CN107723365A - A kind of blood plasma miRNA mark related to lung squamous cancer auxiliary diagnosis and its application - Google Patents
A kind of blood plasma miRNA mark related to lung squamous cancer auxiliary diagnosis and its application Download PDFInfo
- Publication number
- CN107723365A CN107723365A CN201710810611.6A CN201710810611A CN107723365A CN 107723365 A CN107723365 A CN 107723365A CN 201710810611 A CN201710810611 A CN 201710810611A CN 107723365 A CN107723365 A CN 107723365A
- Authority
- CN
- China
- Prior art keywords
- mir
- mirna
- blood plasma
- lung squamous
- squamous cancer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
Abstract
The present invention discloses a kind of blood plasma miRNA mark related to lung squamous cancer auxiliary diagnosis and its application, and the mark is the one or more in miR 181a 5p, miR 21 5p, the 5p of miR 106a 5p and miR 93.Blood plasma miRNA as new biomarker, have stability it is good, it is minimally invasive easily obtain, the characteristics of sensitivity and specificity are high.The utilization of this kind of molecular marker will provide new direction for the diagnosis of the various diseases including tumour and further treatment.This research is by the more targeted lung squamous cancer blood plasma miRNA label drawn with clinical diagnosis potential.Research confirms reliabilities and repeatability of this group of miRNA as the noninvasive label of diagnosis lung squamous cancer.
Description
Technical field
The invention belongs to genetic engineering and oncology, is related to a kind of blood plasma related to lung squamous cancer auxiliary diagnosis
MiRNA marker and its application.
Background technology
Lung cancer (Lung Cancer) is one of most common malignant tumour of Present Global.In China, the incidence of disease of lung cancer and
The death rate ranks first.Non-small cell lung cancer (NSCLC) accounts for the 85% of lung cancer.Wherein, lung squamous cancer is most common in NSCLC
One of hypotype.Although surgical intervention is currently the preferred and most important treatment method of lung squamous cancer, and can be to the lung squamous cancer of early stage
Patient reaches the purpose of healing, but because Lung Squamous Carcinoma Patients early clinical manifestation is without obvious specificity, in China's early diagnostic rate
It is still relatively low.At present, low-dose CT inspection (Low-dose computed tomography (LDCT)) is being used for of more recommending
The examination of lung cancer and pulmonary nodule.It is but potential excessively to diagnose possible, too high cost and make due to such as high rate of false alarm
Into radioactive exposure harm etc. reason cause its use by a definite limitation.The most commonly used tumor-marker of clinical practice at present
Thing, such as squamous cell carcinoma antigen (SCC), carcinoembryonic antigen (CEA),
Neuronspecific enolase (NSE) and Cyfra 21-1, also lack certain sensitivity and specificity.With gene
The development of the biotechnologys such as group, protein science and metabolism group, increasing biomarker have been observed that or studied.
Thus, it is found that the new label that can early diagnose lung squamous cancer points the day and await for it, so as to promote lung squamous cancer early intervention and treatment,
Extend the life cycle of patient.
Microrna (miRNAs) is small non-coding RNA molecule of a kind of length in the nucleotides of 22 or so, and it is by turning
Regulate and control the various vital movement processes of wide participation after record, include generation, invasion and attack and the transfer etc. of tumour.Research finds, miRNA
Expression there is different degrees of upper mediation to lower in tumour, can establish base as a kind of emerging tumor markers for it
Plinth.2008, Mitchell detected free miRNA in peripheral blood, it is found that it can be stable in the presence of in peripheral blood, and
And can be as the noninvasive mark of diagnosing tumour.There is now research confirms circulation miRNA in stomach cancer, breast cancer, Colon and rectum
Potential diagnostic value in the tumours such as cancer.But due to research method and the difference of crowd is included, causes result of study incomplete one
Cause.Therefore, this research and utilization Exiqon miRNA qPCR panel chips and the absolute quantitation method based on qRT-PCR, pass through
Research to the lung squamous cancer blood plasma of large sample, it is intended to which finding has the blood plasma miRNA of potential diagnostic value to lung squamous cancer.And to this
A little expression of the miRNA in lung squamous cell carcinoma cancers and in the blood plasma excretion body of periphery are verified, further to define itself and lung squama
The relation of cancer.If the diagnostic kit of lung squamous cancer is directed to according to this kind of miRNA designs, it will promote the diagnosis and treatment of China's lung squamous cancer
Level, also provide thinking for further research of the future to lung squamous cancer.
