CN106086226A - A kind of blood plasma miRNA mark relevant to IgA nephropathy auxiliary diagnosis and application thereof - Google Patents

A kind of blood plasma miRNA mark relevant to IgA nephropathy auxiliary diagnosis and application thereof Download PDF

Info

Publication number
CN106086226A
CN106086226A CN201610726380.6A CN201610726380A CN106086226A CN 106086226 A CN106086226 A CN 106086226A CN 201610726380 A CN201610726380 A CN 201610726380A CN 106086226 A CN106086226 A CN 106086226A
Authority
CN
China
Prior art keywords
mir
mirna
blood plasma
iga nephropathy
primer
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201610726380.6A
Other languages
Chinese (zh)
Other versions
CN106086226B (en
Inventor
朱伟
周鑫
单霞
齐炼文
黄泽波
王同杉
吴晶晶
朱明霞
王魏魏
陈彦
邢昌赢
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Individual
Original Assignee
Individual
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Individual filed Critical Individual
Priority to CN201610726380.6A priority Critical patent/CN106086226B/en
Publication of CN106086226A publication Critical patent/CN106086226A/en
Application granted granted Critical
Publication of CN106086226B publication Critical patent/CN106086226B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Pathology (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention discloses a kind of blood plasma miRNA mark relevant to IgA nephropathy auxiliary diagnosis and application thereof, and this mark is one or more in miR 148a 3p, miR 150 5p, miR 20a 5p and miR 425 3p.Blood plasma miRNA as novel biomarker, has good stability, Wicresoft easily obtains, susceptiveness and the high feature of specificity.This kind of molecular marker develop by for the various diseases including IgA nephropathy diagnosis and further treatment new direction is provided.This research draws have the IgA nephropathy blood plasma miRNA label of clinical diagnosis potential by more targeted.Research confirms that this group miRNA is as the reliability of the noinvasive label of diagnosis of iga nephropathy and repeatability.

Description

A kind of blood plasma miRNA mark relevant to IgA nephropathy auxiliary diagnosis and application thereof
Technical field
The invention belongs to genetic engineering nephrology field, relate to a kind of blood plasma relevant to IgA nephropathy auxiliary diagnosis MiRNA marker and application thereof.
Background technology
IgA nephropathy (Immunoglobulin A nephropathy, IgAN) is modal primary glomerulonephritis, Feature is mesangial cell proliferation, and substrate increases, and accompanies extensive IgA to deposit.Current IgA nephropathy must confirm through Renal biospy can Diagnosis.But Renal biospy is a kind of invasive inspection method, it is impossible to be repeated at same patient.IgA nephropathy is in early days Diagnosis prognosis bona, but the course of disease was more than 20 years, and the patient having more than 40% enters irreversible end-stage renal failure.Therefore, non- Early diagnosis IgA nephropathy clinically is significant by the discovery of invasive biomarker.
Microrna (miRNAs) is the class length little non-coding RNA molecule at the nucleotide of about 22, and it is by turning The various vital movement processes of wide participation are regulated and controled after record.Research finds, the expression of miRNA has in various degree in IgA nephropathy Upper mediation lower, and miRNA easily obtains, and existence form is the most stable, and can resist the dissolution of nucleic acid in vivo enzyme, Can lay a good foundation as a kind of emerging mark for it.But due to research method and the difference of including crowd in, cause grinding Study carefully result not quite identical.Currently also there is no the consistent method being suitable for miRNA detection clinically.
This research and utilization Exiqon miRNA qPCR panel chip and relative quantification method based on qRT-PCR, pass through Research to the IgA nephropathy blood plasma of large sample, it is intended to find the blood plasma miRNA that IgA nephropathy is had potential diagnostic value.If root The diagnostic kit of IgA nephropathy it is directed to, it will promoting the treatment level of China's IgA nephropathy, being also will according to this kind of miRNA design To provide thinking to the research further of IgA nephropathy.
Summary of the invention
It is an object of the invention to provide a kind of blood plasma miRNA mark relevant to IgA nephropathy auxiliary diagnosis.
Another object of the present invention is to provide above-mentioned blood plasma miRNA mark and primer thereof preparing IgA nephropathy auxiliary Diagnostic kit and the application in the medicine of preparation treatment IgA nephropathy.
A further object of the present invention is to provide the test kit diagnosing for IgA nephropathy auxiliary and treating and medicine.
The purpose of the present invention can be achieved through the following technical solutions:
A kind of blood plasma miRNA mark relevant to IgA nephropathy auxiliary diagnosis, this blood plasma miRNA mark is miR- 148a-3p (UCAGUGCACUACAGAACUUUGU), miR-150-5p (UCUCCCAACCCUUGUACCAGUG), miR-20a-5p (UAAAGUGCUUAUAGUGCAGGUAG) one or more and in miR-425-3p (AUCGGGAAUGUCGUGUCCGCCC). This blood plasma miRNA mark be preferably in miR-148a-3p, miR-150-5p, miR-20a-5p and miR-425-3p two kinds or Two or more combinations, more preferably miR-148a-3p, miR-150-5p, miR-20a-5p and miR-425-3p tetra-kinds The combination that miRNA is formed.
The application in auxiliary diagnosis of iga nephropathy of the above-mentioned blood plasma miRNA mark.
Above-mentioned blood plasma miRNA mark is in preparing IgA nephropathy auxiliary diagnostic box or treatment IgA nephropathy medicine Application.
The primer of a kind of blood plasma miRNA mark relevant to IgA nephropathy auxiliary diagnosis, this primer comprises miR-148a- The primer of one or more miRNA in 3p, miR-150-5p, miR-20a-5p and miR-425-3p；Preferably comprise blood plasma The drawing of two or more miRNA in miR-148a-3p, miR-150-5p, miR-20a-5p and miR-425-3p in miRNA Thing；More preferably comprise tetra-kinds of miRNA of blood plasma miR-148a-3p, miR-150-5p, miR-20a-5p and miR-425-3p Primer.
Above-mentioned primer is in auxiliary diagnosis of iga nephropathy or prepares the application in IgA nephropathy auxiliary diagnostic box.
A kind of IgA nephropathy auxiliary diagnostic box, this test kit is used for detecting blood plasma miR-148a-3p, miR-150-5p, One or more miRNA in miR-20a-5p and miR-425-3p；It is preferably used for detecting blood plasma miR-148a-3p, miR- Two or more miRNA in 150-5p, miR-20a-5p and miR-425-3p；More preferably it is used for detecting blood plasma Tetra-kinds of miRNA of miR-148a-3p, miR-150-5p, miR-20a-5p and miR-425-3p in miRNA.
A kind of IgA nephropathy auxiliary diagnostic box, containing miR-148a-3p, miR-in blood plasma miRNA in this test kit The primer of one or more miRNA in 150-5p, miR-20a-5p and miR-425-3p；It is preferably containing in blood plasma miRNA The primer of two or more miRNA in miR-148a-3p, miR-150-5p, miR-20a-5p and miR-425-3p；Enter one Step is preferably containing tetra-kinds of miRNA of miR-148a-3p, miR-150-5p, miR-20a-5p and miR-425-3p in blood plasma miRNA Primer.
This test kit can also include round pcr common agents, such as reverse transcriptase, buffer, dNTPs, MgCl2, DEPC Water and Taq enzyme etc.；Standard substance and/or reference substance can also be contained.
The blood plasma miRNA mark miR-148a-3p, miR-150-relevant to IgA nephropathy diagnosis involved in the present invention The sequence of every kind of miRNA in 5p, miR-20a-5p and miR-425-3p is the most disclosed, but by independent for each miRNA marker It is combined needing those skilled in the art to pay creative work as IgA nephropathy auxiliary diagnosis marker.Each miRNA indicates The amplimer of thing all can be bought by market and obtain, and the primer of the blood plasma miRNA mark used in the embodiment of the present invention is Purchased from the specificity miRNA stem ring RT-PCR primer produced synthesized by the Rui Bo company of Guangzhou.
Specifically, the present invention solves the technical scheme of problem and includes: (1) sets up sample storehouse and the data of unified standard Storehouse: gather standard compliant blood sample with S.O.P. (SOP), demographic data and clinic that systematic collection is complete provide Material.(2) blood plasma miRNA differential expression analysis of spectrum: analyze the blood plasma miRNA of differential expression in IgA nephropathy and normal control population, And differential expression miRNAs is carried out the checking of further large sample multistage.(3) by multistage checking, these are specified The ability of miRNA diagnosis of iga nephropathy.(4) development of blood plasma miRNA diagnostic kit: according to IgA nephropathy patient and normal population Differential expression miRNA in blood plasma develops miRNAs diagnostic kit, it is achieved the noinvasive of IgA nephropathy patient is assisted diagnosis.(4) Analyze these miRNA expression in IgA nephropathy patients blood plasma, disclose the relation of these miRNA and IgA nephropathy, for inciting somebody to action The medicine developing treatment IgA nephropathy that may be relevant to these miRNA provides foundation.
The present inventor gathers standard compliant blood sample with S.O.P. (SOP), the population that systematic collection is complete Data, clinical data, and have employed Exiqon miRNA qPCR panel chip and qRT-PCR method etc..
The experimental technique studied specifically mainly includes following components:
1. research samples selection: confirm as the patient of IgA nephropathy through pathology.Normal control is just to check UP in hospital Ordinary person group.
2.Exiqon miRNA qPCR panel chip primary dcreening operation: utilize TRIZOL-LS reagent that blood plasma mixing sample is carried out RNA extracts, and carries out qRT-PCR operation acquisition primary dcreening operation result.
3. training set, checking collection: utilize AM1556 test kit (ABI company) that each plasma sample is carried out RNA extraction is logical Cross reverse transcription reaction and obtain cDNA sample, add PCR primer and SYBR Green fluorescent dye carries out PCR reaction.Pass through comparison The Ct value of standard substance, draws the miRNA content in sample.
4. statistical analysis: use χ2Inspection, paired t-test and nonparametric rank test are compared miRNA expression and are existed Difference in different seminar.The diagnostic value of blood plasma miRNA is confirmed by calculating ROC curve analysis.
The expression that seminar of the present invention carries out system by the miRNA in the periphery blood plasma to IgA nephropathy patient at present divides Analysis, it has now been found that one group 4 IgA nephropathy blood plasma microRNA labels with clinical diagnosis potential (miR-148a-3p, MiR-150-5p, miR-20a-5p and miR-425-3p).
Beneficial effects of the present invention:
1. the mark compared to traditional IgAN, blood plasma miRNA, as novel biomarker, has stability Good, Wicresoft easily obtains, susceptiveness and the high feature of specificity.The exploitation of this kind of molecular marker will be for including IgAN Various diseases diagnosis and further treatment new direction is provided.
2. researcher passes through Exiqon miRNA qPCR panel chip and relative quantification method based on qRT-PCR, right Differential expression miRNA in IgAN and normal control population's blood plasma carries out checking tight, multistage and evaluation.Confirm this group MiRNA is as the reliability of the noinvasive label of diagnosis of iga nephropathy and repeatability.
3. researcher finds that miR-148a-3p, miR-150-5p, miR-20a-5p and miR-425-3p are at I level IgA nephropathy Expression in (according to Lee classification) patient is apparently higher than the IgA nephropathy patient of II-V level.Show that this group miRNA is to early stage IgA Diagnosis of nephropathy is worth higher.These results by these miRNA of future studies for the mechanism of IgA nephropathy and for these MiRNA treats the thinking providing new for IgA nephropathy.
Accompanying drawing explanation
Fig. 1: experiment flow figure.
Fig. 2: 4 miRNA of high expressed in IgA nephropathy blood plasma.
Fig. 3: the miRNA obtained is carried out ROC curve analysis.
A: training set；B: checking collection；The intersection that c: training set collects with checking.
Fig. 4: 4 miRNA are carried out ROC curve analysis at the IgA nephropathy of different Lee classifications.
A:IgAN I level；B:IgAN II level；C:IgAN III level；D:IgAN IV-V level.
Detailed description of the invention
Inventor have collected substantial amounts of IgA nephropathy in 2013 to 2015 years from No.1 Attached Hospital, Nanjing Medical Univ and suffers from The venous plasma sample of person and normal Check-up crowd, by the arrangement to sample data, therefrom have finally chosen 83 example IgA nephropathy Test as Exiqon miRNA qPCR panel chip primary dcreening operation and follow-up a series of qRT-PCR with the sample of 82 example normal controls The laboratory sample of card.Selected patients blood plasma's sample standard deviation confirms as the patient of IgA nephropathy through pathology.And system acquisition these The demographic data of sample, clinical data.
With reference to flow chart (Fig. 1), from IgA nephropathy and normal control plasma sample, 20 example IgA nephropathy are randomly choosed Sample and 10 example normal controls, and it has been mixed into 2 example IgA nephropathy blood plasma mixing sample and 1 normal mixing sample respectively (mixing sample is converged the sample forming 2ml by 10 example 200ul plasma samples).This 3 example mixing sample is carried out Exiqon MiRNA qPCR panel chip primary dcreening operation and analysis, concrete steps are with reference to the explanation of Exiqon miRNA qPCR panel chip Book:
1. blood plasma extracting
Taking out plasma sample, after sample thaws, 3000x g is centrifuged 5min and removes some fragments and some insoluble component.Transfer 250ul supernatant, in new 1.5ml pipe, after adding 750ul TRIZOL-LS, acutely shakes 5s.
2. two-phase laminated flow
After homogenate, sample hatches 5 minutes in 15 to 30 DEG C.The sample of the TRIZOL-LS reagent homogenate of every 1ml adds The chloroform of 0.2ml, covers tightly lid.The most acutely vibration body is after 15 seconds, hatches 2 to 3 minutes for 15 to 30 DEG C.13,000g at 4 DEG C Centrifugal 15 minutes.
3.RNA precipitates
Aqueous phase is transferred in new centrifuge tube.Aqueous phase mixes with isopropanol to precipitate RNA therein, adds the amount of isopropanol For: the sample of 1ml TRIZOL-LS reagent homogenate adds the isopropanol of 0.5ml and the glycogen of 5ul.4 DEG C stand half an hour, allow RNA separates out as far as possible.It is centrifuged 15 minutes in 4 DEG C of 13,000g.
4.RNA cleans
Remove supernatant, the sample of every 1ml TRIZOL-LS reagent homogenate add 75% (v/v) ethanol of at least 1ml, Clean RNA precipitate.Standing 10 minutes, then 10000g is centrifuged 5 minutes at 4 DEG C.
The most again RNA precipitate is dissolved
Remove ethanol solution, air drying RNA precipitate 5-10 minute, add the water rifle without RNase and repeatedly blow and beat several Secondary, then hatch 10 minutes for 55 to 60 DEG C.
6. measurement concentration:
Usually lead to～5 μ g RNA/50ml blood plasma.
7.cDNA synthesizes
(1) dilution template ribonucleic acid: use DEPC water that 20-25ng template ribonucleic acid is diluted to 14ul (final concentration of 1.492- 1.786ng/μl)。
(2) reactant liquor is prepared: 5 × Reaction Buffer and DEPC water are placed in and are dissolved on ice, and shakes mixing. Enzyme mix is placed in-20 DEG C of ice chests, flicks mixing and be placed on ice before using.Use after all reagent are all centrifugal.
(3) configuration reactant liquor: the reactant liquor in configuration following table
(4) mix and be centrifuged reagent: centrifugal, to ensure that all solution is thoroughly mixed after shaking or aspirating mixing reactant liquor Uniformly.
(5) reverse transcription reaction and heat inactivation: by reactant liquor after 42 DEG C of incubations 60 minutes, in 95 DEG C of incubations 5 minutes to lose Reverse transcriptase alive.
8.Real-Time PCR
Reagent:
Nuclease free water(Exiqon)
SYBRTM Green master mix(Exiqon)
CDNA template
ROX(Invitrogen)
miRNA PCR ARRAY(Exiqon)
Instrument:
ABI PRISM7900system(Applied Biosystems)
(1) Real-time PCR reagent is prepared: by the cDNA template of preparation, DEPC water and SYBRTM Green master Mix is placed in and dissolves 15-20 minute on ice.
(2) dilution cDNA template: cDNA template nuclease free water RT reaction obtained dilutes 110 times (such as, in 20 μ l reactant liquors, adding 2180ul nuclease free water).
(3) all reaction reagents are mixed:
A., after PCR plate being simply centrifuged, sealer is removed.
B. the cDNA template that 110 times dilute is mixed according to 1:1 volume ratio with 2 × SYBR Green master mix.
C. it is inverted mixing reactant liquor and is centrifuged
D. mixed reaction solution is added each hole in plate
The most again PCR plate is sealed
(4) PCR plate simple, low temperature is centrifuged
(5) Real-time PCR amplification: carry out Real-time PCR amplification and dissolving according to the reaction condition in following table Tracing analysis.
Real-time PCR cycle condition such as following table:
Data analysis: use Δ Δ Ct method
The subsidiary software of PCR instrument device is used to carry out primary data analysis, it is thus achieved that and original Cq value (Cp or Ct, according to instrument not May be different with title).
It is proposed that use GenEx qPCR to analyze software (www.exiqon.com/mirna-pcr-analysis) logarithm According to carrying out standard and deep data analysis.
A. the Δ Ct of each passageway related genes in each process group is calculated.
Δ Ct (group 1)=average Ct average of HK genes ' Ct for group 1array
Δ Ct (group 2)=average Ct average of HK genes ' Ct for group 2array
B. the Δ Δ Ct of each gene in 2 PCR Array (or two groups) is calculated.
Δ Δ Ct=Δ Ct (group 2)-Δ Ct (group 1)
Remarks: generally group 1 is comparison, and group 2 is experimental group.
C. by 2-ΔΔCtCalculating group 2 and the differential expression organizing 1 corresponding gene.
48 differential expression miRNA (2 IgA nephropathy blood plasma mixing samples after chip primary dcreening operation, in having obtained such as following table In be above 1.5 times of differences relative to normal sample).
48 the differential expression miRNA obtained for primary dcreening operation, by training set and checking collection, use based on qRT-PCR Relative quantification method is verified, concretely comprises the following steps:
1. blood plasma RNA extracts: selecting ABI company blood plasma RNA to extract test kit (AM1556), reference reagent box illustrates, often Individual sample is drawn 200ul and is carried out extracting RNA, and finally dissolves with 100ul DEPC water.
The preparation of 2.cDNA:
1) 50 μ L reaction systems are used to carry out reverse transcription experiment
Above reaction system mixes, and after brief centrifugation, reacts with follow procedure:
2) again reaction system adds following reactant after above-mentioned reaction
3.qPCR
1) use 5 μ L reaction systems, test in the following proportions
Reaction system mixes, and after brief centrifugation, is positioned in real-time PCR, reacts with follow procedure:
Reaction adds solubility curve after terminating.
Data analysis: utilize SPSS 16.0 software to carry out statistical analysis, has obtained one group and has concentrated all in training set and checking It is unanimously to 4 miRNA:miR-148a-3p, miR-150-5p, miR-20a-5p and miR-of high expressed in IgA nephropathy blood plasma 425-3p (4 miRNA expression in IgAN patient apparently higher than Normal group, P < 0.05, Fig. 2).To obtained MiRNA carries out ROC curve analysis (P value is both less than 0.05, Fig. 3 in training set, checking collection and both intersection), these 4 The molecular marker of miRNA composition can be good at distinguishing IgA nephropathy patient and normal population.And analyzed by subgroup, send out These 4 the miRNA existing IgA nephropathy patient (figure expressed apparently higher than II-V level in the IgA nephropathy patient of Lee classification I level 4)。
Test kit includes a collection of blood plasma miRNA qRT-PCR primer, it is also possible to have the conventional examination needed for corresponding round pcr Agent, such as: reverse transcriptase, buffer, dNTPs, MgCl2, DEPC water, fluorescent probe, RNase inhibitor, Taq enzyme etc., can basis The concrete experimental technique used is selected, and these common agents are all well known to those skilled in the art, it can in addition contain there is standard Product and comparison (such as normal person's sample etc. of quantitative markization).The value of this test kit is to have only to blood plasma without other group Tissue samples, by the expression contents of miRNA in the Fluorometric assay plasma sample simplified most, assists this samples sources of diagnosis to suffer from The probability suffering from IgA nephropathy of person.Blood plasma miRNA is easy to detect, and quantitatively accurate, is greatly improved the sensitivity of medical diagnosis on disease And specificity, therefore this test kit is put into practice, can help to instruct diagnosis and further individualized treatment.

Claims (9)

1. a blood plasma miRNA mark relevant to IgA nephropathy auxiliary diagnosis, it is characterised in that this blood plasma miRNA mark For one or more in miR-148a-3p, miR-150-5p, miR-20a-5p and miR-425-3p.
Blood plasma miRNA mark the most according to claim 1, it is characterised in that this blood plasma miRNA mark is miR- Two or more combination, preferably miR-in 148a-3p, miR-150-5p, miR-20a-5p and miR-425-3p The combination that tetra-kinds of miRNA of 148a-3p, miR-150-5p, miR-20a-5p and miR-425-3p are formed.
3. the application in auxiliary diagnosis of iga nephropathy of the blood plasma miRNA mark described in claim 1 or 2.
4. the blood plasma miRNA mark described in claim 1 or 2 is preparing IgA nephropathy auxiliary diagnostic box or treatment IgA kidney Application in medicine.
5. the primer of a blood plasma miRNA mark relevant to IgA nephropathy auxiliary diagnosis, it is characterised in that this primer comprises The primer of one or more miRNA in miR-148a-3p, miR-150-5p, miR-20a-5p and miR-425-3p；It is preferably Comprise in blood plasma miRNA in miR-148a-3p, miR-150-5p, miR-20a-5p and miR-425-3p two or more The primer of miRNA；More preferably comprise miR-148a-3p in blood plasma miRNA, miR-150-5p, miR-20a-5p and The primer of tetra-kinds of miRNA of miR-425-3p.
6. the primer described in claim 5 in auxiliary diagnosis of iga nephropathy or prepares answering in IgA nephropathy auxiliary diagnostic box With.
7. an IgA nephropathy auxiliary diagnostic box, it is characterised in that this test kit is used for detecting blood plasma miR-148a-3p, One or more miRNA in miR-150-5p, miR-20a-5p and miR-425-3p；It is preferably used for detecting blood plasma miR- Two or more miRNA in 148a-3p, miR-150-5p, miR-20a-5p and miR-425-3p；More preferably use Tetra-kinds of miRNA of miR-148a-3p, miR-150-5p, miR-20a-5p and miR-425-3p in detection blood plasma miRNA.
8. an IgA nephropathy auxiliary diagnostic box, it is characterised in that containing miR-148a-in blood plasma miRNA in this test kit The primer of one or more miRNA in 3p, miR-150-5p, miR-20a-5p and miR-425-3p；It is preferably containing blood plasma The drawing of two or more miRNA in miR-148a-3p, miR-150-5p, miR-20a-5p and miR-425-3p in miRNA Thing；More preferably contain miR-148a-3p, miR-150-5p, miR-20a-5p and miR-425-3p tetra-in blood plasma miRNA Plant the primer of miRNA.
9. according to the diagnostic kit described in claim 7 or 8, it is characterised in that this test kit also including, round pcr is commonly used The conventional reagent of reagent.
CN201610726380.6A 2016-08-25 2016-08-25 Plasma miRNA marker related to IgA nephropathy auxiliary diagnosis and application thereof Active CN106086226B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201610726380.6A CN106086226B (en) 2016-08-25 2016-08-25 Plasma miRNA marker related to IgA nephropathy auxiliary diagnosis and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201610726380.6A CN106086226B (en) 2016-08-25 2016-08-25 Plasma miRNA marker related to IgA nephropathy auxiliary diagnosis and application thereof

Publications (2)

Publication Number Publication Date
CN106086226A true CN106086226A (en) 2016-11-09
CN106086226B CN106086226B (en) 2020-02-14

Family

ID=57225320

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201610726380.6A Active CN106086226B (en) 2016-08-25 2016-08-25 Plasma miRNA marker related to IgA nephropathy auxiliary diagnosis and application thereof

Country Status (1)

Country Link
CN (1) CN106086226B (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109055525A (en) * 2018-08-15 2018-12-21 深圳慈海医院 A method of finding the biomarker for monitoring IgA nephrosis
CN110951870A (en) * 2020-01-03 2020-04-03 中国人民解放军总医院 Application of miRNA expression quantity in predicting therapeutic effect of clopidogrel

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20090263803A1 (en) * 2008-02-08 2009-10-22 Sylvie Beaudenon Mirnas differentially expressed in lymph nodes from cancer patients
CN102076853A (en) * 2008-05-07 2011-05-25 阿布拉西斯生物科学有限责任公司 Enhancement of drug therapy by mirna
US20150005290A1 (en) * 2013-06-26 2015-01-01 University Of Virginia Patent Foundation Compositions and methods for diagnosing and treating salt sensitivity of blood pressure
CN104428426A (en) * 2012-04-27 2015-03-18 西门子公司 Diagnostic miRNA profiles in multiple sclerosis

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20090263803A1 (en) * 2008-02-08 2009-10-22 Sylvie Beaudenon Mirnas differentially expressed in lymph nodes from cancer patients
CN102076853A (en) * 2008-05-07 2011-05-25 阿布拉西斯生物科学有限责任公司 Enhancement of drug therapy by mirna
CN104428426A (en) * 2012-04-27 2015-03-18 西门子公司 Diagnostic miRNA profiles in multiple sclerosis
US20150005290A1 (en) * 2013-06-26 2015-01-01 University Of Virginia Patent Foundation Compositions and methods for diagnosing and treating salt sensitivity of blood pressure

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109055525A (en) * 2018-08-15 2018-12-21 深圳慈海医院 A method of finding the biomarker for monitoring IgA nephrosis
CN110951870A (en) * 2020-01-03 2020-04-03 中国人民解放军总医院 Application of miRNA expression quantity in predicting therapeutic effect of clopidogrel

Also Published As

Publication number Publication date
CN106086226B (en) 2020-02-14

Similar Documents

Publication Publication Date Title
CN108624695B (en) One kind circulation miRNA marker relevant to thyroid papillary carcinoma auxiliary diagnosis and its application
CN108103198B (en) One kind blood plasma miRNA marker relevant to cancer of pancreas auxiliary diagnosis and its application
CN106119392A (en) A kind of serum miRNA marker relevant to esophageal squamous cell carcinoma auxiliary diagnosis and application thereof
CN106119393A (en) A kind of blood plasma miRNA mark relevant to esophageal squamous cell carcinoma auxiliary diagnosis and application thereof
CN105603101B (en) Detect application of the system of 8 miRNA expression quantity in diagnosis or auxiliary diagnosis of hepatoma product is prepared
CN105950753B (en) One kind blood plasma miRNA marker relevant to adenocarcinoma of lung auxiliary diagnosis and its application
CN109609633A (en) One kind serum miRNA marker relevant to Computer-aided Diagnosis of Breast Cancer and its application
CN108441552B (en) One kind serum/plasma miRNA marker relevant to intrahepatic cholestasis of pregnancy auxiliary diagnosis and its application
CN109055557A (en) One kind serum miRNA marker relevant to cancer of pancreas auxiliary diagnosis and its application
CN105861672A (en) Detection kit and detection method for methylation of septin9 gene in human peripheral blood cell-free DNA
CN111621566B (en) Serum miRNA marker for diagnosing liver cancer and predicting liver cancer metastasis and detection kit thereof
CN108624691A (en) A kind of marker and its application for judging prostatic disorders
CN108531586A (en) A kind of relevant cycle miRNA marker and its application on X chromosome of and Computer-aided Diagnosis of Breast Cancer
CN109609634A (en) One kind circulation miRNA marker relevant to carcinoma of endometrium auxiliary diagnosis and its application
CN106086226A (en) A kind of blood plasma miRNA mark relevant to IgA nephropathy auxiliary diagnosis and application thereof
CN108950003A (en) It is a kind of for the miRNA marker of Diagnosis of Breast cancer and its application of miRNA
CN109593852B (en) Serum miRNA marker related to nasopharyngeal carcinoma auxiliary diagnosis and application thereof
CN108103199A (en) A kind of Xun Huan miRNA marker relevant with oophoroma auxiliary diagnosis and its application
CN106086178A (en) A kind of serum miRNA marker relevant to gastric cancer auxiliary diagnosis and application thereof
CN109593851B (en) Plasma miRNA marker related to breast cancer auxiliary diagnosis and application thereof
CN106350582A (en) Serum miRNA marker related to auxiliary diagnosis for squamous lung cell carcinoma and application thereof
CN106367477A (en) Serum miRNA marker related to auxiliary diagnosis of colorectal cancer, and application thereof
CN110373457A (en) A kind of mRNA marker and its application for ulcerative colitis diagnosis
CN107723365B (en) One kind blood plasma miRNA marker relevant to lung squamous cancer auxiliary diagnosis and its application
CN107746886B (en) One kind blood plasma miRNA marker relevant to colorectal cancer auxiliary diagnosis and its application

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant