CN108148851A

CN108148851A - A kind of rice rhodanese encoding gene OsRHOD1;2 and its application

Info

Publication number: CN108148851A
Application number: CN201810087146.2A
Authority: CN
Inventors: 赵方杰; 史书林; 唐仲
Original assignee: Nanjing Agricultural University
Current assignee: Nanjing Agricultural University
Priority date: 2017-05-17
Filing date: 2018-01-30
Publication date: 2018-06-12

Abstract

The invention discloses a kind of rice rhodanese encoding gene OsRHOD1；2 and its application.Rice rhodanese gene OsRHOD1；2 application, OsRHOD1；2 genes can enhance to the detoxification ability of pentavalent arsenic in the reduction efficiency for improving rice pentavalent arsenic and/or significantly reduce plant above ground portion with being applied in the accumulation of root system arsenic.The present invention is found that the arsenate reductase gene OsRHOD1 in rice by many experiments；2 biological function, OsRHOD1；After 2 overexpressions, reduction efficiency of the rice to As (V) is improved, while the As of rice overground part and underground part (V) content reduces.Overexpress OsRHOD1；2 significantly reduce accumulation of the rice grain to As.

Description

A kind of rice rhodanese encoding gene OsRHOD1；2 and its application

Technical field

The invention belongs to gene engineering technology fields, are related to a kind of rice rhodanese encoding gene OsRHOD1；2 and its Using.

Background technology

At present, the heavy metal pollution problem in environment becomes increasingly conspicuous, and wherein arable soil arsenic (As) pollution is also on the rise. Rice is important the population of cereal crops, global half or so using rice as staple food crop.Since rice is to the richness of arsenic Collection, people can by diet and threatened by arsenic (Meharg et al., 2009；Zhao et al.,2010).Therefore It parses rice and develops side of the reduction rice grain to the accumulation of As to the absorption detoxication mechanisms of As and by technique for gene engineering Method is particularly significant.In the soil, arsenic in aerobic condition and flooding condition respectively with pentavalent arsenic As's (V) and trivalent arsenic As (III) There is (Zhao et al., 2010) in form.As (III) mainly by aquaporin by rice absorbing (Ma et al., 2008), in plant, As (III) can by phytochelatin (PCs) chelate and be transported in vacuole (Ha et al., 1999；Raab et al.,2005；Liu et al., 2010) it or is directly excreted and detoxifies.And As (V) is main By phosphate transport protein by rice absorbing (Abedin et al., 2002；Wu et al.,2011；Kamiya et al., 2013).The As (V) being absorbed into plant, which can be reduced into As (III) and then be chelated or excrete, to detoxify. Find that arsenic mainly exists in the form of As (III) in many plants, thus in rice body As (V) to the reduction process of As (III) Particularly significant (Xu et al., 2007；Liu et al.,2010；Zhao et al.,2010).

The reductase gene for participating in As (V) reduction in plant in rice at present is seldom reported.OsRHOD1；2 genes Accession number in Genbank is NP_001052130, and the gene is homologous with the arsenic reductase gene AtHAC1's in arabidopsis Property is 81%.OsRHOD1 of the present invention；2 genes are noted as rhodanese (Rhodanese) in Genbank.

Invention content

The object of the present invention is to provide rice Os RHOD1；2 new opplication.

The purpose of the present invention is achieved through the following technical solutions：

A kind of rhodanese encoding gene, sequence is as shown in SEQ ID NO.1.

The overexpression vector of the rhodanese encoding gene contains the rhodanese encoding gene.

The overexpression vector, preferably using pTCK303 carriers as the carrier that sets out, by the rhodanese encoding gene Open reading frame sequence be connected into gained between Spe I and BamH I restriction enzyme sites.

The rhodanese encoding gene improve rice pentavalent As reduction efficiency, enhance the removing toxic substances energy to pentavalent As Power and/or significantly reduce application in the accumulation of rice overground part and root system arsenic.

The rhodanese encoding gene is preferably built overexpression vector by the application, and Introduced into Rice is surpassed The rice of the gene is expressed, in the reduction efficiency for improving rice pentavalent As, is enhanced to the detoxification ability of pentavalent As and/or significantly Reduce plant above ground portion and the application in the accumulation of root system arsenic.

Application of the rhodanese encoding gene in the case where reducing dry farming in rice grain arsenic content.

Overexpression vector of the present invention improve rice pentavalent As reduction efficiency, enhance the removing toxic substances energy to pentavalent As Power and/or significantly reduce application in the accumulation of rice overground part and root system arsenic.

The overexpression vector Introduced into Rice is obtained overexpressing the water of the rhodanese encoding gene by the application Rice in the reduction efficiency for improving rice pentavalent As, enhances to the detoxification ability of pentavalent As and/or significantly reduces plant above ground portion The application in accumulation with root system arsenic.

Application of the overexpression vector of the present invention in the case where reducing dry farming in rice grain arsenic content.

Beneficial effects of the present invention

1st, the present invention provides a kind of rhodanese encoding gene OsRHOD1 for the first time by system research；2 and its biology Learn function.

2nd, using special primer, pass through fluorescence quantitative PCR research rhodanese encoding gene OsRHOD1；2 in rice In expression, find rhodanese encoding gene OsRHOD1 of the present invention；2 by As (V) when being coerced, and expression quantity significantly improves (Fig. 1).

3rd, rhodanese encoding gene OsRHOD1 of the present invention；2 is different in Escherichia coli As (V) restores deficient mutants After the expression of source, reducing power (Fig. 2) of the mutant E. coli to As (V) has been covered.

4th, rhodanese encoding gene OsRHOD1 of the present invention；After 2 mutation, reduction efficiency of the rice to As (V) is reduced, Rice overground part accumulates more As (Fig. 3) with underground part simultaneously.

5th, rhodanese encoding gene OsRHOD1 of the present invention；After 2 overexpressions, improve rice and the reduction of As (V) is imitated Rate, while the As of rice overground part and underground part (V) content reduces (Fig. 4).

6th, rhodanese encoding gene OsRHOD1 of the present invention is overexpressed；2 significantly reduce accumulation (figure of the rice grain to arsenic 5)。

Description of the drawings

Fig. 1 is OsRHOD1；2 in rice underground part and the expression characteristic of overground part.

Fig. 2 is OsRHOD1；2 after the heterogenous expression of Escherichia coli, has covered mutant E. coli and As (V) is gone back Former function.

A：OsRHOD1；After 2 express in mutant E. coli, after extraneous 1mM As (V) handle 72h, bacterium solution spectrum Value measures；Wherein, WT represents wild rice, and Δ arsC-vector represents the mutant E. coli for being transferred to empty carrier, Δ arsC- RHOD1；2 representatives are transferred to pET-29a-OsRHOD1；2 mutant E. coli.

B：OsRHOD1；After 2 express in mutant E. coli, As in extraneous 10 μM of As (V) processing 72h wild Oryza species Metamorphosis；Wherein EV represents Escherichia coli WC3110 mutant, OsRHOD1；2 representatives are transferred to pET-29a-OsRHOD1；2 Mutant E. coli.

Fig. 3 is OsRHOD1；2 mutant materials show the reduction efficiency for being absorbed into internal As (V) compared with wild type Writing reduces, while overground part accumulates more As with underground part.

A：OsRHOD1；OsRHOD1 in 2 mutant；2 expression quantity identification；

B：The form and content of mutant and root As in wild type after extraneous 10 μM of As (V) processing 48h；

C：The form and content of mutant and overground part portion As in wild type after extraneous 10 μM of As (V) processing 48h；

D：Mutant absorbs the efficiency of As (V) with wild type；

E：The efficiency of As (III) is arranged outside mutant and wild type；

F：Mutant and wild type material are to being absorbed into the reduction efficiency of internal As (V).

Fig. 4 is OsRHOD1；2 overexpression materials show the reduction efficiency for being absorbed into internal As (V) compared with wild type It writes and improves, while the As of overground part and underground part (V) accumulation significantly reduces.

A：OsRHOD1；2 overexpression material expression amount identifications；

B：Overexpress the efficiency that material absorbs As (V) with wild type；

C：The efficiency of As (III) is arranged outside overexpression material and wild type；

D：Overexpression material and wild type material is to being absorbed into the reduction efficiency of internal As (V)；

E：The form and content of overexpression material and overground part As in wild type after extraneous 10 μM of As (V) processing 48h；

F：The form and content of overexpression material and root As in wild type after extraneous 10 μM of As (V) processing 48h.

Fig. 5 is OsRHOD1；2 mutant materials are enriched with more As (A figures) compared with wild type, in seed；And OsRHOD1；2 overexpression materials are compared with wild type, and As (V) content significantly reduces 20% or so (B figures) in seed.

Specific embodiment：

The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention..Without departing substantially from spirit of the invention In the case of essence, to the modifications or substitutions that the method for the present invention, step or condition are made, all belong to the scope of the present invention.

The expression characteristic of 1 rhodanese encoding gene of embodiment in rice

1) extraction of total serum IgE：By rice paddy seed after 30% liquor natrii hypochloritis sterilizes 30min, with sterile water washing 4-5 It is secondary, then with 1/2MS medium cultures to 2 weeks or so, seedling of the same size is selected to be transferred in culture bucket, with 1/2 Kimura Solution culture methods are handled for 24 hours after a week with the As (V) of 10 μM of concentration, to improve toxic effects of the As (V) to plant, We are using the method for not adding P elements in nutrient solution during processing.Take blade with root in liquid nitrogen in different time points respectively It preserves, RNA is extracted using plant total RNA extraction reagent box (hundred Imtech of Beijing).

2) synthesis of total cDNA is carried out using reverse transcription reagent box (Nanjing Nuo Weizan companies).

3) quantitative fluorescent PCR.After reverse transcription synthesizes total the first chains of cDNA, fluorescent quantitative PCR is carried out using it as template, And expression quantity correction is carried out for reference gene with rice cell skelemin gene (OsActin).Gene OsActin, OsRHOD1；The quantitative PCR program of 2 genes is as follows：95 DEG C of pre-degeneration 5min, 94 DEG C of denaturation 30s, 55 DEG C of renaturation 30s, 72 DEG C are prolonged 30s is stretched, after 40 recycle, 72 DEG C of 7min.Sequence number and the design of primers such as following table of gene：

Expression analysis as a result, it has been found that rhodanese encoding gene is significantly higher than overground part in root system expression quantity, and rice by When being coerced to extraneous pentavalent arsenic As (V), which is significantly increased in the expression quantity of underground part and overground part (Fig. 1).

2 rhodanese encoding gene of embodiment is in Escherichia coli heterogenous expression

1) structure of rhodanese encoding gene prokaryotic expression expression vector is converted with Escherichia coli

According to the cDNA of rhodanese encoding gene, end is gone with the design of two gene ORF frames respectively with software Primer 5.0 The only amplimer of codon adds homologous sequence respectively at the both ends of primer.The special primer of design is as follows：

OsRHOD1；2-29a-F:GATATCGGATCCATGATGATGATGGTGAGATT(SEQ ID NO.6)；

OsRHOD1；2-29a-R:GTGGTGCTCGAGGAGCTCTTCTTGCACTAGAG(SEQ ID NO.7)。

To contain rhodanese encoding gene OsRHOD1；2 cDNA clone is template high-fidelity enzyme GXL (TaKaRa Company) PCR amplification is carried out, the ORF of the rhodanese encoding gene is amplified using special primer.According to expression vector pET- The sequence of upper two restriction enzyme sites of BamHI/XhoI of 29a designs universal amplification primer with software Primer 5.0：

29a-F:TTCCATGGCTGATATCGGATCC(SEQ ID NO.8)；

29a-R:GTGGTGGTGGTGGTGCTCGAG(SEQ ID NO.9)。

Using specific primer PCR amplified production as template, OsRHOD1 is amplified using universal primer；The ORF enzymes of 2 genes connect Simultaneously recovery purifying is for use for segment.Linearized vector is obtained using BamHI/XhoI restriction enzymes double zyme cutting carriers pET-29a, By enzyme, section is connected with linearized vector using recombinant clone kit enzyme in flakes, obtains the prokaryotic expression carrier of gene ORF, digestion Verification is correct rear spare with sequence verification.

2) rhodanese encoding gene OsRHOD1；As (V) restoring function covering verification of 2 E. coli transformants

(1) by pET-29a empty carriers, contain OsRHOD1；The large intestine bar that the pET-29a expression vectors of 2 genes are transferred to respectively Bacterium mutant WC3110；The Escherichia coli WC3110 mutant is the Escherichia coli W3110 that As (V) restoring function is lost；

(2) picking positive control wild-type e. coli W3110, is transferred to empty carrier and pET-29a-OsRHOD1；2 it is big Enterobacteria mutant Δ arsC (WC3110) monoclonals are in LB liquid mediums, with 37 DEG C in constant incubator, 200rpm Bacterium is shaken to cultivate to OD600=0.5；

(3) 1ml bacterium solutions is taken to be cultivated in 100ml LB culture mediums, add in As (V) to 10 μM of concentration, and add in IPTG to dense It spends for 1mM inducible gene expressions；

(4) bacterium solution centrifugation and Aspirate supernatant, filtering (0.22 μm) are measured using HPLC-ICP-MS and trained after cultivating 72h Support the metamorphosis of As in base；

The present embodiment research shows that OsRHOD1；2 genes after heterogenous expression, return in Escherichia coli WC3110 mutant Restoring function (Fig. 2) of the mutant E. coli to As (V) is mended.

Embodiment 3OsRHOD1；The acquisition and identification of 2 mutant

1)OsRHOD1；The acquisition of 2 mutant and breeding

We by rice mutant website (http://signal.salk.edu/) obtain gene OsRHOD1；2 T- The relevant information of DNA insertion mutation bodies RMD_03Z11FF65.Mutant RMD_03Z11FF65 is provided by Central China agricultural university, will be obtained Mutant seeds decladding, using 30% liquor natrii hypochloritis soaking disinfection 30min, then clean 4-5 with sterile deionized water Secondary, then sowing is in 1/2MS culture mediums, cultivating after two weeks by water planting in seedling replanting to 1/2Kimura nutrient solutions.

2) mutant primer is designed:T-DNA insertion mutation body primers：T-DNA-B:AATCCAGATCCCC(SEQ ID NO.10)；Gene magnification primer FF65-F：CATTGTCTGACGGGTGAAAG(SEQ ID NO.11)；FF65-R： ACAAATCAAATTAACACCCAGTC(SEQ ID NO.12)。

3) total DNA of plant leaf blade is extracted, using DNA as template, two-wheeled PCR verifications are carried out using the mutant primer of design The homozygosity of mutant.

4) by the Mutants homozygous identified extraction RNA and reverse transcription is into cDNA.The cDNA of acquisition is subjected to fluorescent quantitation PCR identification genes OsRHOD1；2 expression quantity.

5) Mutants homozygous is named as rhod1；2-1.

Embodiment 5OsRHOD1；The structure of 2 overexpression vector materials

1) extraction of total serum IgE：With embodiment 1

2) synthesis of total cDNA：With embodiment 1

3)OsRHOD1；The acquisition of 2 full length genes and the structure of overexpression vector：

According to OsRHOD1；2 full length cDNA sequence design overexpression primer, primer sequence are as follows：

overOsRHOD1；2-F:GGATCCATGATGATGATGGTGAGATTGCCTG(SEQ ID NO.13)；

overOsRHOD1；2-R：ACTAGTCTAGAGCTCTTCTTGCACTAGAGGT(SEQ ID NO.14).

OsRHOD1 is obtained by template amplification of rice cDNA；2 open reading frame sequences.PCR product warp containing target gene It is connected into pMD19-T (TAKARA companies) cloning vector after recovery purifying, after digestion verification and is sequenced.Correct plasmid is sequenced to use Spe I and BamH I double digestions obtain the genetic fragment containing specific restriction enzyme site.Target gene fragment is connected into pTCK303 to carry Body obtains expression vector pTCK303-OsRHOD1；2, it is spare after sequence verification is correct.

4) enzyme is connected into correct carrier pTCK303-OsRHOD1；2 to be transferred to Agrobacterium spare.

Embodiment 6OsRHOD1；The acquisition of 2 overexpression transgenic lines

By obtained in embodiment 5 turn have pTCK303-OsRHOD1；The Agrobacterium of 2 plasmids infects Nipponbare rice callus Tissue is cultivated by selection after co-culturing 2 days, is broken up, taking root, hardening obtains T0 for transfer-gen plant.

Reagent and solution abbreviation

English in the present invention used in culture medium writes abbreviation and represents as follows：6-BA (6-benzyladenine)；Car (carboxylics Parasiticin)；NAA (methyl α-naphthyl acetate)；IAA (heteroauxin)；2,4-D (2,4- dichlorphenoxyacetic acids)；AS (acetosyringone)； CH (caseinhydrolysate)；L-pro (L-PROLINE)；L-Glu (L-Glutamine)；MES (2-morpholine ethane sulfonic acid)；(N6 is a large amount of by N6 Elementary composition solution)；B5 (B5 trace element components solution)；AA (AA a great number of elements composition)；Agar (agar).

Solution and culture medium prescription

I hormone preparation method

The concentration of hormone and antibiotic in II rice tissue culture

III rice tissue culture culture medium mother liquor formulas

IV Plantlet Regeneration in Mature Embryo Culture of Rice callus inducing medium (1L dosages)

V Plantlet Regeneration in Mature Embryo Culture of Rice callus subculture medium (1L dosages)

VI japonica rice co-cultures culture medium (1L dosages)

VII callus Selective agar medium (1L dosages)

VIII japonica rice differential medium (1L dosages)

Ⅹ suspension Agrobacterium infects the culture medium of callus (AAM feels bacterium solution, 1L dosages)

Agriculture bacillus mediated rice conversion

The induction of Mature Embryos of Rice callus：The rice paddy seed (14, a disk) of peeling enters triangular flask, uses volume ratio 70% ethyl alcohol impregnates 1min (flooding seed), outwells 70% ethyl alcohol of volume ratio, impregnates 30min with 30% sodium hypochlorite of volume ratio, Then it is cleaned 5-6 times with aqua sterilisa until limpid.Seed is pushed on the filter paper of sterilizing with tweezers, suck dry moisture, finally day This fine rice paddy seed is placed on inducing culture, in 30 DEG C of illumination box culture 20-30d.

Agrobacterium is cultivated：Picking Agrobacterium monoclonal or draw the 100 μ L of Agrobacterium (EHA 105) bacterium solution of institute preservation in In 4mL YEP (Kan containing 50mg/L and 50mg/L Str) culture solution, 28 DEG C, 250rpm shaken cultivations 20-36h to bacterium solution OD₆₀₀ It is 0.8~1.0.

Feel bacterium to co-culture：Cultured 500 μ L of bacterium solution are taken in 1.5mL centrifuge tubes, 4 DEG C, 4000rmp, 2min is centrifuged, goes Supernatant.Suspension is made with the 30mL AAM senses bacterium solution containing 200 μm of ol/L As, makes the final concentration of 0.01- of bacterium solution OD600 0.05；The Rice Callus for growing to a certain size is chosen, is put into agrobacterium suspension and infects 5min；Callus is taken Go out, be placed on sterile filter paper and drain 30-40min；Callus is placed in and is co-cultured on base, 25 DEG C of light culture 2.5d；

Selection：Callus is taken out, with sterile water wash 5-6 times, needs ceaselessly to vibrate therebetween.Again with containing 500mg/L The sterile water wash of carbenicillin (Car) 1-2 times.It is finally placed on aseptic filter paper and drains 2h；The callus dried is transferred to and is contained Carry out first round selection on the Selective agar medium of 500 mg/L carbenicillins and 50mg/L hygromycin, 28 DEG C, illumination cultivation 14d；The culture medium that initial callus with kanamycin-resistant callus tissue is gone to carbenicillin containing 500mg/L and 80mg/L hygromycin is enterprising The wheel selection of row second, 28 DEG C, illumination cultivation, the resistant calli until growing graininess.

The induction of resistant calli is broken up and takes root：The color cadmium yellow that picking comes from same callus on super-clean bench resists Property callus 3-4, move into the plastic jar equipped with differential medium (every bottle place 5-7), sealed, put with sealed membrane Enter in constant temperature incubation room, wait for seedling differentiation (25-30d).Treat that seedling length to 2-3cm or so, is put into strong sprout in root media.

Transgenic seedling is transplanted：Transgenic seedling transplants the shortest time as two months or so from breaking up.By seedling root and cauline leaf The test tube for breaking up more intact chooses (seedling length at the top of test tube it is necessary to uncap in time), opens sealed membrane, adds in appropriate distilled water Or sterile water, hardening 3d to 7d or so, agar is then washed away, is transplanted in rice pancebrin and grows, is detected.

The detection of transgenic seedling：Hygromycin selection：Rice seedlings through over cleaning after preparation is taken root, the transgenosis water taken Rice blade (leaf color is normal) 0.8~1.5cm is put into the culture dish containing screening and culturing medium.To there is no transgenosis simultaneously Blade as negative control, by the positive seedling leaf by identification as positive control.Culture is inverted in illumination box Disposition is observed after 48h：Blade turns yellow, it is withered be false positive plant；And the constant blade of color is positive seedling.

PCR amplification hygromycin selection method：(TPS methods) method is extracted using minim DNA, extracts DNA.Using carried DNA as Template carries out PCR detections.Hygromycin primer is HYG-F:ATCTTAGCCAGACGAGCG GG (SEQ ID NO.15), HYG-R: ACACAGCCATCGGTCCAGAC(SEQ ID NO.16).The transfer-gen plant DNA seedling of test positive (GUS) is extracted, PCR amplification is carried out by template of DNA.Primer size is 589bp.

GUS is detected：Containing ready material is immersed in dye liquor, 37 DEG C of incubated overnights, dye blue is sun Property seedling.The Molecular Identification of transgenic seedling：

Extract OsRHOD1；The total serum IgE of 2 overexpression material difference strain blades, the total cDNA of reverse transcription carry out fluorescent quantitation (extraction of total serum IgE, the synthesis of total cDNA, quantifying PCR method is the same as embodiment 1 for PCR identifications.In addition we select surpassed at random The apparent OsRHOD1 of expression effect；2 overexpression material Ox1；2-1；Ox1；2-2；Ox1；2-3 (Fig. 4).

Embodiment 7

OsRHOD1；To the absorption experiment of As (V), specific implementation process is as follows for 2 mutant material and overexpression material：

1) correct mutant material and wild type will be identified, overexpress material and wild type with 30% liquor natrii hypochloritis Sterilize 30min；Then it is cleaned 4-5 times with aqua sterilisa, seed is sprouted in 1/2MS culture mediums；

2) seedling is transferred in 1/2Kimura nutrient solutions by culture after two weeks cultivates, and culture is handled after 1 week；

3) two seedling are planted in every 1L culture dishes, 4 repetitions of each material handle 48h (to highlight As with 10mM As (V) toxic effect carries out in nutrient solution during processing lacking phosphorus processing).

4) rice overground part and underground part will be collected after handling 48h, extracts the As in plant sample:

(1) overground part and underground part sample are collected, and is cleaned with deionized water

(2) the overground part sample of 0.5g or so is weighed, with liquid nitrogen grinding, adds in 20ml PBS (2mM NaH₂PO₄,0.2mM Na₂- EDTA, pH 6.0) extracting solution, the As in ultrasonic 1h extraction plant sample.

(3) plant sample after ultrasound is centrifuged into 15min with 4000rpm；Aspirate supernatant, and with 0.22 μm of filter membrane mistake Filter.The sample for filtering completion is spare to be measured.

5) by underground part sample as (1mM K in the rinsing liquid of ice bath₂HPO₄,0.5mm Ca(NO₃)₂,5mM MES,pH 6.0) 15min is impregnated, removal is attached to the As on root system surface.

6) the underground part sample of 0.5g or so is weighed, with liquid nitrogen grinding, adds in 20ml PBS extracting solutions, ultrasonic 1h extractions are planted As in object sample.Plant sample after ultrasound is centrifuged into 15min with 4000rpm；Aspirate supernatant, and with 0.22 μm of filter membrane mistake Filter.The sample for filtering completion is spare to be measured.

7) overground part is measured using HPLC-ICP-MS, the As forms in underground part and nutrient solution.

This example demonstrates that OsRHOD1；2 mutant materials are compared with wild type, to being absorbed into the reduction of internal As (V) Efficiency significantly reduces, while overground part has accumulated more As (Fig. 3) with underground part；OsRHOD1；2 overexpression materials with it is wild Type is compared, and the reduction efficiency for being absorbed into internal As (V) is significantly improved, while the As of overground part and underground part (V) accumulation It significantly reduces (Fig. 4).

Embodiment 8

OsRHOD1；2 mutant overexpress the measure of As total amounts in seed in material and wild type, specific implementation process It is as follows：

1) mutant material (rhod1 is chosen；11 are spent in 2-1 and background wild type；Overexpress material (Ox1；2-1, Ox1；2-2) and background wild type Nipponbare.It is sprouted 2 weeks using 1/2MS.

2) seedling is moved in the plastic barrel of 5L, with 1/2Kimura Solution culture methods 1 week.

3) seedling of the same size is chosen, potting is carried out, is handled with 20ppm As (V) concentration.

4) soil moisture during paddy growth is controlled, keeps carrying out time of infertility potted plant experiment in a manner of dry farming as possible

5) maturity period rice is harvested, dries 3d in 60 DEG C of baking ovens.

6) it weighs 0.25g or so seeds to boil in pipe in disappearing, addition 5ml nitration mixture (HNO₃:HClO₄=85:15) disappear boiling.

7) with 2%HNO₃The sample boil liquid that disappears is settled to 25ml, fully shakes up and filters (0.45 μm).

8) As contents in each sample are measured using ICP-MS.

The present embodiment is the result shows that OsRHOD1；2 mutant materials are enriched with more As (figures compared with wild type, in seed 5A)；And OsRHOD1；2 overexpression materials are compared with wild type, and As (V) content significantly reduces 20% or so (Fig. 5 B) in seed.

Sequence table

<110>Agricultural University Of Nanjing

<120>A kind of rice rhodanese encoding gene OsRHOD1;2 and its application

<150> 2017103493235

<151> 2017-05-17

<160> 16

<170> SIPOSequenceListing 1.0

<210> 1

<211> 462

<212> DNA

<213>Rice (Oryza sativa)

<400> 1

atgatgatga tggtgagatt gcctgctatg ttcgtgatct gcatcttggc tgttccgctg 60

ctgccagcgc tcggctcgga gccgccgtcg acaccggtgc cgaccgttgg cgtgacggcg 120

gcgagccacc tcgtcggctc cggtggccac agctacttgg acgtcaggac agaagaggaa 180

ttcaagaagg gacatgtgga gaattctctt aatgtgccat tcctcttctt tacccctcaa 240

gggaaggaaa agaacacaaa gttcatagag caggtggcat tgcattatga taaggaggac 300

aacataattg tgggttgcct aagtggagta agatctgaac tagcatctgc cgatctcata 360

gcagccggat tcaaaaatgt aaagaacatg gaaggaggtt acatggcatg ggtggaaaat 420

ggccttgcgg tgaataaacc tctagtgcaa gaagagctct ag 462

<210> 2

<211> 20

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 2

gacgagaact gctccacaaa 20

<210> 3

<211> 20

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 3

gacgagaact gctccacaaa 20

<210> 4

<211> 20

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 4

caacacccct gctatgtacg 20

<210> 5

<211> 21

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 5

catcaccaga gtccaacaca a 21

<210> 6

<211> 32

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 6

gatatcggat ccatgatgat gatggtgaga tt 32

<210> 7

<211> 32

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 7

gtggtgctcg aggagctctt cttgcactag ag 32

<210> 8

<211> 22

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 8

ttccatggct gatatcggat cc 22

<210> 9

<211> 21

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 9

gtggtggtgg tggtgctcga g 21

<210> 10

<211> 13

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 10

aatccagatc ccc 13

<210> 11

<211> 20

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 11

cattgtctga cgggtgaaag 20

<210> 12

<211> 23

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 12

acaaatcaaa ttaacaccca gtc 23

<210> 13

<211> 31

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 13

ggatccatga tgatgatggt gagattgcct g 31

<210> 14

<211> 31

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 14

actagtctag agctcttctt gcactagagg t 31

<210> 15

<211> 20

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 15

atcttagcca gacgagcggg 20

<210> 16

<211> 20

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 16

acacagccat cggtccagac 20

Claims

1. a kind of rhodanese encoding gene, it is characterised in that sequence is as shown in SEQ ID NO.1.

2. the overexpression vector of gene described in claim 1, it is characterised in that compiled containing rhodanese described in claim 1 Code gene.

3. overexpression vector according to claim 2, it is characterised in that using pTCK303 carriers as the carrier that sets out, by right It is required that the open reading frame sequence of 1 gene is inserted into gained between Spe I and BamH I restriction enzyme sites.

4. rhodanese encoding gene described in claim 1 improve rice pentavalent As reduction efficiency, enhance to pentavalent As Detoxification ability and/or significantly reduce application in the accumulation of rice overground part and root system arsenic.

5. application according to claim 4, it is characterised in that by overexpression vector gene constructed described in claim 1, and Introduced into Rice obtains the rice of gene described in overexpression claim 1, so as to improve the reduction efficiency of rice pentavalent As, enhancing pair The detoxification ability of pentavalent As and/or significantly reduce application in the accumulation of plant above ground portion and root system arsenic.

6. application of the rhodanese encoding gene described in claim 1 in the case where reducing dry farming in rice grain arsenic content.

7. overexpression vector described in claim 2 in the reduction efficiency for improving rice pentavalent As, enhances the removing toxic substances to pentavalent As Ability and/or significantly reduce application in the accumulation of rice overground part and root system arsenic.

8. application according to claim 7, it is characterised in that obtain overexpression vector Introduced into Rice described in claim 2 The rice of gene described in claim 1 is overexpressed, in the reduction efficiency for improving rice pentavalent As, enhances the removing toxic substances energy to pentavalent As Power and/or significantly reduce application in the accumulation of plant above ground portion and root system arsenic.

9. application of the overexpression vector in the case where reducing dry farming in rice grain arsenic content described in claim 2.