The content of the invention
It is an object of the invention to provide a kind of blood plasma miRNA mark related to lung squamous cancer auxiliary diagnosis.
Another object of the present invention is to provide above-mentioned blood plasma miRNA mark and its primer prepare lung squamous cancer auxiliary examine
Disconnected kit and the application in the medicine for preparing treatment lung squamous cancer.
A further object of the present invention is to provide the kit and medicine for lung squamous cancer auxiliary diagnosis and treatment.
The purpose of the present invention can be achieved through the following technical solutions：
A kind of blood plasma miRNA mark related to lung squamous cancer auxiliary diagnosis, the mark are miR-181a-5p
(AACAUUCAACGCUGUCGGUGAGU), miR-21-5p (UAGCUUAUCAGACUGAUGUUGA), miR-106a-5p
And the one or more in miR-93-5p (CAAAGUGCUGUUCGUGCAGGUAG) (AAAAGUGCUUACAGUGCAGGUAG).
The blood plasma miRNA mark is preferably two kinds or two in miR-181a-5p, miR-21-5p, miR-106a-5p and miR-93-5p
The combination of the kind above, more preferably tetra- kinds of miR-181a-5p, miR-21-5p, miR-106a-5p and miR-93-5p
The combination that miRNA is formed.
Application of the above-mentioned blood plasma miRNA mark in auxiliary diagnosis lung squamous cancer.
Application of the above-mentioned blood plasma miRNA mark in lung squamous cancer auxiliary diagnostic box is prepared.
Above-mentioned blood plasma miRNA mark is preparing the application in treating lung squamous cancer medicine.
A kind of primer of the blood plasma miRNA mark related to lung squamous cancer auxiliary diagnosis, the primer include miR-181a-
The primer of one or more miRNA in 5p, miR-21-5p, miR-106a-5p and miR-93-5p；Preferably include blood plasma
Two or more miRNA draws in miR-181a-5p, miR-21-5p, miR-106a-5p and miR-93-5p in miRNA
Thing；More preferably include miR-181a-5p, miR-21-5p, miR-106a-5p and miR-93-5p tetra- in blood plasma miRNA
Kind miRNA primer.
Application of the above-mentioned primer in auxiliary diagnosis lung squamous cancer or in preparing lung squamous cancer auxiliary diagnostic box.
A kind of lung squamous cancer auxiliary diagnostic box, miR-181a-5p, miR-21- in blood plasma miRNA are contained in the kit
The primer of one or more miRNA in 5p, miR-106a-5p and miR-93-5p；Preferably contain miR- in blood plasma miRNA
Two or more miRNA primer in 181a-5p, miR-21-5p, miR-106a-5p and miR-93-5p；It is further excellent
Elect drawing containing tetra- kinds of miRNA of miR-181a-5p, miR-21-5p, miR-106a-5p and miR-93-5p in blood plasma miRNA as
Thing.
Also include the reagent that round pcr is commonly used in the kit.Such as reverse transcriptase, buffer solution, dNTPs, MgCl2, DEPC
Water and Taq enzyme etc.；Standard items and/or reference substance can also be contained.
The blood plasma miRNA mark miR-181a-5p, miR-21-5p related to lung squamous cancer diagnosis involved in the present invention,
The sequence of every kind of miRNA in miR-106a-5p and miR-93-5p is disclosed, but each miRNA marker is combined
Those skilled in the art are needed to pay creative work as lung squamous cancer auxiliary diagnosis mark.The amplification of each miRNA marker
Primer can be bought by market and be obtained, and the primer of the blood plasma miRNA mark used in the embodiment of the present invention is purchased from Guangzhou
The specific miRNA stem rings RT-PCR primer of the synthesized production of Rui Bo companies.
Specifically, the technical scheme of the present invention solved the problems, such as includes：(1) sample storehouse and data of unified standard are established
Storehouse：Standard compliant blood sample, the complete demographic data of systematic collection and clinical money are gathered with S.O.P. (SOP)
Material.(2) blood plasma miRNA differential expression spectrum analysis：The blood plasma miRNA of differential expression in lung squamous cancer and normal control population is analyzed,
And further large sample multistage checking is carried out to differential expression miRNAs.(3) by multistage checking, these are specified
MiRNA diagnoses the ability of lung squamous cancer.(4) development of blood plasma miRNA diagnostic kit：According to Lung Squamous Carcinoma Patients and normal population blood
Differential expression miRNA exploitation miRNAs diagnostic kits in slurry, realize the noninvasive auxiliary diagnosis to Lung Squamous Carcinoma Patients.(5) divide
Expressions of these miRNA in lung squamous cell carcinoma cancers and excretion body is analysed, the relation of these miRNA and lung squamous cancer is disclosed, is
The medicine for developing treatment lung squamous cancer that may be related to these miRNA in the future provides foundation.
The present inventor gathers standard compliant blood sample, the complete population of systematic collection with S.O.P. (SOP)
Data, clinical data, and employ Exiqon miRNA qPCR panel chips and qRT-PCR methods etc..
The experimental method specifically studied mainly includes following components：
1. study samples selection：Just control, row operation and chemicotherapy intervention and the patient that lung squamous cancer is confirmed as through pathology.
Normal control is the normal population to be checked UP in hospital.
2.Exiqon miRNA qPCR panel chip primary dcreening operations：Blood plasma mixing sample is carried out using TRIZOL-LS reagents
RNA is extracted, and is carried out qRT-PCR operations and obtained primary dcreening operation result.
3. training set, checking collection：RNA extractions are carried out to each plasma sample using AM1556 kits (ABI companies), led to
Cross reverse transcription reaction and obtain cDNA samples, add PCR primer and SYBR Green fluorescent dyes enter performing PCR reaction.Pass through comparison
The Ct values of standard items, draw the miRNA contents in sample.
4. using the RNA in TRIZOL-LS reagents extraction lung squamous cancer and cancer beside organism, (SBI is public for ExoQuick kits
Department) and AM1556 kits (ABI companies) extraction excretion body in RNA, by qRT-PCR method, detect miRNA and organizing
And the differential expression in excretion body.
5. statistical analysis：With χ2Examine, paired t-test and non-parametric rank sum test compare miRNA expressions and existed
Difference in different seminar.The diagnostic value of blood plasma miRNA is confirmed by calculating ROC curve analysis.
Seminar of the present invention carries out the expression point of system by the miRNA in the periphery blood plasma to lung squamous cancer patient at present
Analysis, it has now been found that one group 4 there is clinical diagnosis potential lung squamous cancer blood plasma microRNA labels (miR-181a-5p,
MiR-21-5p, miR-106a-5p and miR-93-5p).
Beneficial effects of the present invention：
1. compared to traditional tumor markers, blood plasma miRNA as new biomarker, have stability it is good,
It is minimally invasive easily obtain, sensitivity and specificity it is high the characteristics of.The utilization of this kind of molecular marker are by for including tumour
The diagnosis of various diseases and further treatment provide new direction.
2. researcher is by Exiqon miRNA qPCR panel chips and the absolute quantitation method based on qRT-PCR, right
Differential expression miRNA in lung squamous cancer and normal control population's blood plasma carries out tight, multistage checking and evaluation.Confirm this
Reliabilities and repeatability of the group miRNA as the noninvasive label of diagnosis lung squamous cancer.
3. researcher has found miR-181a-5p, miR-21-5p, miR-106a-5p and miR-93-5p in lung squamous cell carcinoma cancers
In expression also with expressed in blood plasma it is consistent, it is shown that the close relation between this group of miRNA and lung squamous cancer.But outside blood plasma
The expression secreted in body does not find notable difference.These results by these miRNA of future studies for lung squamous cancer mechanism with
And provide new thinking for treatments of these miRNA for lung squamous cancer.
Brief description of the drawings
Fig. 1：Experiment flow figure
Fig. 2：4 miRNA of high expression in lung squamous cancer blood plasma.
a：miR-181a-5p；b：miR-21-5p；c：miR-106a-5p；d：miR-93-5p；N：Normal group；T：Experiment
Group.*：P<0.001
Fig. 3：ROC curve analysis is carried out to the miRNA obtained.
a：The intersection of training set, test set and checking collection；b：Training set；c：Test set；d：Checking collection.
Fig. 4：Expressions of 4 miRNA in lung squamous cell carcinoma cancers.
Fig. 5：Expressions of 4 miRNA in Lung Squamous Carcinoma Patients blood plasma excretion body.
Embodiment
Inventor have collected substantial amounts of lung squamous cancer from No.1 Attached Hospital, Nanjing Medical Univ in 2012 to 2015 and suffer from
Person and the venous plasma sample of normal Check-up crowd, by the arrangement to sample data, therefrom have selected 102 lung squamous cancers and
The sample of 101 normal controls is as Exiqon miRNA qPCR panel chips primary dcreening operations and a series of follow-up qRT-PCR checkings
Laboratory sample.23 lung squamous cell carcinoma cancers and 23 cancer beside organisms are also left and taken simultaneously.Selected patients blood plasma's sample standard deviation comes
From in just control, row operation and chemicotherapy intervention and the patient for confirming as through pathology lung squamous cancer.And system acquisition these samples
This demographic data, clinical data.
With reference to flow chart (Fig. 1), 30 lung squamous cancer samples have been randomly choosed from lung squamous cancer and normal control plasma sample
Sheet and 10 normal controls, and 3 lung squamous cancer blood plasma mixing samples and 1 normal mixing sample (one have been mixed into respectively
Individual mixing sample is converged the sample for forming 2ml by 10 200ul plasma samples).Exiqon is carried out to this 4 mixing samples
MiRNA qPCR panel chips primary dcreening operations and analysis, explanation of the specific steps with reference to Exiqon miRNA qPCR panel chips
Book：
1. blood plasma extracts
Plasma sample is taken out, 3000x g centrifuge 5min and remove some fragments and some insoluble components after sample thaws.Transfer
Supernatant after adding 750ul TRIZOL-LS, acutely shakes 5s into new 1.5ml pipes.
2. two-phase laminated flow
Sample is incubated 5 minutes in 15 to 30 DEG C after homogenate.Added in the sample that TRIZOL-LS reagents per 1ml are homogenized
0.2ml chloroform, covers tightly lid.Acutely after 15 seconds, 15 to 30 DEG C are incubated 2 to 3 minutes vibration body manually.13,000g at 4 DEG C
Centrifugation 15 minutes.
3.RNA is precipitated
Aqueous phase is transferred in new centrifuge tube.Aqueous phase is mixed with isopropanol to precipitate RNA therein, adds the amount of isopropanol
For：Add 0.5ml isopropanol and 5ul glycogen in the sample of 1ml TRIZOL-LS reagents homogenate.4 DEG C of standing half an hour, allow
RNA is separated out as far as possible.Centrifuged 15 minutes in 4 DEG C of 13,000g.
4.RNA is cleaned
Supernatant is removed, at least the 75% of 1ml (v/v) ethanol is added in the sample per the homogenate of 1ml TRIZOL-LS reagents,
Clean RNA precipitate.10 minutes are stood, then 10000g is centrifuged 5 minutes at 4 DEG C.
5. RNA precipitate is dissolved again
Remove ethanol solution, air drying RNA precipitate 5-10 minutes, add no RNase water blown and beaten repeatedly with rifle it is several
Secondary, then 55 to 60 DEG C are incubated 10 minutes.
6. measure concentration：
Usually lead to~5 μ g RNA/50ml blood plasma.
7.cDNA is synthesized
(1) template ribonucleic acid is diluted：20-25ng template ribonucleic acids are diluted to 14ul (final concentration of 1.492- using DEPC water
1.786ng/μl)。
(2) reaction solution is prepared：5 × Reaction Buffer and DEPC water is placed in and dissolved on ice, and shakes mixing.
Enzyme mix are placed in -20 DEG C of ice chests, are placed on ice after mixing is flicked before use.All reagents use after centrifuging.
(3) reaction solution is configured：Configure the reaction solution in following table
(4) mix and centrifuge reagent：Concussion or suction centrifuge after mixing reaction solution, to ensure that all solution are thoroughly mixed
Uniformly.
(5) reverse transcription reaction and heat inactivation：By reaction solution after 42 DEG C incubate 60 minutes, 5 minutes are incubated in 95 DEG C to lose
Reverse transcriptase living.
8.Real-Time PCR
Reagent：
Nuclease free water(Exiqon)
SYBRTM Green master mix(Exiqon)
CDNA templates
ROX(Invitrogen)
miRNA PCR ARRAY(Exiqon)
Instrument：
ABI PRISM7900system(Applied Biosystems)
(1) Real-time PCR reagents are prepared：By the cDNA templates of preparation, DEPC water and SYBRTM Green master
Mix is placed in dissolving 15-20 minutes on ice.
(2) cDNA templates are diluted：The cDNA templates that RT reactions obtain are diluted 110 times with nuclease free water
(for example, 2180ul nuclease free water are added into 20 μ l reaction solutions).
(3) all reaction reagents are mixed：
A. after PCR plate is simply centrifuged, sealer is removed.
B. by 110 times of cDNA templates diluted and 2 × SYBR Green master mix according to 1：1 volume ratio mixes.
C. it is inverted and mixes reaction solution and centrifuge
D. each hole mixed reaction solution added in plate
E. PCR plate is sealed again
(4) PCR plate simple, low temperature is centrifuged
(5) Real-time PCR are expanded：Reaction condition in following table carries out Real-time PCR amplifications and dissolving
Tracing analysis.
Real-time PCR cycles condition such as following table：
Data analysis：Using Δ Δ Ct methods
Carry out primary data analysis using the subsidiary software of PCR instrument device, obtain original Cq values (Cp or Ct, according to instrument not
May be different with title).
It is proposed that use GenEx qPCR analysis softwares (www.exiqon.com/mirna-pcr-analysis) logarithm
According to the standard of progress and deep data analysis.
A. the Δ Ct of each passageway related genes in each treatment group is calculated.
Δ Ct (group 1)=average Ct-average of HK genes ' Ct for group 1array
Δ Ct (group 2)=average Ct-average of HK genes ' Ct for group 2array
B. the Δ Δ Ct of each gene in 2 PCR Array (or two groups) is calculated.
Δ Δ Ct=Δs Ct (group 2)-Δ Ct (group 1)
Remarks：Generally group 1 is control, and group 2 is experimental group.
C. 2- Δ Δ Ct calculating group 2 and the differential expression for organizing 1 corresponding gene are passed through.
After chip primary dcreening operation, obtain such as 27 differential expression miRNA (3 lung squamous cancer blood plasma mixing samples in following table
In relative to normal sample be above 1.5 times of differences).
The 27 differential expression miRNA obtained for primary dcreening operation, by training set, test set and checking collect, using based on
QRT-PCR absolute quantitation method is verified, is concretely comprised the following steps：
1. blood plasma RNA extracts：From ABI companies blood plasma RNA extracts kit (AM1556), illustrate with reference to kit, often
Individual sample draws 200ul and carries out extraction RNA, and is finally dissolved with 100ul DEPC water.
2.cDNA preparation：
1) reverse transcription experiment is carried out using 50 μ L reaction systems
Above reaction system mixes, and after brief centrifugation, is reacted with following procedure：
2) following reactant is added in the backward reaction system of above-mentioned reaction
3.qPCR
1) 5 μ L reaction systems are used, are tested in the following proportions
Reaction system mixes, and after brief centrifugation, is positioned in real-time PCR, is reacted with following procedure：
Reaction adds solubility curve after terminating.
Data analysis：By the Ct values for the standard items for comparing various concentrations, acquisition can be calculated often after converging into standard curve
The absolute concentration of miRNA in individual sample.Carry out statistical analysis using the softwares of SPSS 19.0, obtained one group in training set and
4 miRNA for being unanimously to high expression in lung squamous cancer blood plasma are concentrated in checking：miR-181a-5p、miR-21-5p、miR-106a-
5p and miR-93-5p (concentrating P values to be both less than 0.05, Fig. 2 in training set and checking).By this 4 miRNA, can calculate every
The ROC curve of individual sample.Such as Fig. 3, the molecular marker of this 4 miRNA compositions can be good at distinguishing Lung Squamous Carcinoma Patients and just
Ordinary person group.
The expression of this 4 miRNA excretion bodies in lung squamous cell carcinoma cancers and blood plasma, lung are further have detected after seminar
Squamous carcinoma tissue extraction RNA utilizes TRIZOL, and excretion body extracts kit is ExoQuick kits (SBI companies).200ul blood plasma
After the excretion body 200ul DEPC water extracted is resuspended, excretion body RNA is carried out using AM1556 kits (ABI companies)
Extraction, step is the same as blood plasma RNA extraction process.
Find that miR-181a-5p, miR-21-5p, miR-106a-5p and miR-93-5p exist with non-parametric test analysis
Expression in lung squamous cell carcinoma cancers is above cancer beside organism (Fig. 4).MiR-181a-5p, miR-21-5p, miR-106a-5p and miR-
Expression of the 93-5p in lung squamous cancer blood plasma excretion body is not found apparently higher than normal population (Fig. 5).
Kit includes a collection of blood plasma miRNA qRT-PCR primers, can also there is the conventional examination needed for corresponding round pcr
Agent, such as：Reverse transcriptase, buffer solution, dNTPs, MgCl2, DEPC water, fluorescence probe, RNase inhibitor, Taq enzyme etc., can basis
The experimental method specifically used is selected, and these common agents are all well known to those skilled in the art, it can in addition contain there is standard
Product and control (normal person's sample of such as quantitative markization).The value of this kit is only to need blood plasma without other groups
Tissue samples, by the expression contents of miRNA in the Fluorometric assay plasma sample most simplified, carry out the auxiliary diagnosis samples sources and suffer from
The possibility for suffering from lung squamous cancer of person.Blood plasma miRNA is easy to detect, and quantitative accurate, greatly improves the sensitiveness of medical diagnosis on disease
And specificity, therefore this kit is put into and put into practice, it can help to instruct diagnosis and further individualized treatment.
Claims (10)
1. a kind of blood plasma miRNA mark related to lung squamous cancer auxiliary diagnosis, it is characterised in that the mark is miR-181a-
One or more in 5p, miR-21-5p, miR-106a-5p and miR-93-5p.
2. blood plasma miRNA mark according to claim 1, it is characterised in that the blood plasma miRNA mark is miR-
The combination of two or more in 181a-5p, miR-21-5p, miR-106a-5p and miR-93-5p.
3. blood plasma miRNA mark according to claim 2, it is characterised in that the blood plasma miRNA mark is miR-
Tetra- kinds of miRNA of 181a-5p, miR-21-5p, miR-106a-5p and miR-93-5p combination.
4. application of the blood plasma miRNA mark described in claim 1,2 or 3 in auxiliary diagnosis lung squamous cancer.
5. application of the blood plasma miRNA mark in lung squamous cancer auxiliary diagnostic box is prepared described in claim 1,2 or 3.
6. the blood plasma miRNA mark described in claim 1,2 or 3 is preparing the application in treating lung squamous cancer medicine.
7. a kind of primer of the blood plasma miRNA mark related to lung squamous cancer auxiliary diagnosis, it is characterised in that the primer includes
The primer of one or more miRNA in miR-181a-5p, miR-21-5p, miR-106a-5p and miR-93-5p；Preferably
Include two or more in miR-181a-5p, miR-21-5p, miR-106a-5p and miR-93-5p in blood plasma miRNA
MiRNA primer；More preferably include blood plasma miRNA in miR-181a-5p, miR-21-5p, miR-106a-5p and
Tetra- kinds of miRNA of miR-93-5p primer.
8. application of the primer described in claim 7 in auxiliary diagnosis lung squamous cancer or in preparing lung squamous cancer auxiliary diagnostic box.
9. a kind of lung squamous cancer auxiliary diagnostic box, it is characterised in that contain miR-181a- in blood plasma miRNA in the kit
The primer of one or more miRNA in 5p, miR-21-5p, miR-106a-5p and miR-93-5p；Preferably contain blood plasma
Two or more miRNA draws in miR-181a-5p, miR-21-5p, miR-106a-5p and miR-93-5p in miRNA
Thing；More preferably contain miR-181a-5p, miR-21-5p, miR-106a-5p and miR-93-5p tetra- in blood plasma miRNA
Kind miRNA primer.
10. diagnostic kit according to claim 9, it is characterised in that also include what round pcr was commonly used in the kit
Reagent.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710810611.6A CN107723365B (en) | 2017-09-11 | 2017-09-11 | One kind blood plasma miRNA marker relevant to lung squamous cancer auxiliary diagnosis and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710810611.6A CN107723365B (en) | 2017-09-11 | 2017-09-11 | One kind blood plasma miRNA marker relevant to lung squamous cancer auxiliary diagnosis and its application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107723365A true CN107723365A (en) | 2018-02-23 |
| CN107723365B CN107723365B (en) | 2019-10-01 |
Family
ID=61205084
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710810611.6A Active CN107723365B (en) | 2017-09-11 | 2017-09-11 | One kind blood plasma miRNA marker relevant to lung squamous cancer auxiliary diagnosis and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107723365B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2021159562A1 (en) * | 2020-02-13 | 2021-08-19 | 朱伟 | Circulating mirna and carcino-embryonic mirna marker related to pan-tumor auxiliary diagnosis, and use thereof |
Citations (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103146702A (en) * | 2013-02-22 | 2013-06-12 | 上海大学 | Application of MiR-181a-5p in non-small cell lung cancer |
| CN103725779A (en) * | 2013-12-10 | 2014-04-16 | 长沙赢润生物技术有限公司 | Serum/plasmanon miRNA marker for diagnosing non-small cell lung cancer at early stage and application thereof |
| CN104704122A (en) * | 2012-04-20 | 2015-06-10 | 艾珀特玛治疗公司 | miRNA modulators of thermogenesis |
| CN105950753A (en) * | 2016-06-16 | 2016-09-21 | 朱伟 | Plasma miRNA marker relevant to lung adenocarcinoma auxiliary diagnosis and application thereof |
| CN106350582A (en) * | 2016-08-25 | 2017-01-25 | 朱伟 | Serum miRNA marker related to auxiliary diagnosis for squamous lung cell carcinoma and application thereof |
| CN106460053A (en) * | 2014-05-13 | 2017-02-22 | 罗塞塔金诺米克斯有限公司 | MIRNA expression signature in classification of thyroid tumors |
| CN106636317A (en) * | 2015-10-30 | 2017-05-10 | 益善生物技术股份有限公司 | Lung cancer related mciroRNA detection kit |
| CN106687602A (en) * | 2014-06-13 | 2017-05-17 | 维也纳自然资源与生命科学大学 | Compositions and methods for the diagnosis and treatment of bone fractures and disorders |
-
2017
- 2017-09-11 CN CN201710810611.6A patent/CN107723365B/en active Active
Patent Citations (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104704122A (en) * | 2012-04-20 | 2015-06-10 | 艾珀特玛治疗公司 | miRNA modulators of thermogenesis |
| CN103146702A (en) * | 2013-02-22 | 2013-06-12 | 上海大学 | Application of MiR-181a-5p in non-small cell lung cancer |
| CN103725779A (en) * | 2013-12-10 | 2014-04-16 | 长沙赢润生物技术有限公司 | Serum/plasmanon miRNA marker for diagnosing non-small cell lung cancer at early stage and application thereof |
| CN106460053A (en) * | 2014-05-13 | 2017-02-22 | 罗塞塔金诺米克斯有限公司 | MIRNA expression signature in classification of thyroid tumors |
| CN106687602A (en) * | 2014-06-13 | 2017-05-17 | 维也纳自然资源与生命科学大学 | Compositions and methods for the diagnosis and treatment of bone fractures and disorders |
| CN106636317A (en) * | 2015-10-30 | 2017-05-10 | 益善生物技术股份有限公司 | Lung cancer related mciroRNA detection kit |
| CN105950753A (en) * | 2016-06-16 | 2016-09-21 | 朱伟 | Plasma miRNA marker relevant to lung adenocarcinoma auxiliary diagnosis and application thereof |
| CN106350582A (en) * | 2016-08-25 | 2017-01-25 | 朱伟 | Serum miRNA marker related to auxiliary diagnosis for squamous lung cell carcinoma and application thereof |
Non-Patent Citations (1)
| Title |
|---|
| MOHAMMAD ASKANDAR IQBAL等: ""MicroRNA in lung cancer: role, mechanisms, pathways and therapeutic"", 《MOLECULAR ASPECTS OF MEDICINE》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2021159562A1 (en) * | 2020-02-13 | 2021-08-19 | 朱伟 | Circulating mirna and carcino-embryonic mirna marker related to pan-tumor auxiliary diagnosis, and use thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107723365B (en) | 2019-10-01 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105950753B (en) | One kind blood plasma miRNA marker relevant to adenocarcinoma of lung auxiliary diagnosis and its application | |
| CN108103198B (en) | One kind blood plasma miRNA marker relevant to cancer of pancreas auxiliary diagnosis and its application | |
| CN108624695B (en) | One kind circulation miRNA marker relevant to thyroid papillary carcinoma auxiliary diagnosis and its application | |
| CN106119393A (en) | A kind of blood plasma miRNA mark relevant to esophageal squamous cell carcinoma auxiliary diagnosis and application thereof | |
| CN105603101B (en) | Detect application of the system of 8 miRNA expression quantity in diagnosis or auxiliary diagnosis of hepatoma product is prepared | |
| CN106119392A (en) | A kind of serum miRNA marker relevant to esophageal squamous cell carcinoma auxiliary diagnosis and application thereof | |
| CN109609633A (en) | One kind serum miRNA marker relevant to Computer-aided Diagnosis of Breast Cancer and its application | |
| CN109055557A (en) | One kind serum miRNA marker relevant to cancer of pancreas auxiliary diagnosis and its application | |
| CN108531586A (en) | A kind of relevant cycle miRNA marker and its application on X chromosome of and Computer-aided Diagnosis of Breast Cancer | |
| CN109609634A (en) | One kind circulation miRNA marker relevant to carcinoma of endometrium auxiliary diagnosis and its application | |
| CN109593851A (en) | One kind blood plasma miRNA marker relevant to Computer-aided Diagnosis of Breast Cancer and its application | |
| CN108103199A (en) | A kind of Xun Huan miRNA marker relevant with oophoroma auxiliary diagnosis and its application | |
| CN109593852B (en) | Serum miRNA marker related to nasopharyngeal carcinoma auxiliary diagnosis and application thereof | |
| CN108929910A (en) | One kind serum miRNA marker relevant to adenocarcinoma of lung auxiliary diagnosis and its application | |
| CN106119347B (en) | The primer and kit of colorectal cancer transfer detection based on serum exosomal microRNAs | |
| CN106350582A (en) | Serum miRNA marker related to auxiliary diagnosis for squamous lung cell carcinoma and application thereof | |
| CN107723365B (en) | One kind blood plasma miRNA marker relevant to lung squamous cancer auxiliary diagnosis and its application | |
| CN106086178A (en) | A kind of serum miRNA marker relevant to gastric cancer auxiliary diagnosis and application thereof | |
| CN106367477A (en) | Serum miRNA marker related to auxiliary diagnosis of colorectal cancer, and application thereof | |
| CN107746886B (en) | One kind blood plasma miRNA marker relevant to colorectal cancer auxiliary diagnosis and its application | |
| CN106086226A (en) | A kind of blood plasma miRNA mark relevant to IgA nephropathy auxiliary diagnosis and application thereof | |
| WO2021159562A1 (en) | Circulating mirna and carcino-embryonic mirna marker related to pan-tumor auxiliary diagnosis, and use thereof | |
| CN109022586A (en) | One kind blood plasma miRNA marker relevant to cervical carcinoma auxiliary diagnosis and its application | |
| CN109536612B (en) | Plasma miRNA marker related to nasopharyngeal carcinoma auxiliary diagnosis and application thereof | |
| CN107723366B (en) | One kind serum miRNA marker relevant to cardia cancer auxiliary diagnosis and its application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |