CN108929910B

CN108929910B - Serum miRNA marker related to lung adenocarcinoma auxiliary diagnosis and application thereof

Info

Publication number: CN108929910B
Application number: CN201810878450.9A
Authority: CN
Inventors: 朱伟; 周鑫; 邹璇; 单霞; 闻伟; 葛炳辰; 张澜; 朱军
Original assignee: Individual
Current assignee: Individual
Priority date: 2018-08-03
Filing date: 2018-08-03
Publication date: 2022-11-29
Anticipated expiration: 2038-08-03
Also published as: CN108929910A

Abstract

The invention discloses a serum miRNA marker related to lung adenocarcinoma cancer auxiliary diagnosis and application thereof, wherein the marker is one or more of miR-133a-3p, miR-584-5p, miR-10b-5p and miR-221-3 p. The serum miRNA is used as a novel biomarker and has the characteristics of good stability, easy minimally invasive acquisition and high sensitivity and specificity. The development and utilization of the molecular markers can provide a new direction for the diagnosis and further treatment of various diseases including tumors. The research can more specifically obtain the lung adenocarcinoma serum miRNA marker with clinical diagnosis potential. The study demonstrated the reliability and reproducibility of this group of mirnas as noninvasive markers for the diagnosis of lung adenocarcinoma.

Description

Serum miRNA marker related to lung adenocarcinoma auxiliary diagnosis and application thereof

Technical Field

The invention belongs to the field of genetic engineering and oncology, and relates to a serum miRNA marker related to lung adenocarcinoma cancer auxiliary diagnosis and application thereof.

Background

Lung cancer is a malignant tumor with the highest mortality in the world, and Non-small cell lung cancer (NSCLC) accounts for 80% of the total lung cancer. The non-small cell lung cancer can be further divided into lung adenocarcinoma, lung squamous carcinoma and the like according to pathological types, and the incidence rate of the lung adenocarcinoma exceeds that of the lung squamous carcinoma at present, thus becoming the most common lung cancer type. Surgical treatment remains the most effective method for treating non-small cell lung cancer at present. However, most patients are in the middle and late stage at the time of treatment, so that the median survival period is still 7-11 months, and the 5-year survival rate is only about 17%. At present, the research on the molecular and clinical characteristics of lung cancer is intensive, and the clinical screening and treatment methods are advanced, but the methods either depend too much on the experience of testers, are too expensive to be popularized, or have yet to be enhanced in detection sensitivity and specificity. Therefore, there is an urgent need to develop new reliable non-invasive early diagnostic markers that facilitate early intervention and treatment and prolong patient survival.

The discovery of Micro-RNA (miRNAs) is one of the major discoveries in recent years. Mature mirnas are a class of evolutionarily conserved, small non-coding RNA molecules that are 18-25 nucleotides in length. According to research, miRNA can regulate more than 1/3 of genes of an organism in a post-transcriptional level, thereby participating in a plurality of physiological and pathological processes of the organism. Expression of mirnas is time-specific as well as tissue-specific. Also, some mirnas can be involved in specific physiopathologies as well as in specific disease processes. Therefore, certain specific miRNAs can be used as markers of certain physiological pathologies and certain diseases such as tumors and the like. In 2008, mitchell detected free mirnas in peripheral blood, which were found to be stably present in peripheral blood and could be used as a non-invasive marker for diagnosing tumors. This finding has opened the way that numerous researchers around the world have begun exploring circulating mirnas as noninvasive markers. The existing research proves the potential diagnosis value of the circulating miRNA in lung cancer, gastric cancer, breast cancer and colorectal cancer. Recent clinical trials have shown that accurate sub-typing of lung cancer enables patients to obtain maximum therapeutic benefit and avoid potential therapeutic side effects. This is the embodiment of the accurate medical thought. However, the current research on circulating miRNAs for lung cancer mainly aims at a collection containing a plurality of subtypes of non-small cell lung cancer. The results may be biased by the differences in the constitution of the non-small cell lung cancer subtypes selected for study.

