CN107641624A - The cloning process of soybean Tolerant to low P gene Gm100776332 a kind of and functional verification - Google Patents
The cloning process of soybean Tolerant to low P gene Gm100776332 a kind of and functional verification Download PDFInfo
- Publication number
- CN107641624A CN107641624A CN201611218485.7A CN201611218485A CN107641624A CN 107641624 A CN107641624 A CN 107641624A CN 201611218485 A CN201611218485 A CN 201611218485A CN 107641624 A CN107641624 A CN 107641624A
- Authority
- CN
- China
- Prior art keywords
- gene
- soybean
- low
- tolerant
- arabidopsis
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Peptides Or Proteins (AREA)
Abstract
The invention discloses a kind of soybean Tolerant to low P gene Gm100776332 and its cloning process and application, belong to resource and environment technical field.The present invention explores the related gene of glycolytic pathway in soybean gene group by Different Proteomics, under the processing of low-phosphorous condition, is measured with the expression quantity in qPCR technologies measure magnificent spring No. 5 and tile kiln soya bean.The obvious Gm100776332 genes of difference have finally been screened with Differential Proteomic and q round pcrs, have cloned the resistance to inverse gene Gm100776332 of soybean, and the critical index soluble sugar content of its Tolerant to low P is measured by arabidopsis thaliana transformation.
Description
Technical field
The invention belongs to resource and environment technical field, and in particular to a kind of Gm100776332 grams of soybean Tolerant to low P gene
Grand method and functional verification.
Background technology
Soybean originates from China, is one of the fourth-largest cereal crops in China, rich in fat and protein.As tradition
Grain, oil, forage crop, there is very important status in agricultural production.Phosphorus element is growth and development of plants and metabolism
Necessary nutrient, it participates in the various Biochemical processes in plant in many ways.It is but most of in soil
Phosphorus is difficult to be absorbed by plants, utilize.South China is mostly characteristic of acid red soil, and pH value is low, and phosphorus is easy to be fixed, and available phosphorus is even more
Famine, causes that this area's soybean yields is relatively low, economic benefit is difficult to meet the production requirement of people, so that soil lacks
Phosphorus turns into one of most important restriction factor of south China Soybean production.By increasing the p application rate, containing for available phosphorus in soil can be improved
Amount, but due to phosphate fertilizer, diffusion velocity is slow in soil, causes P use efficiency very low, and largely also can band using phosphate fertilizer
Come water body and soil pollution.
With the development of molecular biology and molecular genetics, the research of the resistance to inverse aspect of plant achieves considerable progress.
Disclosing resistance to inverse essence step by step on a molecular scale turns into the target of researcher, therefore, utilizes proteomics research, solution
The analysis molecular mechanism related to soybean Tolerant to low P, excavates Tolerant to low P gene, to realize efficient utilization of the soybean to phosphorus element, this is right
Improve southern soybean yields to have important practical significance and application prospect.This research is on the basis of laboratory early-stage Study
On, soybean Tolerant to low P gene Gm100776332 correlation function is parsed, Tolerant to low P gene has been arrived in excavation, to soybean from now on
Genetic improvement lays the foundation.
The content of the invention
It is an object of the invention to explore the related gene of soybean Tolerant to low P using proteomics, first to laboratory
Existing Tolerant to low P and phosphorus responsive type soybean varieties carry out low-phosphorous processing, screening, finally determine that the magnificent spring No. 5 is Tolerant to low P soybean
Kind, tile kiln soya bean are phosphorus responsive type soybean varieties.Resistance to inverse gene finally is excavated with iTRAQ technologies and q round pcrs, finally
By the genetic transformation into arabidopsis, Tolerant to low P gene has been finally given.
After low-phosphorous processing 48h, the spring No. 5 to China extracts albumen with tile kiln soya bean and carries out iTRAQ analyses and qPCR surveys respectively
It is fixed, it is found that there occurs more obvious difference in glycolytic pathway.It was found that pyruvate decarboxylase (the pyruvate in the approach
Decarboxylase, PDC) expression quantity changes there occurs obvious, and then also result in the concern of this research.Pyruvate decarboxylation
Enzyme is a kind of carboxy lyase using diphosphothiamine as coenzyme, is widely present in plant.As the pass in fermentation approach
Key enzyme, pyruvate decarboxylation generation acetaldehyde caused by PDC catalysis glycolysis.PDC drives fermentating metabolism path, by competing with PDC
Strive metabolism pyruvic acid and participate in the energetic supersession in plant and metabolism, a variety of biologies of response anoxic, low temperature, high salt etc. with
Abiotic stress.This research finds that the low-phosphorous environment of the gene pairs has necessarily by the clone to the gene, functional verification
Resistivity.Finally it is determined that gene Gm100776332 is played a role in the Tolerant to low P approach of soybean, there is provided
A kind of soybean Tolerant to low P gene Gm100776332 cloning process.Another object of the present invention is to provide above-mentioned cloning process
The soybean Tolerant to low P gene Gm100776332 of acquisition.
Another object of the present invention is to provide said gene Gm100776332 application；Described application is that soybean is resistance to
Low-phosphorous gene Gm100776332 application.
The purpose of the present invention is achieved through the following technical solutions：A kind of soybean Tolerant to low P gene Gm100776332 clone
Method：Using primers F：5-ggatccATGAACACTAACATCCTCGGCG-3；Primer R：5-
GgtaccTCACTGAGGATTGGGAGGACG-3 carries out reverse transcription PCR, and 94 DEG C of 3min pre-degenerations, 94 DEG C of denaturation 30s, 56 DEG C are moved back
Fiery 45s, 72 DEG C of extension 1min, 72 DEG C re-extend 10min after 32 circulations；Soybean China spring No. 5 is handled under the conditions of without phosphorus
Gm100776332 genes are cloned in 48h, length is 2303 bp, the 5 ' non-translational regions comprising 277bp, and the 3 ' of 214bp non-turns over
Translate area and 1812bp open reading frame.
A kind of soybean Tolerant to low P gene Gm100776332 is obtained by above-mentioned cloning process, and its nucleotide gene sequence is as follows
It is shown：
ATGAACACTAACATCCTCGGCGACTGCAAGTCCGGAAACAGTGACGTCGGGTGTCCCCCGAATG
GCACCGTCTCGGTGATCAAGAACTCCGTCCCTGCCACCGCAATCACCTCCTCGGATGCCACGCTAGGG
CGTCACCTGGCTCGAAGACTAGTCCAGGTGGGTGTGAAGGACGTTTTCTCCGTGCCAGGTGACTTTAA
CCTCACCCTCCTCGACCACCTCATCGCGGAGCCGCAGTTGAAAAACGTTGGATGCTGCAACGAACTTA
ATGCTGGATACGCTGCGGACGGCTACGCGCGGTGCAGGGGCGTGGGCGCGTGTGCTGTCACGTTTACT
GTGGGAGGGTTGAGTGTGATAAACGCGATTGCGGGCGCGTACAGTGAGAACCTTCCGCTGATTTGTAT
CGTTGGTGGGCCCAACACGAACGACTTTGGTACTAACAGGATCTTGCATCACACCATTGGGTCGCCAG
ATTTCAGCCAAGAGCTCAGGTGCTTCCAAACAGTTACTTGCTATCAGGCTGTGGTGAATAACATAGAA
GATGCACATGAAATGATTGATACTGCGATCTCAACCTGTCTGAAAGAAAGCAAGCCTGTGTACATAAG
CATAAGTTGTAACTTGCCTGGCATTCCTCACCCCACATTCAGTCGTGAGCCAGTTCCATTTTCTCTGT
CTCCAAAATTGAGTAACAAGATGGGGTTGGAGGCAGCAGTGGAAGCAGCAGCAGAGTTCCTAAACAAG
GCAGTGAAGCCTGTAATGGTTGGTGGTCCAAAATTAAGGGTGGCTAAGGCATGTGATGCATTTGTTGA
ACTTGCTGATTCATGTGGTTATCCATTTGCTGTGATGCCATCAGCCAAGGGACTAGTCCCTGAGCACC
ATCCCCACTTCATTGGCACATTCTGGGGTGCTGTTAGCACCGCATTCTGCGCTGAGATCGTCGAATCC
GCTGATGCATACCTGTTTGCTGGCCCCAAAAACAATGACTACAGCTCGGTTGGGTACTCACTCCTCCT
CAAGAAGGAGAAGGCCATCCTTGTGCTGCCAGACCGTGTTGTGATCTCGAACGGACCCACGTTCGGGT
GTGTCCTCATGATGGATTTCCTCAAGGAACTAGCAAAGAGGCTCAAGCATAATAACACTGCTTATGAG
AACTACTCCAGGATTTTTGTCCCTGATGGAAAGCCATTGAAGGCTGAACCCAGAGAGCCTTTAAGGGT
TAATGTTCTGTTTAAGCATGTGCAAGATATGCTGTCTAGCGAAACTGCGGTGATTGCTGAGACAGGGG
ACTCTTGGTTTAACTGCCAGAAGCTGAAGTTGCCAAAGGGGTGTGGGTATGAGTTCCAAATGCAATAT
GGTTCAATTGGTTGGTCTGTTGGTGCAACTCTTGGTTATGCTCAGGCTGTTCCTGAGAAGAGAGTGAT
TTCTTGCATTGGTGATGGAAGCTTTCAGGTGACAGCTCAGGATGTGTCCACAATGCTGAGAAATGAGC
AGAAGAGCATCATCTTCCTGATAAACAATGGTGGATACACTATTGAAGTTGAAATTCATGATGGGCCA
TACAACGTGATTAAAAACTGGAACTACACTGGCTTGGTTGATGCAATCCACAATGGTGAAGGAAAATG
CTGGACCACTAAGGTTACATGTGAAGAAGAGCTTGTTGAGGCAATTCAGACAGCAACAGGAGTCAAGA
AGGATTGCTTGTGCTTCATTGAGGTAATTGTTCACAAGGATGACACAAGCAAAGAATTGCTTGAATGG
GGCTCTAGGGTTTGTGCTGCTAACGGTCGTCCTCCCAATCCTCAGTGA
Above-mentioned soybean Tolerant to low P gene Gm100776332 participate in soybean Tolerant to low P application, this research by using
Transgenic arabidopsis realizes that soybean vernalization gene Gm100776332 participates in resistance to inverse application；Especially by changes in energy metabolism
Regulate and control resistance to inverse approach.
Described uses transgenic arabidopsis to be realized using flower pesticide infestation method arabidopsis thaliana transformation.
Above-mentioned soybean Tolerant to low P gene Gm100776332 cloning process, and come in fact by using transgenic arabidopsis
Existing soybean Tolerant to low P gene Gm100776332 participates in the regulation of resistance to inverse approach, specifically includes following steps：
(1) excavation of the resistance to inverse gene of soybean：Magnificent No. 5 soya seeds surface sterilizations of spring, by the seed kind sterilized in quartz
In sand, after germination when seedling grows true leaf (true leaf expansion), the seedling for selecting growing way consistent is moved to containing different phosphorus concentrations 1/
Continue to cultivate in 2Hoagland nutrient solutions.When plant to be gone to processing 48h in without phosphorus liquid medium then, take 2cm left
The right soybean tip of a root.Protein is extracted, is further verified by iTRAQ detections and data analysis, and using qPCR methods,
QPCR obtains identical result with iTRAQ technologies.Find that PDC occurs significantly to change in the expression quantity of Each point in time.
The gene is found by NCBI, is named as Gm100776332.
(2) clone of soybean Gm100776332 genes：The same a collection of Soybean Root point material for taking iTRAQ to determine, Ran Houyong
TRIzol extraction methods carry out RNA extraction and reverse transcription is into cDNA, have cloned Gm100776332 CDS sequences.Its length
Spend for 1812bp, contain 277bp 5 ' non-translational regions, 214bp 3 ' non-translational regions and 1812bp open reading frame.
It is compared after sequencing, Gm100776332 sequence is consistent with the reference sequences of William 82.Connect pZeroBack/Blunt
Vector carriers are sequenced；After identification is correct in conversion Agrobacterium.
(3) arabidopsis is carrier to realize that the resistance to inverse gene Gm100776332 of soybean participates in Tolerant to low P regulation experiment：First
The genetic transformation of arabidopsis is carried out, the screening of Gm100776332 genetic transformation arabidopsis positive plants, turns arabidopsis Tolerant to low P
Gene time point qPCR checking.In order to further appreciate that Gm100776332 function, we constructed scale for this research
Heterologous transformant is carried out to arabidopsis up to carrier.Obtained T0 is passed through in the screening and culturing medium containing 20mg/L hygromycin for seed and trained
Support, resistant seedling is moved into Nutrition Soil after 10 days.After obtaining T1 generations, 20 plants of T1 of the above are taken to extract base for plant leaf
Because of a group STb gene, make positive control with DNA, WT lines DNA and water make negative control, expand hygromycin gene.Just
Step demonstrates target gene Gm1007763321 and has been incorporated into the genome of arabidopsis.Wildtype Arabidopsis thaliana is carried out simultaneously
With the measure of transgenic Arabidopsis plants soluble sugar content, the expression quantity of transgenic arabidopsis has significantly compared with wild type
Improve.Therefore, tested by this, thus it is speculated that the gene may participate in soybean Tolerant to low P mechanism.
Testing result shows that we construct Overexpression vector and carry out heterologous transformant to arabidopsis.Obtained T0 generation kinds
Son moves into resistant seedling in Nutrition Soil through being cultivated in the screening and culturing medium containing 20mg/L hygromycin after 10 days.Obtain
After T1 generations, take 20 plants of T1 of the above to extract genome DNA for plant leaf, make positive control, WT lines with DNA
DNA and water make negative control, expand hygromycin gene.As a result show, 15 plants of Arabidopsis plants can amplify and positive control phase
With the DNA bands of size, 5 plants of arabidopsis have no and amplify purpose band.
The present invention is had the following advantages relative to prior art and effect：
1st, the present invention obtains the gene Gm100776332 of Tolerant to low P sequence information by Genebank databases,
And Gm100776332 is named as, and Gm100776332, length 1812bp have been cloned in the cultivated soybean China spring No. 5, comprising
277bp 5 ' non-translational regions, 214bp 3 ' non-translational regions and 1812bp open reading frame.
2nd, the present invention has cloned soybean vernalization gene Gm100776332, and the function of its Tolerant to low P is applied.This
Invention includes soybean Tolerant to low P gene Gm100776332 clone and PCR primer design and reaction condition, further comprises simultaneously
To illustrating that soybean Tolerant to low P gene Gm100776332 participates in the application of Tolerant to low P approach using transgenic technology.
3rd, the present invention first by Gm100776332 genes in arabidopsis overexpression, it was demonstrated that the gene is successfully integrated
Into arabidopsis gene group.
4th, the present invention is measured with qPCR methods to the expression quantity of transgenic arabidopsis, and confirms that the gene is
One function protein, and participate in the Tolerant to low P approach of soybean.
Brief description of the drawings
Fig. 1 is the lower glycolysis regulatory mechanism figure of low-phosphorous condition processing, and * * represent up-regulated gene, * represents down-regulated gene；
Fig. 2 is the CDS Sequence Detection result figures that agarose gel electrophoresis detection amplifies the Gm100776332 genes come；
M,DL2000 DNA maker；1-2, Gm100776332 CDS sequence PCR primers；
Fig. 3 is T1 for Gm100776332 transgenic arabidopsis PCR qualification result figures；M is DL2000 DNA Marker；P
Compareed for positive plasmid；H2O:H2O is masterplate；WT, WT lines control；1-20 is transgenic arabidopsis DNA to be identified
Masterplate；
Fig. 4 is the expression quantity of transgenic arabidopsis and wildtype Arabidopsis thaliana soluble sugar under the processing of low-phosphorous condition.
Embodiment
With reference to embodiment and accompanying drawing, the present invention is described in further detail, but embodiments of the present invention are not
It is limited to this.
The iTRAQ technologies of embodiment 1 carry out low-phosphorous processing to Tolerant to low P and phosphorus responsive type soybean, are visited with iTRAQ technologies
Beg for its regulatory mechanism；
The soybean tip of a root after crushing (processing 48h) is taken out from -80 DEG C of refrigerators to be put into the mortar with Liquid nitrogen precooler, is added
Enter liquid nitrogen grinding into powder, extract protein；Quantification of protein and albumen FASP (FilterAided Sample
Preparation) method enzymolysis and iTRAQ reagents mark；The high pH-RP liquid phases of first dimension and the second anti-phase LC-MS of dimension
RPLC-MS；Data retrieval and analysis of biological information.
The clone of the soybean Gm100776332 genes of embodiment 2
Selected No. 5 soya seeds of magnificent spring are clean with aseptic water washing after 10%H2O2 surface sterilizations 1min, are transferred to
With being placed in vernalization in dark in river sand.After three days, the seedling for selecting neat and consistent is transferred to 1/2 Hoagland nutrient solutions relaying
Continuous culture, condition of culture is dark for 12h illumination/12h, 50% humidity.Proper Sampling Period is four leaf stage, and sample time is illumination
10h after beginning, sampling point are plant above ground portion, RNA extractions are carried out after liquid nitrogen flash freezer, using primers F：5-ggatccATGAA
CACTAACATCCTCGGCG-3；Primer R：5-ggtaccTCACTGAGGATTGGGAGGACG-3 carries out RT-PCR, passes through
TaKaRa glue reclaims and purification kit are reclaimed, and recovery product connection sequencing vector, bacterium solution are carried out after converting Escherichia coli
PCR identification, sequencing.As a result (Fig. 3) is shown：Its length is 1812bp gene, contains 277bp 5 ' untranslateds
Area, 214bp 3 ' non-translational regions and 1812bp open reading frame.Be compared after sequencing, GmVRN1 sequence and
The reference sequences of William 82 are consistent.
The genetic transformation of the arabidopsis of embodiment 3 and screening
Processing before transformation of Arabidopsis thaliana：When the main tongue of arabidopsis is grown to 5-6cm, whole inflorescence is cut in inflorescence base portion, is gone
Its apical dominance.4-6 newborn side tongues are grown at axillary bud position after 1 week, treat its side tongue inflorescence form bud and part bloom or
It can be used to convert when forming 1-2 silique, need to cut off the silique grown up to before conversion；By the agrobacterium liquid or flat board of storage
The Agrobacterium of preservation draws plate activation on the flat board containing antibiotic；The monoclonal positive agriculture containing target gene of picking activation
In the YEP liquid training base that bacillus contains antibiotic to 5mL, 28 DEG C, 250rpm is activated overnight；Above-mentioned dip dyeing liquid for shell is poured on beaker
In, plant to be transformed is tipped upside down in dip dyeing liquid for shell rapidly, taken out after making inflorescence submergence 2min.It is as far as possible careful during operation, should not
Allow soil bits etc. to fall to contaminate in culture medium；Excessive bacterium solution is sucked after conversion with blotting paper, but need not inhale too dry.Will
Plant keeps flat, and covers arabidopsis aerial part with black plastic bag.After moisturizing light culture 16-24h, carefully remove polybag,
And water is poured, recover normal illumination；After about two weeks, it can be tentatively judged to turn base if viridescent plant grows
Because of plant, move it into soil and continue to cultivate, for sowing and follow-up Molecular Identification.Nontransgenic plants are in hygromycin
Normal growth is unable under screening, eventually yellow is dead, while the hygromycin gene of transfer-gen plant is detected by PCR.
As a result show (Fig. 4)：Obtained T0 is passed through in the screening and culturing medium containing 20mg/L hygromycin for seed and cultivated, and 10
Resistant seedling is moved into Nutrition Soil after it.After obtaining T1 generations, take total for plant leaf extraction genome with 20 plants of T1
DNA, make positive control with DNA, WT lines DNA and water make negative control, expand hygromycin gene.As a result show,
14 plants of Arabidopsis plants can amplify the DNA bands with positive control formed objects, preliminary proof target gene
Gm100776332 has been incorporated into the genome of arabidopsis.
The measure of the transgenic arabidopsis soluble sugar expression contents of embodiment 4；
In order to parse gene Gm100776332 Tolerant to low P efficiency, this project is to transgenic arabidopsis and wildtype Arabidopsis thaliana
Soluble sugar content be determined, under low-phosphorous environmental condition, transgenic arabidopsis and wild type are carried out at stress
48h is managed, then carrying out soluble sugar content to transgenic arabidopsis and wildtype Arabidopsis thaliana is measured, in the result of measure
The middle soluble sugar content for finding transgenic arabidopsis is all remarkably higher than wildtype Arabidopsis thaliana.It is resistance to low to speculate that the gene take part in
Phosphorus approach, by conventional report, PDC participates in energetic supersession and metabolism in plant, response anoxic, low temperature, high salt
Etc. a variety of biotic and abiotic stress.But participate in tolerant to low-phosphorus stress and have no report.
Above-described embodiment is the preferable embodiment of the present invention, but embodiments of the present invention are not by above-described embodiment
Limitation, other any Spirit Essences without departing from the present invention with made under principle change, modification, replacement, combine, letter
Change, should be equivalent substitute mode, be included within protection scope of the present invention.
Claims (6)
- A kind of 1. Tolerant to low P gene Gm100776332 cloning process, it is characterised in that：Using primers F such as SEQ ID NO：2 institutes Show；Primer R such as SEQ ID NO：Shown in 3, reverse transcription PCR, 94 DEG C of 3min pre-degenerations, 94 DEG C of denaturation 30s, 56 DEG C of annealing are carried out 45s, 72 DEG C of extension 1min, 72 DEG C re-extend 10min after 32 circulations；Cloned in the cultivated soybean China spring No. 5 Gm100776332。
- A kind of 2. Tolerant to low P gene Gm100776332, it is characterised in that：Obtained as the cloning process described in claim 1, it is described Soybean Tolerant to low P gene Gm100776332 nucleotide gene sequence such as SEQ ID NO：Shown in 1.
- 3. soybean Tolerant to low P gene Gm100776332 as claimed in claim 2, its additional technical feature are：It is resistance in participation Application in inverse approach.
- 4. applications of the soybean Tolerant to low P gene Gm100776332 according to claim 3 in Tolerant to low P approach is participated in, its It is characterised by：The application of soybean Tolerant to low P base Gm100776332 regulations is realized by using transgenic arabidopsis.
- 5. soybean Tolerant to low P gene Gm100776332 according to claim 4 answering in participating in glycolytic pathway With, it is characterised in that：Described uses transgenic arabidopsis to be realized using flower pesticide infestation method arabidopsis thaliana transformation.
- 6. applications of the soybean Tolerant to low P gene Gm100776332 as claimed in claim 5 in participating in glycolytic pathway, It specifically includes following steps：(1) excavation of the resistance to inverse gene of soybean：Magnificent No. 5 soya seeds surface sterilizations of spring, by the seed kind sterilized in quartz sand, After germination when seedling grows true leaf (true leaf expansion), the seedling for selecting growing way consistent is moved to containing different phosphorus concentrations 1/ Continue to cultivate in 2Hoagland nutrient solutions.When plant to be gone to processing 48h in without phosphorus liquid medium then, 2cm or so is taken The soybean tip of a root.Protein is extracted, is further verified by iTRAQ detections and data analysis, and using qPCR methods, qPCR Identical result is obtained with iTRAQ technologies.Find that PDC occurs significantly to change in the expression quantity of Each point in time.Pass through NCBI finds the gene, is named as Gm100776332；(2) clone of soybean Gm100776332 genes：The same a collection of Soybean Root point material for taking iTRAQ to determine, then uses TRIzol Extraction method carries out RNA extraction and reverse transcription is into cDNA, has cloned Gm100776332 CDS sequences.Its length is 1812bp, contain 277bp 5 ' non-translational regions, 214bp 3 ' non-translational regions and 1812bp open reading frame.After sequencing It is compared, Gm100776332 sequence is consistent with the reference sequences of William 82.Connect pZeroBack/Blunt vector Carrier is sequenced；After identification is correct in conversion Agrobacterium；(3) arabidopsis is carrier to realize that the resistance to inverse gene Gm100776332 of soybean participates in Tolerant to low P regulation experiment：Intended first The genetic transformation of southern mustard, the screening of Gm100776332 genetic transformation arabidopsis positive plants, when turning the gene of arabidopsis Tolerant to low P Between point qPCR verify.In order to further appreciate that Gm100776332 function, we construct Overexpression vector to intending for this research Southern mustard carries out heterologous transformant.Obtained T0 is passed through in the screening and culturing medium containing 20mg/L hygromycin for seed and cultivated, handle after 10 days Resistant seedling is moved into Nutrition Soil.After obtaining T1 generations, take 20 plants of T1 of the above to extract genome DNA for plant leaf, use DNA makees positive control, and WT lines DNA and water make negative control, expand hygromycin gene.Preliminary proof purpose base Because Gm1007763321 has been incorporated into the genome of arabidopsis.Wildtype Arabidopsis thaliana has been carried out simultaneously and transgenic arabidopsis is planted The measure of strain soluble sugar content, the expression quantity of transgenic arabidopsis are significantly improved compared with wild type.Therefore, by this Experiment, thus it is speculated that the gene may participate in soybean Tolerant to low P mechanism.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611218485.7A CN107641624B (en) | 2016-12-26 | 2016-12-26 | Cloning method and functional verification of soybean low-phosphorus-resistant gene Gm100776332 |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611218485.7A CN107641624B (en) | 2016-12-26 | 2016-12-26 | Cloning method and functional verification of soybean low-phosphorus-resistant gene Gm100776332 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107641624A true CN107641624A (en) | 2018-01-30 |
| CN107641624B CN107641624B (en) | 2021-02-26 |
Family
ID=61109812
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201611218485.7A Active CN107641624B (en) | 2016-12-26 | 2016-12-26 | Cloning method and functional verification of soybean low-phosphorus-resistant gene Gm100776332 |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107641624B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112898395A (en) * | 2021-03-16 | 2021-06-04 | 华南农业大学 | Aluminum-resistant related gene GmNAC069, and coding protein and application thereof |
| CN115644055A (en) * | 2022-10-14 | 2023-01-31 | 吉林省农业科学院 | Low-phosphorus-resistant breeding and culturing method for soybean |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104928284A (en) * | 2015-06-30 | 2015-09-23 | 华南农业大学 | Soybean vernalization gene GmVRN1 and colonizing method and application thereof |
-
2016
- 2016-12-26 CN CN201611218485.7A patent/CN107641624B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104928284A (en) * | 2015-06-30 | 2015-09-23 | 华南农业大学 | Soybean vernalization gene GmVRN1 and colonizing method and application thereof |
Non-Patent Citations (2)
| Title |
|---|
| GENBANK: "《登录号：XM_003520362》", 《GENBANK》 * |
| 丁洪: "《酸性磷酸酶活性与大豆耐低磷能力的相关研究》", 《植物营养与肥料学报》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112898395A (en) * | 2021-03-16 | 2021-06-04 | 华南农业大学 | Aluminum-resistant related gene GmNAC069, and coding protein and application thereof |
| CN112898395B (en) * | 2021-03-16 | 2022-09-02 | 华南农业大学 | Aluminum-resistant related gene GmNAC069, and encoding protein and application thereof |
| CN115644055A (en) * | 2022-10-14 | 2023-01-31 | 吉林省农业科学院 | Low-phosphorus-resistant breeding and culturing method for soybean |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107641624B (en) | 2021-02-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109750047B (en) | Tea tree hexose transporter gene CsSWEET17 and application thereof in regulating and controlling vegetative growth and seed size of plants | |
| CN112321694B (en) | Wheat leaf rust resistance protein and coding gene and application thereof | |
| CN102174527B (en) | Application of upright dense cluster genes in improvement of utilization efficiency of nitrogen fertilizer | |
| CN105367644A (en) | Plant stress tolerance associated transcription factor, encoding gene of plant stress tolerance associated transcription factor, and application of encoding gene | |
| CN109971880A (en) | For detecting the nucleic acid sequence and its detection method of corn plant DBN9508 | |
| CN113621625B (en) | Application of sesame SiERF103 gene in enhancing plant resistance | |
| CN105838726B (en) | A kind of Salt Tolerance Gene in Alfalfa gene M sCDPK and its coding albumen and application | |
| CN107022015A (en) | Chinese small iris heavy metal ATP enzyme transport protein IlHMA2 and its encoding gene and application | |
| CN113322261B (en) | Application of soybean ABC transporter gene GmALS3 in breeding of low-phosphorus-resistant and aluminum-toxicity-resistant plants | |
| CN107641624A (en) | The cloning process of soybean Tolerant to low P gene Gm100776332 a kind of and functional verification | |
| CN103266130B (en) | Soybean water channel protein gene GmPIP1; The application of 2 | |
| CN102899333B (en) | Rice salt stress related gene SIDP364 and coding protein and application thereof | |
| CN106892973A (en) | Plant adversity resistance related protein GhMYB4 and encoding gene and application | |
| CN110452917A (en) | The application of bryony VyGOLS gene and its coding albumen in drought stress | |
| CN107325161A (en) | A kind of albumen related with high-salt stress to resistance to Low nitrogen stress and its encoding gene and application | |
| CN103074351B (en) | Synthetic EPSPS gene for transgenic herbicide resistant plant | |
| CN105177002A (en) | miR159a related to barley powdery mildew resistance and application thereof | |
| CN103172718B (en) | Plant low nitrogen stress resistant related protein GmDUF-CBS and encoding gene and application thereof | |
| CN103923922B (en) | Heavy metal evoked promoter is cultivating the application in heavy metal pollution of soil early warning transgenic plant | |
| CN110295174A (en) | The transgenic arabidopsis strain and its construction method of FIPV gene overexpression | |
| CN1944648B (en) | Rice Cyp2 gene for increasing plant salt tolerance | |
| CN104928284A (en) | Soybean vernalization gene GmVRN1 and colonizing method and application thereof | |
| CN109971764A (en) | Rice Os NRT2.1 gene is improving the application in the manganese element content in rice grain | |
| CN108148851A (en) | A kind of rice rhodanese encoding gene OsRHOD1;2 and its application | |
| CN108753816A (en) | The transgenic arabidopsis strain and its construction method of SYTA gene overexpressions |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |