamous cell carcinoma auxiliary diagnostic box or treatment esophagus
Application in scale cancer medicine.
5. the primer of a serum miRNA marker relevant to esophageal squamous cell carcinoma auxiliary diagnosis, it is characterised in that this primer comprises
One or more miRNA in miR-20b-5p, miR-28-3p, miR-192-5p, miR-223-3p and miR-296-5p draw
Thing；Preferably comprise miR-20b-5p, miR-28-3p, miR-192-5p, miR-223-3p and miR-296-in serum miRNA
The primer of two or more miRNA in 5p；More preferably comprise miR-20b-5p, miR-28-in serum miRNA
The primer of five kinds of miRNA of 3p, miR-192-5p, miR-223-3p and miR-296-5p.
6. the answering in auxiliary diagnosis esophageal squamous cell carcinoma or preparation esophageal squamous cell carcinoma auxiliary diagnostic box of the primer described in claim 5
With.
7. an esophageal squamous cell carcinoma auxiliary diagnostic box, it is characterised in that this test kit be used for detecting serum miR-20b-5p,
One or more miRNA in miR-28-3p, miR-192-5p, miR-223-3p and miR-296-5p；It is preferably used for detection
In serum miR-20b-5p, miR-28-3p, miR-192-5p, miR-223-3p and miR-296-5p two or more
miRNA；More preferably for detecting miR-20b-5p, miR-28-3p, miR-192-5p, the miR-223-3p in serum
With five kinds of miRNA of miR-296-5p.
8. an esophageal squamous cell carcinoma auxiliary diagnostic box, it is characterised in that containing miR-20b-in serum miRNA in this test kit
The primer of one or more miRNA in 5p, miR-28-3p, miR-192-5p, miR-223-3p and miR-296-5p；Preferably
For containing in miR-20b-5p, miR-28-3p, miR-192-5p, miR-223-3p and miR-296-5p in serum miRNA two kinds
Or the primer of two or more miRNA；More preferably contain miR-20b-5p, miR-28-3p, miR-in serum miRNA
The primer of five kinds of miRNA of 192-5p, miR-223-3p and miR-296-5p.
9. according to the diagnostic kit described in claim 7 or 8, it is characterised in that this test kit also including, round pcr is commonly used
Reagent.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610723653.1A CN106119392B (en) | 2016-08-25 | 2016-08-25 | Serum miRNA marker related to esophageal squamous carcinoma auxiliary diagnosis and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610723653.1A CN106119392B (en) | 2016-08-25 | 2016-08-25 | Serum miRNA marker related to esophageal squamous carcinoma auxiliary diagnosis and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106119392A true CN106119392A (en) | 2016-11-16 |
| CN106119392B CN106119392B (en) | 2019-12-31 |
Family
ID=57275202
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610723653.1A Active CN106119392B (en) | 2016-08-25 | 2016-08-25 | Serum miRNA marker related to esophageal squamous carcinoma auxiliary diagnosis and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106119392B (en) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109825575A (en) * | 2019-04-08 | 2019-05-31 | 首都医科大学附属北京胸科医院 | Auxiliary diagnosis miRNA marker lungy and its application |
| CN110283912A (en) * | 2019-07-18 | 2019-09-27 | 暨南大学 | Application of the has-miR-3656 as esophageal squamous cell carcinoma molecular marker |
| CN110716044A (en) * | 2019-10-23 | 2020-01-21 | 郑州大学 | Serum protein marker, kit and detection method for early screening and diagnosis of esophageal squamous carcinoma |
| CN111733234A (en) * | 2019-03-25 | 2020-10-02 | 深圳大学 | Esophageal cancer molecular marker and application thereof |
| CN112410428A (en) * | 2020-11-19 | 2021-02-26 | 中国医学科学院肿瘤医院 | Application of microRNA molecule in diagnosis and treatment of T1 stage esophageal squamous carcinoma lymph node metastasis |
| WO2021159562A1 (en) * | 2020-02-13 | 2021-08-19 | 朱伟 | Circulating mirna and carcino-embryonic mirna marker related to pan-tumor auxiliary diagnosis, and use thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101861401A (en) * | 2007-10-11 | 2010-10-13 | 俄亥俄州立大学研究基金会 | Methods and compositions for the diagnosis and treatment of esphageal adenocarcinomas |
| WO2012012689A2 (en) * | 2010-07-22 | 2012-01-26 | The Johns Hopkins University | Circulating micrornas are biomarkers of various diseases |
| WO2015194627A1 (en) * | 2014-06-18 | 2015-12-23 | 東レ株式会社 | Esophageal cancer detection kit or device, and detection method |
-
2016
- 2016-08-25 CN CN201610723653.1A patent/CN106119392B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101861401A (en) * | 2007-10-11 | 2010-10-13 | 俄亥俄州立大学研究基金会 | Methods and compositions for the diagnosis and treatment of esphageal adenocarcinomas |
| WO2012012689A2 (en) * | 2010-07-22 | 2012-01-26 | The Johns Hopkins University | Circulating micrornas are biomarkers of various diseases |
| WO2015194627A1 (en) * | 2014-06-18 | 2015-12-23 | 東レ株式会社 | Esophageal cancer detection kit or device, and detection method |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111733234A (en) * | 2019-03-25 | 2020-10-02 | 深圳大学 | Esophageal cancer molecular marker and application thereof |
| CN109825575A (en) * | 2019-04-08 | 2019-05-31 | 首都医科大学附属北京胸科医院 | Auxiliary diagnosis miRNA marker lungy and its application |
| CN110283912A (en) * | 2019-07-18 | 2019-09-27 | 暨南大学 | Application of the has-miR-3656 as esophageal squamous cell carcinoma molecular marker |
| CN110716044A (en) * | 2019-10-23 | 2020-01-21 | 郑州大学 | Serum protein marker, kit and detection method for early screening and diagnosis of esophageal squamous carcinoma |
| CN110716044B (en) * | 2019-10-23 | 2023-04-18 | 郑州大学 | Serum protein marker, kit and detection method for early screening and diagnosis of esophageal squamous carcinoma |
| WO2021159562A1 (en) * | 2020-02-13 | 2021-08-19 | 朱伟 | Circulating mirna and carcino-embryonic mirna marker related to pan-tumor auxiliary diagnosis, and use thereof |
| CN112410428A (en) * | 2020-11-19 | 2021-02-26 | 中国医学科学院肿瘤医院 | Application of microRNA molecule in diagnosis and treatment of T1 stage esophageal squamous carcinoma lymph node metastasis |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106119392B (en) | 2019-12-31 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106119392A (en) | A kind of serum miRNA marker relevant to esophageal squamous cell carcinoma auxiliary diagnosis and application thereof | |
| CN108103198B (en) | One kind blood plasma miRNA marker relevant to cancer of pancreas auxiliary diagnosis and its application | |
| CN106119393A (en) | A kind of blood plasma miRNA mark relevant to esophageal squamous cell carcinoma auxiliary diagnosis and application thereof | |
| CN108624695B (en) | One kind circulation miRNA marker relevant to thyroid papillary carcinoma auxiliary diagnosis and its application | |
| CN105950753B (en) | One kind blood plasma miRNA marker relevant to adenocarcinoma of lung auxiliary diagnosis and its application | |
| CN105603101B (en) | Detect application of the system of 8 miRNA expression quantity in diagnosis or auxiliary diagnosis of hepatoma product is prepared | |
| CN109609633A (en) | One kind serum miRNA marker relevant to Computer-aided Diagnosis of Breast Cancer and its application | |
| CN108441552B (en) | One kind serum/plasma miRNA marker relevant to intrahepatic cholestasis of pregnancy auxiliary diagnosis and its application | |
| CN109055557A (en) | One kind serum miRNA marker relevant to cancer of pancreas auxiliary diagnosis and its application | |
| CN105861672A (en) | Detection kit and detection method for methylation of septin9 gene in human peripheral blood cell-free DNA | |
| CN108624691A (en) | A kind of marker and its application for judging prostatic disorders | |
| CN108531586A (en) | A kind of relevant cycle miRNA marker and its application on X chromosome of and Computer-aided Diagnosis of Breast Cancer | |
| CN109609634A (en) | One kind circulation miRNA marker relevant to carcinoma of endometrium auxiliary diagnosis and its application | |
| CN108950003A (en) | It is a kind of for the miRNA marker of Diagnosis of Breast cancer and its application of miRNA | |
| CN105925703A (en) | Method for screening miRNA markers in PB (peripheral blood) of kidney cancer and kidney cancer diagnosis marker miR-210 | |
| CN109593851A (en) | One kind blood plasma miRNA marker relevant to Computer-aided Diagnosis of Breast Cancer and its application | |
| CN109593852B (en) | Serum miRNA marker related to nasopharyngeal carcinoma auxiliary diagnosis and application thereof | |
| CN106086178A (en) | A kind of serum miRNA marker relevant to gastric cancer auxiliary diagnosis and application thereof | |
| CN108103199A (en) | A kind of Xun Huan miRNA marker relevant with oophoroma auxiliary diagnosis and its application | |
| CN108929910A (en) | One kind serum miRNA marker relevant to adenocarcinoma of lung auxiliary diagnosis and its application | |
| CN106350582A (en) | Serum miRNA marker related to auxiliary diagnosis for squamous lung cell carcinoma and application thereof | |
| CN106367477A (en) | Serum miRNA marker related to auxiliary diagnosis of colorectal cancer, and application thereof | |
| CN106086226A (en) | A kind of blood plasma miRNA mark relevant to IgA nephropathy auxiliary diagnosis and application thereof | |
| CN107723365B (en) | One kind blood plasma miRNA marker relevant to lung squamous cancer auxiliary diagnosis and its application | |
| CN107746886B (en) | One kind blood plasma miRNA marker relevant to colorectal cancer auxiliary diagnosis and its application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |