CN1944648B - Rice Cyp2 gene for increasing plant salt tolerance - Google Patents

Abstract

The present invention discloses one rice Cyp2 gene for raising plant salt tolerance and possessing the base sequence as shown in SEQ ID No. 1 in the sequence list. One protein related to the salt tolerance of rice is first separated and identified fast by means of the protein group technology based on 2-D electrophoresis and mass spectrography; and the Cyp2 gene is then proved to have the function of raising plant salt tolerance by means of genome and biochemical measures. Transferring the salt tolerance Cyp2 gene to rice, strawberry, flower and other plants can raise their salt tolerance to raise yield and quality.

Description

A kind of rice Cyp 2 gene that improves plant salt endurance

Technical field

The present invention relates to functional genomics, especially a kind of rice Cyp 2 gene that improves plant salt endurance.

Background technology

The soil salinization is a global problem to the threat of agricultural.The whole world has 1,000,000,000 hectares saltings, accounts for world land area 7.6%, nearly more than 100,000,000 hectares of China saltings, agricultural plough 500,000,000 mu nearby of the underproduction, the abandoned lands that cause because of salinification.In recent years; fast development along with China's industrialized agriculture; particularly vegetables and flower shed are produced the expansion of area; these protection ground are excessive because of fertilizer amount; upper soll layer moisture constantly evaporates; make deep layer moisture constantly by moving on the capillary action, cause the deep soil salinity to be accumulated to the top layer, aggravated the secondary salinization process on protection ground.Mainly take two kinds of measures for the utilization of salinization soil, the one, improve the soil with chemistry or physical method; The 2nd, cultivate the salt tolerant crop kind by conventional hybridization or biotechnology.But the former is the input cost height not only, and along with using of a large amount of chemical substances increased the weight of the secondary salinization of soil, therefore, excavates the plant salt tolerance genetic resources, and the crop varieties of cultivating salt tolerant just seems very important.

Salinity is divided into osmotic stress, ion injury, ion imbalance or nutritive deficiency three classes to plant stress, and osmotic stress and ion injury are considered to two main processes to plant hazard at present.The salt tolerance of plant generally speaking can be divided into form salt tolerant and physiology salt tolerant.Under salt stress, because extraneous osmotic pressure is lower, plant absorbing moisture difficulty, the water deficit phenomenon can take place in cell.Plant can initiatively accumulate some soluble substances for fear of this injury, reduces the osmotic potential of cell, thereby moisture is successfully entered in the plant materials, guarantees the carrying out of plant normal physiological activity.Under condition of salt stress, plant salt endurance is regulated by multiple physiological mechanism.On the one hand, the small molecules compatible solute as: a large amount of accumulation in plant materials such as proline(Pro), soluble sugar, fructose, sucrose, polyamines play the osmoregulation effect to plant salt endurance.On the other hand, some functional proteins as: ooze and transfer albumen, proline(Pro) synthetic enzyme (P5CS), channel protein (aquaporin and potassium channel protein), Lea albumen (later stage embryo generation rich protein) and stride film transport protein (plasma membrane H ⁺-ATPase and vacuole skin H ⁺-ATPase) wait and to be subjected to salt to induce that high expression level can slow down the plant salt damage in plant materials.Na in the plant materials ⁺Ionic equilibrium is the important mechanisms that plant self salt tolerant is regulated.The adjustment signal of the quantitative character gene SKCl that for example Arabidopis thaliana SOS serial genes is relevant with the paddy rice salt tolerant is that plant self is regulated Na ⁺Ionic equilibrium or keep sodium and the important channel of potassium balance.

In recent years, along with the foundation of high throughput protein group technology such as two-dimensional electrophoresis, mass-spectrometric technique, protein biochip technology and yeast two-hybrid, quickened the development of plant protein group.Protein group is meant all protein of an organism genomic expression.Wanting " all protein " in postgraduate's object is a very thing of difficulty.The biologist has proposed the notion of functional protein group at present, set about from the part, pay attention to studying those protein that may relate to specific function mechanism all therefore, set about the function of research marking protein under different physiological conditions from the organ with specific function, tissue, the cell of an organism.

Many results of study show that utilization can successfully separate with the biological mass spectrometry technology based on 2-D and identify the relevant protein of rice seedling salt tolerance.These protein mainly participate in carbohydrate, nitrogen and energy metabolism adjusting, reactive oxygen species removing, mRNA and albumen processing and cytoskeleton stability.But above-mentioned protein is only separated on protein expression profiles level and kind and is identified, does not provide it to have the function evidence that changes plant salt endurance.

Summary of the invention

The invention provides a kind of rice Cyp 2 gene that improves plant salt endurance.

A kind of rice Cyp 2 gene that improves plant salt endurance has the described base sequence of SEQ ID NO.1 in the sequence table.

The rice Cyp 2 gene encoded protein matter of described raising plant salt endurance has the described aminoacid sequence of SEQ ID NO.3 in the sequence table.

The expression vector that contains the rice Cyp 2 gene of the described raising plant salt endurance of claim 1.

The transgenic cell line that contains the rice Cyp 2 gene of the described raising plant salt endurance of claim 1.

Utilization of the present invention is based on the protein technique of 2-D electrophoresis and mass spectroscopy, separate and evaluation paddy rice salt tolerance related protein, according to protein and nucleic acid database Query Results such as Expasy, NCBI, TIGER, obtain paddy rice salt-resistant related gene (or protein) sequence information, confirm gene function by means such as functional genomics and biochemistry then.

Gene source:

With hybrid rice salt tolerant combination Shan excellent No. 10 and the responsive combination of salt two line system is material, seed is broadcast containing NaCl solution soaked in the filter paper culture dish, places incubator to germinate, and changes salts solution every day, to keep the salt concn basically identical.Treat that growth of seedling is to 10d, the blade of excellent No. 10 and two line system seedling of collection research Shan respectively, with cold acetone/trichloroacetic acid precipitation method rapid extraction leaf total protein, through bidimensional electrophoretic separation, with PDQUEST software analysis glue figure match condition, found that high expression level protein site in excellent No. 10 seedling leaves of Shan.On glue, downcut this protein site, use trypsin Trypsin) carry out digestion (In-gel digest) in the glue, extract enzyme and cut product, vacuum-drying with the trifluoroacetic acid dissolving, is analyzed solute then with substance assistant laser desorpted ionization flight mass spectrum (MALDI-TOF-MS), obtain peptide quality fingerprinting (Peptide Mass Fingerprint, PMF) collection of illustrative plates, inquiry Mascot database is compared rice cell antibody cyclophilin 2 albumen with high score.Analyze the aminoacid sequence that is separated to 3 peptide sections in the above-mentioned solute with series connection electrospray ionization mass spectrum (ESI-MS/MS) then, 3 peptide section sequences all are contained in the rice cell antibody albumen as a result, confirm that further this albumen is rice cell antibody albumen.

Aminoacid sequence according to existing rice cell antibody cyclophilin 2, by NCBI and TIGER database search, compare the gene of coding rice cell antibody albumen peptidylprolylisomerase Cyp2, gene number is Os02g02890 (or OSJNBb0088N06.23).This gene ORF (open reading frame) is 519bp, and mRNA length is 885bp.

Gene clone and conversion:

Total mRNA is a template with excellent No. 10 seedling of Shan (broadcasting back 10 days), utilize the increase encoding sequence of peptidylprolyl isomerase Cyp2 gene of RT-PCR method, then the Cyp2 gene is packed in the PMD18-T carrier, correct through checking order, cut with EcoRI and HindIII enzyme, reclaim gene fragment, be connected into then in the Super1300 carrier, change the GV3101 Agrobacterium again over to, after identifying correctly, soak method transformation mode plant Arabidopis thaliana, containing screening transgenic arabidopsis positive plant on the MS solid medium of Totomycin by agriculture bacillus mediated flower, numerous kind and identify generation, obtain 12 strains systems of transgenosis of isozygotying to T3.

Gene salt tolerant Function Identification:

In T3 generation, isozygotys and cultivates 7d after transgenic line and wild-type ((ecotype Columbia)) the Arabidopis thaliana seed treatment, observes the growth of seedling situation.After treating that seedling cotyledon launches fully, the seedling of transgenic line and wild-type moved into respectively contain on NaCl and the normal MS substratum, place the incubator of identical light and temperature condition to cultivate then.After cultivating 12-15d, observe transgenic line and the phenotype of wild-type seedling under high-salt stress.Found that containing in the 170mM NaCl MS cultivation that albefaction death appears in wild-type seedling radical leaves, still keep green and change Cyp2 gene strain system; And under 200mM NaCl, the whole albefaction death of wild-type seedling, change Cyp2 gene strain system and only albefaction death occurs, and still keep green, illustrate that Cyp2 gene overexpression in plant can alleviate the plant salt damage at growth of seedlings point and rest blade at seedling base portion 1-2 Lao Ye.

Beneficial effect of the present invention:, can improve Arabidopis thaliana seedling salt tolerance with resistant gene of salt Cyp2 transformation mode plant Arabidopis thaliana.If with plants such as vegetables such as resistant gene of salt Cyp2 rice transformation or strawberry, flowers, might improve plant salt endurance, on the one hand, can increase paddy rice or outdoor vegetable, the flowers output on the saltings, improve the utilization in the saltings of our province coastal region; On the other hand, can overcome the continuous cropping obstacle that causes because of the soil accumulation of salt in the surface soil under the facility condition, improve the yield and quality of plants such as vegetables, flowers, increase farmers' income.

Embodiment

If relating to the special unit of indicating that do not have of concentration, content, following content is mass percent concentration or content

The acquisition of gene

With hybrid rice salt tolerant combination Shan excellent No. 10 and the responsive combination of salt two line system is material, seed is broadcast containing 100mM NaCl solution soaked in the filter paper culture dish, places 30 ℃ of incubators to germinate, and changes salts solution every day, to keep the salt concn basically identical.Treat growth of seedling to 10d, collect the blade of excellent No. 10 and two line system seedling of Shan respectively.

With cold acetone/trichloroacetic acid precipitation method (by improving one's methods of Salekdeh etc.: Salekdeh G H, Siopongco J, Wade L J, Ghareyazie B, Bennett J.A proteomic approach toanalyzing drought-and salt-responsiveness in rice.Field Crop Res, 2002,76 (2-3): 199～219) rapid extraction leaf total protein, method is as follows:

Rice leaf becomes fine powder with liquid nitrogen grinding, divide in the 1.5ml centrifuge tube of packing into, add 1ml protein extract I (acetone soln that contains 10% trichoroacetic acid(TCA) and 0.07% beta-mercaptoethanol) at-20 ℃ of precipitation crude protein 1h, at 4 ℃ of centrifugal 20min of following 13000rpm, get precipitation, abandon supernatant, and then add 1ml protein extract II (acetone soln that contains 0.07% beta-mercaptoethanol) at-20 ℃ of suspension crude protein ball 1h, at 4 ℃ of centrifugal 20min of following 13000rpm, get precipitation, abandon supernatant, repeat again to suspend under the same conditions and clean 3 times with protein extract II, vacuum drain crude protein dry powder, use the lysate dissolution precipitation, and at room temperature place 1h, continuous vortex is 5-6 time/hour between burst times.Contain 7mol/L urea, 2mol/L thiocarbamide, 4%Chaps (U.S. Ameresco company), 50mmol/L DTT (U.S. Promega company) and 0.5% amphotericeledrolyte pH3-10 in the lysate, the lysate consumption is 25 μ l lysates/mg precipitation.

According to Bradford method (Bradford M M.A rapid and sensitive method for thequantitation of microgram quantities of protein utilizing the principle ofprotein-dye binding.Anal Biochem, 1976,72:248-54) measure protein content with Coomassie brilliant blue G-250 (Sigma company), through bidimensional electrophoretic separation (sex change/SDS-2D-PAGE, adopt the IPGs immobilized ph gradient strip (Bio-Rad company) of 17cm pH7-10, first to isoelectrofocusing divide four the step carry out, the first step, voltage 250V 15min; Second step, voltage 10000V 5h; The 3rd step, voltage 10000V, 60000Vh; In the 4th step, voltage 500V is up to end.First to isoelectrofocusing to second to when conversion, need the balance adhesive tape, carry out in two steps, the first step, (contain 6.0mol/L urea at balance liquid I, 2%SDS (U.S. Promega company), 0.375mol/L Tris-HClpH 8.8 (U.S. Promega company), 20% glycerine and 130mmol/L DTT (U.S. Promega company)) middle balance 10min, second step, (contain 6.0mol/L urea at balance liquid II, 2%SDS (U.S. Promega company), 0.375mol/L Tris-HCl pH 8.8 (U.S. Promega company), 20% glycerine and 135mmol/L iodo-acid amide) middle balance 10min, transfer to second then to SDS-2D-PAGE glue, run glue and adopt constant current, the electric current 24mA of every glue, operation 5-6h.), dye colour developing with silver and (use fixedly 30min of 500ml stationary liquid (40% methyl alcohol+10% acetate), use 500ml cma staining liquid (to contain 3.6% sodium hydroxide 10.5ml among the 500ml then, 20% Silver Nitrate 9ml and 5ml ammoniacal liquor) dyeing 32-33min, with distilled water flushing 4 times, then with 500ml liquid (containing 1% citric acid 2.5ml and formaldehyde 250 μ l among the 500ml) the colour developing 5-12min that develops the color, use 500ml 5% acetic acid termination reaction 5min at last), scanning, with PDQUEST (Bio-Rad company) software analysis glue figure match condition, found that high expression level protein site in excellent No. 10 seedling leaves of Shan, estimate its iso-electric point and molecular weight and be respectively about pI 9.0 and 19 KD.

On glue, downcut this protein site, with 8 μ l 10ng/ μ l trypsin Trypsin, Roche, the U.S.) (25mM ammonium bicarbonate soln, pH 8.0) carry out digestion (In-gel digest) in the glue: place 4 ℃ of refrigerators to place 40min and make film absorb enzyme liquid fully, add 10 μ l 25mM ammonium bicarbonate buffers again, in 37 ℃ of incubation 12h.

Extract enzyme and cut product: with 30-50 μ l 5%TFA (Merk company, Germany) extract enzymes in 40 ℃ and cut peptide section 1 hour once, use 50%ACN/2.5%TFA (the Merk company of equal volume again, Germany) solution extracts 1 hour once in 30 ℃, use 25 μ l CAN (Fischer companies at last, the U.S.) supersound extraction once merges No. 3 times extracting solution.Vacuum-drying, dissolve with 4 μ l, 0.5% trifluoroacetic acid then, 0.6 μ l solute is analyzed with substance assistant laser desorpted ionization flight mass spectrum (MALDI-TOF-MS), obtain peptide quality fingerprinting (Peptide Mass Fingerprint, PMF) collection of illustrative plates, inquiry Mascot database is compared rice cell antibody cyclophilin 2 albumen significantly (to compare to divide and to be higher than 65) than high score (115), and matching sequence accounts for overall amino acid sequence 38%.Analyze the aminoacid sequence that is separated to 3 peptide sections in the above-mentioned solute with series connection electrospray ionization mass spectrum (ESI-MS/MS) then, found that 3 peptide section sequences all are contained in the rice cell antibody albumen, confirm that further this albumen is rice cell antibody albumen.

Aminoacid sequence according to existing rice cell antibody cyclophilin 2 (Cyp2), by NCBI and TIGER database search, compare the gene of coding rice cell antibody albumen peptidylprolyl isomerase Cyp2, gene number is Os02g02890 (or OSJNBb0088N06.23).This gene ORF (open reading frame) is 519bp, and mRNA length is 885bp.

Gene clone and conversion

Total mRNA is a template with excellent No. 10 seedling of Shan (broadcasting back 10 days), utilizes the increase encoding sequence of peptidylprolyl isomerase Cyp2 gene of RT-PCR method.

Concrete operations are as follows: at first, the mRNA reverse transcription is become the first chain cDNA, the SUPERSCRIPTTM III that used reverse transcription test kit is a GIBCOBRL company, reaction system 20 μ l, add 1 μ l oligo dT, 1 μ l 10mM dNTP, 5 μ g RNA and DEPC water to 13 μ l successively, 65 ℃ of sex change 5 minutes, rapidly cooled on ice at least 1 minute, centrifugal a little, add 4 μ l, 5 * First-Strand buffer, 1 μ l 0.1M DTT, 1 μ l RNase OUT then successively ^TMRecombinant RNase inhibitor and 1 μ l SuperScript ^TMIII RT.Slightly mix, 50 ℃ of reactions 60 minutes, 70 ℃ made enzyme deactivation in 15 minutes.In order to remove chain, add 1 μ l RNase H at 37 ℃ of incubation 20min ,-20 ℃ of preservations with cDNA complementary RNA.Then with the first chain cDNA for touching plate amplifying target genes Cyp2, used amplification pairing primer:

Cyp2-F，5’-GAATTCATGTCGAACACGAGGGTGTT-3’，

Cyp2-R，AAGCTTCTAGGAGAGCTGGCCGCAGT，

The PCR reaction system is 50 μ l, add 10 * PCR buffer, 5 μ l, 10mM dNTPs1 μ l, reverse transcription product 5 μ l, 10 μ M forward primers (Cyp2-F), 1 μ l, 10 μ M reverse primers (Cyp2-R), 1 μ l, 5U/ μ l Tag archaeal dna polymerase 0.5 μ l successively, add water to 50 μ l at last.The PCR reaction conditions: 95 ℃ of pre-sex change, 95 ℃ of 30s of sex change, the 58 ℃ of 30s that anneal extend 72 ℃ of 1min, and 72 ℃ of 10min are extended in 30 circulations at last, 4 ℃ of preservations.

After the amplification Cyp2 gene packed in the pMD18-T carrier: the pMD18-T carrier is produced by TakaRa company.The DNA and the pMD18-T carrier that reclaim the Cyp2 gene of purifying are carried out ligation, linked system 10 μ l, each component is respectively DNA, the 5 μ l Solution I of the Cyp2 gene of 0.5 μ l pMD18-T carrier, 4.5 μ l purifying.Connect 8～12 hours down at 14 ℃～16 ℃, will connect product then and be transformed in the bacillus coli DH 5 alpha competent cell.

The Cyp2 gene pack into the pMD18-T carrier after order-checking is correct, cut with EcoRI and HindIII enzyme that TakaRa company produces, operate as follows: enzyme is cut system 40 μ l, comprise that 4 μ l10 * buffer, 8 μ l have inserted the pMD18-T carrier of Cyp2 gene, 1 μ l EcoRI, 1 μ l HindIII and 26 μ l water, incubation 6h in 37 ℃ of water-baths.

The Glassmilk kit that produces with vast Tyke, Beijing biotech company reclaims gene fragment, operates as follows: downcut required dna fragmentation from sepharose, be placed in the Eppendorf pipe of 1.5ml.Add the sol solutions of 3 times of volumes, place 5min under the room temperature, during jog Eppendorf pipe glue is dissolved fully.Add 10 μ l glass milk, put upside down mixing, ice bath is placed 10min down.Every 2-3min mixing 1 time, the centrifugal 30s of 12000rpm inhales and abandons supernatant.Add 250 μ l rinsing liquids, blow and beat rinsing liquid with pipettor, the suspension mixing of gently glass being suckled, the centrifugal 30s of 12000rpm inhales and abandons supernatant.Repeat rinsing 1 time.With the rifle head remaining rinsing liquid is blotted only.Then, be positioned over the dry 15-20min of 37 ℃ of incubators.The sterile distilled water that adds 20 μ l, mixing, 60 ℃ of water-bath 5min, the centrifugal 1min of 12000rpm reclaims supernatant liquor.

The gene fragment that reclaims is connected in the Super1300 carrier, operate as follows: linked system 10 μ l, DNA, 1 μ l, the 10 * T4 ligase enzyme buffer and the 1 μ l T4 ligase enzyme that comprise the Cyp2 gene of 2 μ l Super1300 carriers, 6 μ l purifying, connect 12h down at 4-10 ℃, to connect product then and be transformed in the bacillus coli DH 5 alpha competent cell, and extract plasmid and identify.

Gene fragment changes in the GV3101 Agrobacterium after being connected into the Super1300 carrier again, operate as follows: get 200 μ l Agrobacterium competent cells, add the plasmid DNA that 5～10 μ l build, 30 ℃ of ice bath 30min, quick-frozen 1min in the liquid nitrogen, 37 ℃ of water-bath 5min, (1 liter of YEB substratum contains 1g yeast extract, 5g beef extract, 5g peptone, 5g sucrose and 0.5g MgSO47H2O to add 1ml YEB substratum then, pH7.0), 28 ℃ are recovered to cultivate 4h; The centrifugal 30s of 10000g, abandon supernatant, add 0.1ml YEB substratum suspension cell again, (1 liter of YEB substratum contains 1g yeast extract, 5g beef extract, 5g peptone, 5g sucrose, 0.5gMgSO47H2O and 12g agar to coat the YEB flat board that contains 100 μ g/ml kantlex, 25 μ g/ml gentamicins and 125 μ g/ml Rifampins, pH 7.0) on, about 48h cultivated for 28 ℃.

Through identifying that (the picking positive colony is as template after correct, identify with colony polymerase chain reaction (PCR) method), by agriculture bacillus mediated flower-dipping method transformation mode plant Arabidopis thaliana, operate as follows: the Agrobacterium bacterium colony that inoculation contains the purpose plasmid (contains 0.1% yeast extract in 10ml YEB substratum, 0.5% beef extract, 0.5% peptone, 0.5% sucrose, 0.05%MgSO47H2O, 1.2% agar, 100 μ g/ml kantlex, 25 μ g/ml gentamicins and 125 μ g/ml Rifampins) in 28 ℃, 200rpm shakes overnight incubation, transform the day before yesterday by be inoculated at 1: 50 200ml contain in the identical antibiotic YEB nutrient solution enlarged culturing to OD600 be 1.2～1.6, about 6h, the centrifugal 15min collection of 5000g bacterium, be resuspended in the infiltration damping fluid, making OD600 is 0.8, and the resuspended liquid of 200ml can use 3 times.Transform used soak solution and contain 0.5 * MS macroelement, 0.5 * MS trace element, 0.5mg/L VB5,5% sucrose, 44nM 6-BA (U.S. Sigma company) and 0.03%Silwet L-77 (U.S. LEHLESEEDS company).The infiltration conversion fluid that 200ml is contained the purpose Agrobacterium places a container, the flowerpot that Arabidopis thaliana is arranged is planted in upset, plant is immersed to be contained in the infiltration damping fluid of Agrobacterium to be transformed, soaked 5 minutes, slowly take out flowerpot, be sidelong in pallet, covered black plastic cloth lucifuge 24 hours, take off plastic cloth in second day, uprightly place flowerpot.

Preparation MS screening dull and stereotyped (the MS substratum adds 80g/ml Totomycin and 50g/ml penbritin), the T1 of conversion results is seeded in screening for seed after sterilization dull and stereotyped, can screen the Arabidopis thaliana seed about 100 μ g on the flat board of every 15cm.4 ℃ of vernalization 3 days, lie in the growth case and cultivate (22 ℃ of constant temperature, 24h illumination), select on screening culture medium root system and the overground part normal positive plant of growing after 7～10 days, move into the slow seedling of normal MS substratum and be implanted into soil after 3～5 days, T2 is for seed for the individual plant results.Numerous kind and identify generation, obtain 12 strains systems of transgenosis of isozygotying to T3.

Gene salt tolerant Function Identification

T3 sterilizes with 1% clorox for isozygoty transgenic line and wild-type (ecotype Columbia) Arabidopis thaliana seed, and vernalization is 3 days in 4 ℃ of refrigerators, places the incubator of 22 ℃ of temperature, humidity 50%, 24h illumination continuously to cultivate then.After cultivating 7d, observe the growth of seedling situation.After treating that seedling cotyledon launches fully, transgenic line and wild-type seedling moved into respectively contain on 170mM NaCl, 200mMNaCl and the normal MS solid medium (containing 1 * macroelement, 1 * trace element, 1 * molysite, 3% sucrose and 0.8% agar), place the incubator of identical light and temperature condition (22 ℃, humidity 50%, continuous 24h illumination) to cultivate then.After cultivating 12-15d, observe transgenic line and the phenotype of wild-type seedling under high-salt stress.Found that containing in the 170mM NaCl MS cultivation that albefaction death appears in wild-type seedling radical leaves, still keep green and change Cyp2 gene strain system; And under 200mM NaCl, the whole albefaction death of wild-type seedling, change Cyp2 gene strain system and only albefaction death occurs, and still keep green, illustrate that Cyp2 gene overexpression in plant can alleviate the plant salt damage at growth of seedlings point and rest blade at seedling base portion 1-2 Lao Ye.

SEQUENCE?LISTING

＜110〉Hangzhou City Agricultural Science Research Inst.

＜120〉a kind of rice Cyp 2 gene that improves plant salt endurance

<130>

<160>3

<170>PatentIn?version?3.3

<210>1

<211>519

<212>DNA

＜213〉paddy rice

<400>1

atgtcgaaca?cgagggtgtt?cttcgacatg?accgtcggcg?gagctccggc?ggggcggatc 60

gtgatggagc?tgtacgcgaa?ggacgtgccg?cggacggcgg?agaacttccg?cgcgctctgc 120

accggcgaga?agggcgtggg?caagagcggc?aagccgctgc?actacaaggg?gagcaccttc 180

caccgcgtga?tcccggagtt?catgtgccag?ggcggcgact?tcacccgcgg?caacggcacg 240

ggaggggagt?cgatctacgg?cgagaagttc?gccgacgagg?tgttcaagtt?caagcacgac 300

agccccggca?tcctgtccat?ggcgaacgcc?gggcccaaca?ctaacgggtc?ccagttcttc 360

atctgcaccg?tgccctgcag?ctggctggac?gggaagcacg?tcgtgttcgg?ccgcgtcgtc 420

gagggcatgg?acgtcgtcaa?ggccatcgag?aaggtgggat?cccgcggcgg?gagcaccgcc 480

aagccggtcg?tcatcgccga?ctgcggccag?ctctcctag 519

<210>2

<211>885

<212>mRNA

＜213〉paddy rice

<400>2

cgcagcgatc?tgaagtgaaa?cagcaaaaaa?aatcaaacaa?aaagaaaaaa?tattccccat 60

ctgtgaaatt?cgcaaaaccc?tagcgcggcg?gcgatgtcga?acacgagggt?gttcttcgac 120

atgaccgtcg?gcggagctcc?ggcggggcgg?atcgtgatgg?agctgtacgc?gaaggacgtg 180

ccgcggacgg?cggagaactt?ccgcgcgctc?tgcaccggcg?agaagggcgt?gggcaagagc 240

ggcaagccgc?tgcactacaa?ggggagcacc?ttccaccgcg?tgatcccgga?gttcatgtgc 300

cagggcggcg?acttcacccg?cggcaacggc?acgggagggg?agtcgatcta?cggcgagaag 360

ttcgccgacg?aggtgttcaa?gttcaagcac?gacagccccg?gcatcctgtc?catggcgaac 420

gccgggccca?acactaacgg?gtcccagttc?ttcatctgca?ccgtgccctg?cagctggctg 480

gacgggaagc?acgtcgtgtt?cggccgcgtc?gtcgagggca?tggacgtcgt?caaggccatc 540

gagaaggtgg?gatcccgcgg?cgggagcacc?gccaagccgg?tcgtcatcgc?cgactgcggc 600

cagctctcct?agatctgtgc?tgttcccctt?cgcctttcgc?cagtatcagt?cgtcttgagt 660

cgtcgagtcc?ctaaataagg?aggaggtggt?ggtggtgtta?gtctttttat?gagttcgtgt 720

cgtgttggtg?agatgagatc?gcccatggtt?tggttggatt?aggcggagtt?cttggatcga 780

ttcggtggag?ttggatctgc?gatccttctt?ggggttggtt?ttaaatctta?attcgtgtcg 840

ctgcttctat?gatatcgcta?tcaatcaatg?agaacatttg?ggatc 885

<210>3

<211>172

<212>PRT

＜213〉paddy rice

<400>3

Met?Ser?Asn?Thr?Arg?Val?Phe?Phe?Asp?Met?Thr?Val?Gly?Gly?Ala?Pro

1 5 10 15

Ala?Gly?Arg?Ile?Val?Met?Glu?Leu?Tyr?Ala?Lys?Asp?Val?Pro?Arg?Thr

20 25 30

Ala?Glu?Asn?Phe?Arg?Ala?Leu?Cys?Thr?Gly?Glu?Lys?Gly?Val?Gly?Lys

35 40 45

Ser?Gly?Lys?Pro?Leu?His?Tyr?Lys?Gly?Ser?Thr?Phe?His?Arg?Val?Ile

50 55 60

Pro?Glu?Phe?Met?Cys?Gln?Gly?Gly?Asp?Phe?Thr?Arg?Gly?Asn?Gly?Thr

65 70 75 80

Gly?Gly?Glu?Ser?Ile?Tyr?Gly?Glu?Lys?Phe?Ala?Asp?Glu?Val?Phe?Lys

85 90 95

Phe?Lys?His?Asp?Ser?Pro?Gly?Ile?Leu?Ser?Met?Ala?Asn?Ala?Gly?Pro

100 105 110

Asn?Thr?Asn?Gly?Ser?Gln?Phe?Phe?Ile?Cys?Thr?Val?Pro?Cys?Ser?Trp

115 120 125

Leu?Asp?Gly?Lys?His?Val?Val?Phe?Gly?Arg?Val?Val?Glu?Gly?Met?Asp

130 135 140

Val?Val?Lys?Ala?Ile?Glu?Lys?Val?Gly?Ser?Arg?Gly?Gly?Ser?Thr?Ala

145 150 155 160

Lys?Pro?Val?Val?Ile?Ala?Asp?Cys?Gly?Gln?Leu?Ser

165 170

Claims (1)

1. the application of rice Cyp 2 gene in improving the arabidopsis thaliana salt-tolerance performance, the base sequence of described rice Cyp 2 gene is shown in SEQ ID NO:1.