Therefore, the study focused on lung cancer as the most common subtype, lung adenocarcinoma, and the Exiqon miRNA qpcrpel chip and qRT-PCR-based absolute quantification method were used to find serum miRNA with potential diagnosis of lung adenocarcinoma. And the expression of the miRNA in lung cancer tissues and serum exosomes is verified so as to further define the relationship between the miRNA and lung adenocarcinoma. If a diagnosis kit aiming at the lung adenocarcinoma is designed according to the miRNA, the diagnosis and treatment level of the lung adenocarcinoma in China can be promoted, and a thought is provided for further research on the lung cancer in the future.

Disclosure of Invention

The invention aims to provide a serum miRNA marker related to auxiliary diagnosis of lung adenocarcinoma.

The invention also aims to provide the application of the serum miRNA marker and the primer thereof in preparing a lung adenocarcinoma auxiliary diagnosis kit and preparing a medicament for treating lung adenocarcinoma.

The invention also aims to provide a kit and a medicament for auxiliary diagnosis and treatment of lung adenocarcinoma.

The purpose of the invention can be realized by the following technical scheme:

a serum miRNA marker related to auxiliary diagnosis of lung adenocarcinoma, wherein the marker is one or more of miR-133a-3p (uuugguccccuucaacagcugg), miR-584-5p (uuaugguugccuggacagg), miR-10b-5p (uaccugguaaccgaauugg), and miR-221-3p (agcuacaugcuggguuu).

The serum miRNA marker is preferably a combination of two or more of miR-133a-3p, miR-584-5p, miR-10b-5p and miR-221-3p, and is further preferably a combination consisting of four miRNAs of miR-133a-3p, miR-584-5p, miR-10b-5p and miR-221-3 p.

The application of the serum miRNA marker in auxiliary diagnosis of lung adenocarcinoma.

The serum miRNA marker is applied to preparation of a lung adenocarcinoma auxiliary diagnosis kit or preparation of a lung adenocarcinoma treatment drug.

A primer of a serum miRNA marker related to auxiliary diagnosis of lung adenocarcinoma comprises a primer of one or more miRNAs in miR-133a-3p, miR-584-5p, miR-10b-5p and miR-221-3 p; preferably primers containing two or more of miR-133a-3p, miR-584-5p, miR-10b-5p and miR-221-3p in serum miRNA; further preferred are primers containing four kinds of miRNAs, namely miR-133a-3p, miR-584-5p, miR-10b-5p and miR-221-3p, in serum miRNAs.

The primer is applied to auxiliary diagnosis of lung adenocarcinoma or preparation of a lung adenocarcinoma auxiliary diagnosis kit.

An auxiliary diagnosis kit for lung adenocarcinoma, which contains primers of one or more miRNAs in miR-133a-3p, miR-584-5p, miR-10b-5p and miR-221-3p in serum miRNAs; preferably primers containing two or more of miR-133a-3p, miR-584-5p, miR-10b-5p and miR-221-3p in serum miRNA; further preferably, the primers contain four miRNAs of miR-133a-3p, miR-584-5p, miR-10b-5p and miR-221-3p in serum miRNAs.

The kit also comprises a reagent commonly used in PCR technology or/and a reagent commonly used in immunohistochemical technology.

The kit may also include reagents commonly used in PCR reactions, such as reverse transcriptase, buffers, dNTPs, mgCl ₂ DEPC water and Taq enzyme, etc.; standards and/or controls may also be included.

The sequence of each miRNA in the serum miRNA markers miR-133a-3p, miR-584-5p, miR-10b-5p and miR-221-3p related to lung adenocarcinoma diagnosis is disclosed, but the combination of the miRNA markers as the auxiliary diagnosis marker of lung adenocarcinoma requires creative work of the technicians in the field. Amplification primers of all miRNA markers can be obtained by market purchase, and the primers of the serum miRNA markers used in the embodiment of the invention are specific miRNA stem-loop RT-PCR primers synthesized and produced by Guangzhou Ruibo company.

Specifically, the technical solution of the present invention to solve the problem includes: (1) establishing a unified specimen library and a database: standard procedures (SOP) were used to collect blood samples meeting the standards and the system collected complete demographic and clinical data. (2) differential expression profiling of serum miRNAs: differentially expressed serum miRNAs in lung adenocarcinoma and normal control populations were analyzed and further large sample multi-stage validation of differentially expressed miRNAs was performed. (3) The ability of these mirnas to diagnose lung adenocarcinoma was clear by multi-stage validation. (4) development of a serum miRNA diagnostic kit: miRNAs diagnostic kit is developed according to the differential expression miRNA in the serum of the lung adenocarcinoma and the normal population, so that noninvasive auxiliary diagnosis of the lung adenocarcinoma patient is realized. (4) Analyzing the expression conditions of the miRNAs in lung adenocarcinoma tissues, arterial serum and exosomes, revealing the relationship between the miRNAs and lung adenocarcinoma, and providing a basis for developing medicaments for treating lung adenocarcinoma possibly related to the miRNAs.

The inventor collects blood samples meeting the standard by a Standard Operation Program (SOP), systematically collects complete demographic data and clinical data, and adopts an Exiqon miRNA qPCR panel chip, a qRT-PCR method and the like.

The experimental method of research mainly includes the following parts:

1. study sample selection: patients who were initially treated, were not operated, and were intervened with chemoradiotherapy and then pathologically confirmed as lung adenocarcinoma. The normal control is a normal population subjected to physical examination in a hospital.

2.Exiqon miRNA qPCR panel chip primary screening: and (3) carrying out RNA extraction on the serum mixed sample by using a TRIZOL-LS reagent, and carrying out qRT-PCR operation to obtain a primary screening result.

3. Training set, validation set, and additional validation set: RNA extraction is carried out on each serum sample by using an AM1556 kit (ABI company), a cDNA sample is obtained through reverse transcription reaction, and a PCR primer and SYBR Green fluorescent dye are added for PCR reaction. And (5) comparing the Ct values of the standard substance to obtain the miRNA content in the sample.

4. The RNA in lung adenocarcinoma and paracarcinoma tissues is extracted by using a TRIZOL-LS reagent, the RNA in exosomes is extracted by using an ExoQuick kit (SBI company) and an AM1556 kit (ABI company), and the expression difference of miRNA in the tissues and the exosomes is detected by a qRT-PCR method.

5. Statistical analysis: exercise chi ² Tests, paired t tests, and non-parametric rank-sum tests compare the differences in miRNA expression levels among different study groups. And (4) confirming the diagnostic value of the serum miRNA by calculating a risk value and analyzing a ROC curve.

At present, by carrying out systematic expression analysis on miRNA in peripheral serum of a lung adenocarcinoma patient, the research group of the invention has found a group of 4 lung adenocarcinoma serum microRNA markers (miR-133 a-3p, miR-584-5p, miR-10b-5p and miR-221-3 p) with clinical diagnosis potential.

The invention has the beneficial effects that:

1. compared with the traditional tumor marker, the serum miRNA is used as a novel biomarker, and has the characteristics of good stability, easy minimally invasive acquisition, and high sensitivity and specificity. The development and utilization of the molecular markers can provide a new direction for the diagnosis and further treatment of various diseases including tumors.

2. In contrast to previous studies, the present study focused on the most common subtype of lung cancer, lung adenocarcinoma, rather than on a collection of numerous lung cancer subtypes, either whole lung cancer or non-small cell lung cancer. The research can more specifically obtain the lung adenocarcinoma serum miRNA marker with clinical diagnosis potential.

3. Researchers carry out rigorous and multistage verification and evaluation on differential expression miRNA in the serum of lung adenocarcinoma and normal control population through an Exiqon miRNA qPCR panel chip and an absolute quantitative method based on qRT-PCR. The reliability and repeatability of this group of mirnas as noninvasive markers for diagnosing lung adenocarcinoma were confirmed.

4. Researchers found that miR-133a-3p, miR-584-5p and miR-10b-5p in serum were expressed higher in patients with EGFRDELE746-A7750 than in patients with EGFR wild-type, suggesting potential indications for the effects of EGFR mutations and related therapeutic effects that may be useful for EGFR mutations in the future.

5. Researchers find that the expression of miR-221-3p in lung cancer tissues is consistent with that in serum, and show the close relationship between the miRNA and lung cancer. Meanwhile, the expression of the miR-10b-5p in serum exosomes is higher than that of a normal control. These results will provide new ideas for future studies on the mechanism of these mirnas for lung adenocarcinoma and for the treatment of lung adenocarcinoma by these mirnas.

Drawings

FIG. 1: flow chart of experiment

FIG. 2 is a schematic diagram: 4 miRNAs highly expressed in lung adenocarcinoma serum

FIG. 3: ROC curve analysis was performed on the obtained mirnas. A: a collection of training and validation sets; b: training a set; c: a verification set; d: an external verification set.

FIG. 4: expression of 4 miRNAs in lung adenocarcinoma tissue

FIG. 5: expression of miR-133a-3p, miR-584-5p and miR-10b-5p in EGFR mutation patients.

Detailed Description

The inventor collects a large number of venous serum samples of lung adenocarcinoma patients and normal physical examination population from the first subsidiary hospital of Nanjing medical university in 2012 to 2016, and selects 170 samples of lung adenocarcinoma and 170 samples of normal control from the samples through sorting sample data as experimental samples for preliminary screening and subsequent series of qRT-PCR verification of an Exiqon miRNA qPCR panel chip. At the same time, 19 pairs of lung adenocarcinoma and paracarcinoma tissues are retained. Selected patient serum samples were obtained from patients who were initially treated, not subjected to surgery or chemoradiotherapy intervention, and then pathologically confirmed as lung adenocarcinoma. And the system collects the demographic data and clinical data of the samples.

Referring to the flow chart (fig. 1), 30 lung adenocarcinoma samples and 10 normal controls were randomly selected from the lung adenocarcinoma and normal control serum samples, and mixed into 3 lung adenocarcinoma serum pooled samples and 1 normal pooled sample, respectively (one pooled sample was formed by pooling 10 200ul serum samples to form a 2ml sample). The 4 mixed samples are subjected to preliminary screening and analysis of an Exiqon miRNA qPCR panel chip, and the specific steps refer to the specifications of the Exiqon miRNA qPCR panel chip:

1. serum extraction

Serum samples were removed and centrifuged for 5min at 3000x g after thawing to remove some debris and some insoluble components. The supernatant was transferred to a new 1.5ml tube and after adding 750ul TRIZOL-LS, shaken vigorously for 5s.

2. Two-phase separation

After homogenization the sample is incubated for 5 minutes at 15 to 30 ℃. 0.2ml of chloroform was added to 1ml of the sample homogenized with TRIZOL-LS reagent, and the cap was closed. After shaking the tube vigorously manually for 15 seconds, incubate at 15 to 30 ℃ for 2 to 3 minutes. Centrifuge at 13,000g for 15 minutes at 4 ℃.

RNA precipitation

The aqueous phase was transferred to a fresh centrifuge tube. The aqueous phase was mixed with isopropanol to precipitate the RNA therein, the amount of isopropanol added was: each sample was homogenized by adding 1ml of TRIZOL-LS reagent together with 0.5ml of isopropanol and 5ul of glycogen. Standing at 4 ℃ for half an hour to separate out RNA as much as possible. Centrifuge at 13,000g for 15 minutes at 4 ℃.

RNA cleaning

The supernatant was removed and the RNA pellet was washed by adding at least 1ml of 75% (v/v) ethanol to 1ml of sample homogenized by TRIZOL-LS reagent. The mixture was allowed to stand for 10 minutes and then centrifuged at 10000g at 4 ℃ for 5 minutes.

5. Re-solubilization of RNA pellets

The ethanol solution was removed, the RNA pellet was air-dried for 5-10 minutes, repeatedly blown several times with a gun by adding RNase-free water, and then incubated at 55 to 60 ℃ for 10 minutes.

6. And (3) measuring the concentration:

typically, 5. Mu.g RNA/50ml serum can be obtained.

cDNA Synthesis

(1) Dilution of template RNA: 20-25ng template RNA was diluted to 14ul (final concentration 1.492-1.786 ng/. Mu.l) using DEPC water.

(2) Preparing a reaction solution: the 5 × Reaction Buffer and DEPC water were dissolved on ice and shaken well. The Enzyme mix was placed in an ice box at-20 ℃ and gently mixed before use and then placed on ice. All reagents were used after centrifugation.

(3) Preparing a reaction solution: the reaction solutions in the following table were prepared

(4) Mix and centrifuge reagents: and shaking or pumping the reaction solution uniformly and then centrifuging to ensure that all the solutions are thoroughly and uniformly mixed.

(5) Reverse transcription and heat inactivation: after incubating the reaction mixture at 42 ℃ for 60 minutes, the reverse transcriptase was inactivated by incubating at 95 ℃ for 5 minutes.

8.Real-Time PCR

Reagent:

Nuclease free water(Exiqon)

SYBR ^TM Green master mix(Exiqon)

cDNA template

ROX(Invitrogen)

miRNA PCR ARRAY(Exiqon)

The instrument comprises:

ABI PRISM7900system(Applied Biosystems)

(1) Preparation of Real-time PCR reagents: the prepared cDNA template, DEPC water and SYBR ^TM Green master mix was dissolved on ice for 15-20 minutes.

(2) Diluting the cDNA template: the cDNA template obtained from the RT reaction was diluted 110-fold with nucleoease free water (for example, 2180. Mu.l of nucleoease free water was added to 20. Mu.l of the reaction solution).

(3) Mixing all reaction reagents:

A. after simple centrifugation of the PCR plate, the seal was removed.

B. The 110-fold diluted cDNA template was mixed with 2 × SYBR Green master mix as described in 1:1 and mixing.

C. Inverting and mixing the reaction solution and centrifuging

D. Adding the mixed reaction solution to each well in the plate

E. Resealing the PCR plate

(4) Simple low temperature centrifugation of PCR plate

(5) Real-time PCR amplification: real-time PCR amplification and dissolution curve analysis were performed according to the reaction conditions in the following table.

Real-time PCR cycling conditions are as follows:

and (3) data analysis: using the Delta Ct method

Preliminary data analysis was performed using software attached to the PCR instrument to obtain the original Cq value (Cp or Ct, which may vary from instrument to instrument).

We propose to use GenEx qPCR analysis software (www.exiqon.com/mirna-pcr-analysis) for standard and in-depth data analysis.

a. The Δ Ct for each pathway-associated gene in each treatment group was calculated.

ΔCt(group 1)＝average Ct–average of HK genes’Ct for group 1array

ΔCt(group 2)＝average Ct–average of HK genes’Ct for group 2array

b. The Δ Δ Ct for each gene in 2 PCR arrays (or two groups) was calculated.

Δ Δ Ct = Δ Ct (group 2) - Δ Ct (group 1)

Remarking: typically group 1 is the control and group 2 is the experimental group.

c. The expression difference of the corresponding genes of the group 2 and the group 1 is calculated by 2-delta Ct.

After initial screening of the chip, 35 differentially expressed mirnas in the following table were obtained (all over 2-fold difference in 3 lung adenocarcinoma serum pool samples compared to normal samples). Then, the 35 miRNAs are verified one by 40 samples in the mixed sample to obtain 9 differential expression miRNAs (the difference multiple is more than 1.5 times, and the P value is less than 0.05).

Verifying 9 differential expression miRNAs obtained by primary screening by adopting an absolute quantitative method based on qRT-PCR through a training set, a verification set and an additional verification set, and specifically comprising the following steps:

1. serum RNA extraction: serum RNA extraction kit (AM 1556) of ABI company is selected, 200ul of RNA is extracted from each sample according to the kit instruction, and finally 100ul of DEPC water is used for dissolving.

Preparation of cDNA:

1) Reverse transcription experiment was performed using a 50. Mu.L reaction system

The above reaction system was mixed well and after instantaneous centrifugation, the reaction was carried out according to the following procedure:

2) The following reactants are added into the reaction system after the reaction

3.qPCR

1) Using a 5. Mu.L reaction system, the following tests were carried out in the following proportions

The reaction system is mixed evenly, placed in a real-time quantitative PCR instrument after instantaneous centrifugation, and reacted according to the following procedures:

the dissolution profile was added after the reaction was complete.

And (3) data analysis: the absolute concentration of miRNA in each sample can be calculated by comparing Ct values of standard substances with different concentrations and compiling into a standard curve. Statistical analysis is carried out by using SPSS 16.0 software, a group of training sets is obtained, and the verification sets are all consistent with 4 miRNAs with high expression in lung adenocarcinoma serum: miR-133a-3p, miR-584-5p, miR-10b-5P and miR-221-3P (in the training set, the P value in the verification set is less than 0.05, and the P value is shown in figure 2). By the 4 miRNAs, the risk value RSF of each sample can be calculated, and the specific steps are as follows:

1. calculating a cutoff value of each miRNA for distinguishing lung adenocarcinoma from normal control by using an ROC curve;

2. if the sample is larger than the cutoff value, marking as 1, otherwise, marking as 0;

3. applying formula risk values

S _ij The value of miRNAj relative to sample i calculated in 2, W _j Is a one-way regression coefficient of the miRNA.

As shown in fig. 3, the molecular markers composed of these 4 mirnas can distinguish lung adenocarcinoma patients from normal population well. The additional training set further confirms the reliability of the results.

A total of 14 patients with lung adenocarcinoma in the study group were subjected to clinical EGFR mutation analysis, 5 of which were wild type, 3 of which were EGFR DelE746-a7750 mutant, and 6 of which were L858R mutant. Analysis by Chi-square test showed that miR-133a-3p, miR-584-5p and miR-10b-5p are expressed more in patients with EGFR mutation than in patients with EGFR wild type (FIG. 5).

After the research group, the expression of exosomes of the 4 miRNAs in lung adenocarcinoma tissues and serum is further detected, TRIZOL is used for extracting RNA from the lung adenocarcinoma tissues, and the exosome extraction kit is an ExoQuick kit (SBI company). Exosome RNA extracted from 200ul serum was resuspended in 200ul DEPC water, and exosome RNA was extracted using AM1556 kit (ABI) in the same procedure as the serum RNA extraction.

The expression of miR-221-3p in lung adenocarcinoma tissues is higher than that in paracarcinoma tissues by non-parametric test analysis (figure 4). Meanwhile, the expression of miR-10b-5P in the lung adenocarcinoma serum is higher than that in the serum exosomes of the normal population (P <0.05, see the following table).

miRNA	Multiple of	P value
			miR-10b-5p	1.82	0.006
miR-133a-3p	1.24	0.988
			miR-584-5p	1.12	0.791
miR-221-3p	1.65	0.192

The kit comprises a batch of serum miRNA qRT-PCR primers, and can also comprise common reagents required by corresponding PCR technologies, such as: reverse transcriptase, buffer, dNTPs, mgCl2, DEPC water, fluorescent probes, RNase inhibitors, taq enzyme and the like can be selected according to the specific experimental method, the common reagents are well known to those skilled in the art, and in addition, standard substances and controls (such as quantitative standard normal human samples and the like) can be provided. The kit has the value that only serum is needed, other tissue samples are not needed, and the expression content of miRNA in the serum sample is detected through the simplest fluorescence method, so as to assist in diagnosing the possibility of suffering from lung adenocarcinoma of a patient from which the sample is derived. The serum miRNA is stable, convenient to detect and accurate in quantification, and sensitivity and specificity of disease diagnosis are greatly improved, so that the kit can help to guide diagnosis and further individualized treatment when put into practice.

Claims

1. Application of primers for detecting expression levels of four miRNAs (micro ribonucleic acid) miR-133a-3p, miR-584-5p, miR-10b-5p and miR-221-3p in serum in preparation of lung adenocarcinoma auxiliary diagnosis kits.

2. The use of claim 1, wherein the kit further comprises reverse transcriptase, buffer, dNTPs, mgCl ₂ DEPC water, fluorescent probes, rnase inhibitors, and Taq enzyme.