CN111235125A

CN111235125A - Rhodanese EsSTR4A related to salt tolerance, oxidation resistance and antifungal capacity of plants, and coding gene and application thereof

Info

Publication number: CN111235125A
Application number: CN202010193812.8A
Authority: CN
Inventors: 张荃; 亓玉婷; 李传顺; 高世庆; 公杰; 孔莹莹
Original assignee: Shandong Normal University
Current assignee: Shandong Normal University
Priority date: 2020-03-19
Filing date: 2020-03-19
Publication date: 2020-06-05
Anticipated expiration: 2040-03-19
Also published as: CN111235125B

Abstract

The invention belongs to the technical field of agricultural biology, and particularly relates to rhodanese EsSTR4A related to salt tolerance, oxidation resistance and antifungal capacity of plants, and a coding gene and application thereof. The invention takes the Thellungiella halophila as an experimental material to obtain the EsSTR4A protein and the coding gene thereof, and the coding gene is introduced into the tobacco, thereby obviously improving the salt resistance, oxidation resistance and antifungal capability of the plant. The EsSTR4A protein and the coding gene thereof have important theoretical and practical significance for improving and enhancing the stress resistance of transgenic plants including wheat, potato, cucumber, tomato and other economic crops and accelerating the molecular breeding process of improving the stress resistance of plants.

Description

Rhodanese EsSTR4A related to salt tolerance, oxidation resistance and antifungal capacity of plants, and coding gene and application thereof

Technical Field

The invention belongs to the technical field of agricultural biology, and particularly relates to rhodanese EsSTR4A related to salt tolerance, oxidation resistance and antifungal capacity of plants, and a coding gene and application thereof.

Background

Thiocyanates (Strhodaneses, STR, EC 2.8.1.1) are also known as thiosulfatothransferases (TSTs), which are widely present in various organisms. STRs in animals have been shown to be an important tool for cyanide detoxification. Besides the important function of thiocyanate in mammals in the detoxification of cyanogen compounds, the wide and ubiquitous existence of thiocyanate in mammals also suggests that thiocyanate has other important physiological functions.

Plant rhodanese STR/TST is a widely existed polygene protein family, and the functions of the plant rhodanese STR/TST are diverse. In arabidopsis, the functions of STRs mainly include cyanide detoxification, sulfur metabolism and mobilization of sulfur to carry out biosynthesis or repair of iron-sulfur clusters. Some of the STR members of arabidopsis have been found to be arsenate tolerant, suggesting that STR family members act as arsenate reductase AR and are involved in the detoxification of arsenate. A cadmium-induced arabidopsis AtStr9 homologue was identified in Datura Ardisia, and the STR was found to play a role in heavy metal stress. Although rhodanese activity is ubiquitous in many organisms and there is some understanding of the physiological functions of rhodanese family members, the role of other physiological functions that rhodanese family members may have, particularly in plant stress response, and the mechanisms thereof, have not been clearly elucidated.

The function of the Thellungiella halophila rhodanese in stress tolerance has not been reported. The invention identifies a gene EsSTR4A which codes a protein containing rhodanese (rhodanese) structural domain from Thellungiella halophila (Eutrema Salsugineum), and preliminarily confirms that the gene plays an important role in improving the stress tolerance of plants through functional research of the gene in abiotic and biotic stress of the plants.

Disclosure of Invention

The invention aims to provide rhodanese EsSTR4A related to salt tolerance, oxidation resistance and antifungal capacity of plants.

Still another objective of the invention is to provide a coding gene of the above-mentioned Thellungiella halophila rhodanese EsSTR 4A.

It is still another object of the present invention to provide a recombinant expression vector containing the above-mentioned coding gene.

It is still another object of the present invention to provide a recombinant strain containing the above-mentioned encoding gene.

The invention also aims to provide application of the Thellungiella halophila rhodanese EsSTR 4A.

It is still another object of the present invention to provide the use of the above-mentioned encoding gene.

According to the specific embodiment of the invention, the amino acid sequence of the Thellungiella halophila rhodanese EsSTR4A is shown as SEQ ID No. 1:

the EsSTR4A protein of the invention consists of 270 amino acid residues and has a Rhodanese Homology structural Domain (RHOD), the structural Domain corresponds to the 385 th and 696 th bases of the cDNA coding sequence, and the active site is located at the 598 th and 600 th bases of the cDNA coding sequence.

The genomic sequence of the Thellungiella halophila rhodanese EsSTR4A gene according to the embodiment of the invention is shown in SEQ ID No. 2:

ATGACGTCTCTTCCGATTATCCTCTCAGCCTCTTCTCCTCCTCTGCGAAACTTATGCAAACCTTCCTCTTCTCGAATCCCAGATTCCGACCAATCTCCCATAACTCCACTCAAACTCTCGCCTTCATTACAGCTTCTATCCAAAACCCATCTCTCTCTCGCCGTTTCACAGATCATCTCAACTTCCCCTGTTCTCGCGTCAGAATCCTTCACCTCAATCACAGATCCTTCATCTACTGGGAAAATCGATTTGGAGTCAGTTTTGATTTCGATCGATAATTTCTTCAACAAGTACCCGTTTTTCGTGGCGGGATGTACATTCATCTACCTCGTGGTTGTGCCTGTGGTTATCTTCTACCTGAGGAAGTATAAACCAATATCCGCCATGAATGCGTTTCGAAAGCTCAAGAGCCAACCCGATTCGCAGCTTTTGGATATCAGAGATGAGAAGACTTTGGCTTCGTTGGCATCGCCGAATCTCAAGTTTCTTGGTAAGAGCTCGATTCAGGTTCCGTATAGTGAAGAAGACGAGTCGGGTTTCTTGAAGAGAGTCAAAGGAAGCTTCTCTGATCCGGAGAATACAGTTGTTTGTGTTCTTGACAAGTAAGGGTTAAACCAAAAGCTTCAAACTTTTAGCAAAATTGGGATGTTGCTTAAAACCAAAAGCTTCAAACTTTTATTGTGATCATTGTCACCAAACAACATGTTTCCAATGTCTTTGAAGATTTTTGTGGAAATTGATAGTTGCAGAGAGATCTCACATGTTTATTTAAACTTTGATGTGGAAGGCAGTTTTGATGGTAACTCCGTGAAAGTGGCTGAATTGCTTGTAGAGAATGGCTTCAAAGAGGCTTATTACATCAAAGGCGGCGCAAGAGGGAAGAATGGTTGGTTGGTATGTTACTTACATCTCTCTTTCTCTCTGGAATCAGTATGATGTTTATGTTTTGCTTTTGGTAGCTAGACTCCATTGATTCTGTCACAAATCCCGAGGGTCTGGTCTTTGTATTGCTGCCTTATTAACAATGATGTTCACAGGCCATTCAAGAGGAGCTTTTGCCTCCACCTGTGCATATGTATACATCAAAAAACACTAAAGCTCCAAGCAAGAACGAGGAGCCGTCCGTTGTTGGAACTGAAAACTGA

according to the coding gene of the Thellungiella halophila rhodanese EsSTR4A, the cDNA nucleotide sequence is shown in SEQ ID No. 3:

the recombinant expression vector according to the embodiment of the invention comprises a binary agrobacterium vector, a vector which can be used for plant microprojectile bombardment and the like. The plant expression vector may also comprise the 3' untranslated region of the foreign gene, i.e., a region comprising a polyadenylation signal and any other DNA segments involved in mRNA processing or gene expression. The polyadenylation signal can lead polyadenylic acid to the 3 'end of the mRNA precursor, and the untranslated regions transcribed from the 3' end of Agrobacterium crown gall inducible (Ti) plasmid genes (e.g., nopaline synthase Nos genes) and plant genes all have similar functions.

When the EsSTR4A is used for constructing a recombinant plant expression vector, any enhanced promoter, constitutive promoter or tissue-specific promoter can be added in front of the transcription initiation nucleotide, such as cauliflower mosaic virus (CaMV)35S promoter, Ubiquitin promoter (Ubiquitin) of corn and the like, and the enhanced promoter, the constitutive promoter or the tissue-specific promoter can be used alone or combined with other plant promoters; in addition, when the gene of the present invention is used to construct plant expression vectors, enhancers, including translational or transcriptional enhancers, may be used, and these enhancer regions may be ATG initiation codon or initiation codon of adjacent regions, etc., but must be in the same reading frame as the coding sequence to ensure proper translation of the entire sequence. The translational control signals and initiation codons are widely derived, either naturally or synthetically. The translation initiation region may be derived from a transcription initiation region or a structural gene.

In order to facilitate the identification and screening of transgenic plant cells or plants, plant expression vectors to be used may be processed, for example, by adding a gene encoding an enzyme or a luminescent compound which can produce a color change (GUS gene, luciferase gene, etc.), an antibiotic marker having resistance (gentamicin marker, kanamycin marker, etc.), or a chemical-resistant marker gene (e.g., herbicide-resistant gene), etc., which can be expressed in plants. From the safety of transgenic plants, the transgenic plants can be directly screened and transformed in a stress environment without adding any selective marker gene.

Any vector capable of guiding the expression of the exogenous gene in the plant is utilized to introduce the EsSTR4A gene provided by the invention into plant cells, and a transgenic cell line and a transgenic plant capable of improving the stress resistance of the plant can be obtained. The expression vector carrying the encoding gene can be used to transform plant cells or tissues by using conventional biological methods such as Ti plasmid, Ri plasmid, plant virus vector, direct DNA transformation, microinjection, conductance, Agrobacterium mediation, etc., and the transformed plant tissues can be cultivated into plants. The plant host to be transformed may be either a monocotyledonous or dicotyledonous plant, such as: arabidopsis, wheat, corn, cucumber, tomato, potato, alfalfa and the like.

The invention also provides application of the Thellungiella halophila rhodanese EsSTR4A and the coding gene thereof, in particular application in improving the stress resistance of plants.

The invention also provides a cultivation method for obviously improving the stress resistance of plants, which comprises the step of introducing any one of the recombinant expression vectors containing the EsSTR4A gene into plant cells to improve the salt resistance, oxidation resistance and antifungal capacity of the plants and obtain the plants with obviously improved stress resistance.

The invention takes the Thellungiella halophila as an experimental material to obtain the EsSTR4A protein and the coding gene thereof, and the coding gene is introduced into the tobacco, thereby obviously improving the salt resistance, oxidation resistance and antifungal capability of the plant. The EsSTR4A protein and the coding gene thereof have important theoretical and practical significance for improving and enhancing the stress resistance of transgenic plants including wheat, potato, cucumber, tomato and other economic crops and accelerating the molecular breeding process of improving the stress resistance of plants.

Drawings

Fig. 1 shows the results of molecular detection of essr 4A transgenic tobacco, wherein M: DNAmarker DL 2000; 1-8: different transgenic tobacco lines; n: negative control; WT: a wild type; p: a positive control;

FIG. 2 shows a comparison of the growth of EsSTR4A transgenic tobacco and wild type at 0, 100, 150 and 200mM NaCl;

FIG. 3 shows a comparison of major root length of EsSTR4A transgenic tobacco and wild type at 0, 100, 150, 200mM NaCl; each set of data had 20 replicates, representing P < 0.05;

FIG. 4 shows a comparison of the stress tolerance-related enzyme activities of EsSTR4A transgenic tobacco and wild-type leaf tissue after 24 hours of NaCl treatment, where WT-L: wild-type tobacco leaf tissue, T-L: transgenic tobacco leaf tissue; each set of data was 3 replicates representing P <0.05, P <0.01, P <0.001, P < 0.0001;

FIG. 5 shows a comparison of the activity of EsSTR4A transgenic tobacco and wild type root tissue stress tolerance-related enzymes after 24 hours of NaCl treatment, WT-R: wild type tobacco root tissue, T-R: transgenic tobacco root tissue; each set of data was 3 replicates representing P <0.05, P <0.01, P <0.001, P < 0.0001;

FIG. 6 shows a comparison of the POD activity and MDA content of the EsSTR4A transgenic tobacco and wild type root tissue after NaCl treatment for 48 hours, WT-R: wild type tobacco root tissue, T-R: transgenic tobacco root tissue; each set of data was 3 replicates representing P <0.01, representing P < 0.0001;

FIG. 7 shows the comparison of bacteriostatic effect of crude enzyme solution of transgenic tobacco and wild tobacco on fungi, BF: buffer control; WT-R: wild type tobacco root tissue enzyme solution; T-R: transgenic tobacco root tissue enzyme liquid.

Detailed Description

The test material was Thellungiella halophila (Eutrema salsugineum), tobacco. Collecting the leaves and roots of the allogenic expression plants of the Thellungiella halophila and the EsSTR4A and the corresponding wild plants, and the like for extracting RNA, DNA and quantitatively analyzing the reverse-tolerance related enzyme activity. In all cases, samples such as leaves and roots were immediately frozen in liquid nitrogen and placed at-80 ℃ until use for extraction of DNA, RNA or enzyme solutions and the like.

The molecular biological experiments, which are not specifically described in the following examples, were performed according to the methods listed in molecular cloning, a laboratory manual (third edition) J. SammBruker, or according to the kit and product instructions.

Example 1 cDNA cloning of the EsSTR4A Gene regulated by Thellungiella halophila rhodanese Synthesis

Trizol was used to extract the total RNA from the Arabidopsis thaliana seedlings which had grown for about 20 days. The cDNA was obtained by reverse transcription using Superscript II (Invitrogen) reverse transcriptase. Primers P1 and P2 were designed based on the 5 'UTR and 3' UTR sequences of the EsSTR4A gene. PCR amplification was performed using the cDNA obtained by reverse transcription as a template, and primers P1 and P2. The sequences of primers P1 and P2 are as follows:

P1：5'CTCTCGTCGTCATTTAGTTATG 3'

P2：5'GCATAAGGTCTGGTAGTATC 3'

the PCR product was subjected to 1% agarose gel electrophoresis to detect a band having a molecular weight of about 0.88kb, which included the coding region of EsSTR4A and about 72bp of 5 'and 3' -UTR regions, and which was consistent with the expected results.

Recovering the fragment, connecting the recovered fragment with pMD18-T (Takara), then transforming Escherichia coli DH5 α competent cells, and screening positive clones according to ampicillin resistance markers on pMD18-T vector to obtain the recombinant plasmid containing the recovered fragment.

The nucleotide sequence of the recombinant plasmid vector is determined by taking M13F (-47) and M13R (-48) sequences on the recombinant plasmid vector as a universal primer, and the sequencing result shows that the Open Reading Frame (ORF) of the amplified EsSTR4A gene is deoxyribonucleotide from 1 st to 813 th positions from the 5' end of SEQ ID No.3, and the coding amino acid sequence is protein of SEQ ID No. 1. The recombinant vector containing the EsSTR4A gene shown in SEQ ID No.3 is named pMD18-T-EsSTR 4A.

The EsSTR4A gene was further amplified in the Thellungiella halophila genome using primers P1 and P2, and the genomic sequence of the gene was 1300bp, consisting of three exons and three introns. The first exon has a longer sequence of 602bp, the second and third exons have shorter sequences of 103bp and 108bp, respectively, and the CDS sequence is 813 bp.

Example 2 Using EsSTR4A Gene to improve salt and fungus resistance of plants

2.1 construction of recombinant expression vectors

Carrying out PCR amplification by using cDNA obtained by reverse transcription of total RNA of thellungiella halophila as a template and using specific primers containing EcoRI and BamHI linker sequences; then EcoRI and BamHI double digestion PCR products are recovered, and the digestion products are inserted between EcoRI and BamHI digestion sites behind the 35S promoter of the vector pCAMBIA3301H in the forward direction to obtain a recombinant vector 35S, namely EsSTR 4A. The primer sequences are as follows:

35S-EsSTR4A[EcoRI]：5'CCGGAATTCCTCTCGTCGTCATTTAGTTATG 3'

35S-EsSTR4A[BamHI]：5'CGCGGATCCGCATAAGGTCTGGTAGTATC 3'

2.2 Using EsSTR4A gene to enhance salt-resistant and antifungal capability of plants

1) Obtaining transgenic tobacco material

The recombinant expression vector pCAMBIA3301H-35S EsSTR4A constructed above is transformed into Agrobacterium tumefaciens GV3101, tobacco is transformed, MS culture medium containing 6mg/L Basta is used for screening, and 22 positive transgenic tobacco plants are obtained.

And performing further identification and screening on the positive transgenic plants obtained by screening by using PCR (polymerase chain reaction), wherein a pair of primers used by the PCR is P1 and P2. PCR identification is carried out on 35S EsSTR4A transgenic tobacco, as shown in figure 1, a positive transgenic plant can obtain a band about 885bp through PCR amplification, and a 35S EsSTR4A transgenic tobacco 19 strain is obtained in total.

2) EsSTR4A transgenic tobacco salt tolerance and related physiological index determination

Sterilizing wild type and EsSTR4A transgenic tobacco seeds, growing in an MS culture medium for 7 days, selecting seedlings with consistent growth conditions, transplanting the seedlings to the MS culture medium containing 0, 100, 150 and 200mM NaCl, and culturing at 25 ℃ for 10 days under the conditions of illumination for 16 h/darkness for 8 h; the growth conditions of the tobacco seedlings were observed and photographed, and the measurement and statistics of the length of the main root were performed for each group of 20 seedlings.

As shown in FIG. 2, the transgenic tobacco plants grew better and the main roots were longer at NaCl concentrations of 100, 150 and 200mM compared to wild-type tobacco, although there was no significant difference in the growth of the transgenic tobacco and the wild-type tobacco under normal growth conditions.

As shown in FIG. 3, the mean root length of the transgenic tobacco plants is greater than that of the wild-type tobacco plants at 100mM NaCl concentrations, 150mM NaCl concentrations and 200mM NaCl concentrations, and the root length of the transgenic tobacco plants is significantly greater than that of the wild-type tobacco, which indicates that the transgenic tobacco has stronger salt tolerance than the wild-type tobacco, and indicates that the EsSTR4A gene can improve the salt tolerance of the transgenic tobacco plants.

After 4 weeks of growth of wild type and EsSTR4A transgenic tobacco, seedlings with consistent growth conditions were selected, leaves of the plants were collected after 24 hours of treatment with 0, 150 and 200mM NaCl solutions, respectively, and their superoxide dismutase (SOD) and Peroxidase (POD) activities were measured, with the results shown in A and B in FIG. 4. There were 12 individuals per sample, one replicate for each 4.

After 4 weeks of growth of wild type and EsSTR4A transgenic tobacco, seedlings with consistent growth conditions were selected, leaves of the plants were collected after 24 hours of treatment with 0, 100 and 200mM NaCl solutions, respectively, and the Catalase (CAT) activity and Malondialdehyde (MDA) content of the leaves were measured, and the results are shown in C and D in FIG. 4. There were 12 individuals per sample, one replicate for each 4.

As shown in fig. 4, transgenic tobacco leaves exhibited up-regulation of SOD activity after 24 hours of treatment with both 150mM and 200mM NaCl compared to wild-type tobacco leaf tissue, and particularly up-regulation of transgenic tobacco SOD enzyme activity was significant after treatment with 200mM NaCl, although transgenic tobacco leaf tissue had lower SOD activity than wild-type under normal growth conditions, as shown in a panel in fig. 4. Compared to wild-type tobacco leaf tissue, transgenic tobacco leaves showed a significant up-regulation of POD activity under normal growth conditions and 24 hours of 150mM and 200mM NaCl treatment, respectively, as shown in panel B of FIG. 4. Compared with wild tobacco leaf tissue, the CAT activity of the transgenic tobacco leaf is remarkably increased under normal growth conditions and after 24 hours of treatment with 100mM and 200mM NaCl respectively, as shown in a graph C in FIG. 4. The MDA content of transgenic tobacco leaves after 24 hours of treatment with both 100mM and 200mM NaCl showed a significant down-regulation compared to wild-type tobacco leaf tissue, although under normal growth conditions the MDA content of transgenic tobacco leaf tissue was slightly higher than wild-type, as shown in panel D of fig. 4.

After 4 weeks of growth of wild type and EsSTR4A transgenic tobacco, seedlings with consistent growth status were selected, roots of the plants were collected after 24 hours of treatment with 0, 150 and 200mM NaCl solutions, respectively, and their superoxide dismutase (SOD) and Peroxidase (POD) activities were measured, and the results are shown in FIG. 5 in A and B. There were 12 individuals per sample, one replicate for each 4.

After 4 weeks of growth of wild type and EsSTR4A transgenic tobacco, seedlings with consistent growth conditions were selected, roots of the plants were collected after 24 hours of treatment with 0, 100 and 200mM NaCl solutions, respectively, and the Catalase (CAT) activity and Malondialdehyde (MDA) content of the roots were measured, and the results are shown in C and D in FIG. 5. There were 12 individuals per sample, one replicate for each 4.

As shown in fig. 5, transgenic tobacco roots showed an up-regulation of SOD activity under normal growth conditions compared to wild-type tobacco root tissue as shown in panel a in fig. 5, with a particularly significant up-regulation of SOD activity after 150mM and 200mM NaCl treatment. As shown in panel B of figure 5, transgenic tobacco roots exhibited a significant up-regulation of POD activity after 24 hours of treatment with 150mM and 200mM nacl under normal growth conditions compared to wild-type tobacco root tissue. As shown in panel C of FIG. 5, the CAT activity of transgenic tobacco roots was significantly up-regulated after 24 hours of 100mM and 200mM NaCl treatment compared to wild-type tobacco root tissue, although the CAT activity of transgenic tobacco root tissue was lower than that of wild-type under normal growth conditions. As shown in panel D of fig. 5, transgenic tobacco roots exhibited a significant down-regulation in MDA content after 24 hours of 100mM NaCl treatment compared to wild-type tobacco root tissue, and both in normal growth conditions and after 200mM NaCl treatment.

After 4 weeks of growth of wild type and EsSTR4A transgenic tobacco, seedlings with consistent growth conditions were selected, roots of the plants were collected after 48 hours of treatment with NaCl solutions containing 0, 150 and 200mM, respectively, and determination of Peroxidase (POD) activity and Malondialdehyde (MDA) content was performed, with the results shown in A and B of FIG. 6. There were 12 individuals per sample, one replicate for each 4.

As shown in fig. 6, specifically, as shown in a panel in fig. 6, POD activity of transgenic tobacco roots was significantly up-regulated under normal growth conditions and after 48 hours of 150mM, 200mM NaCl treatment, respectively, compared to wild-type tobacco root tissue. As shown in panel B of figure 6, the MDA content of transgenic tobacco roots after 48 hours of treatment with both 150mM and 200mM NaCl appeared to be down-regulated compared to wild-type tobacco root tissue, although the MDA content of transgenic tobacco root tissue was slightly higher than wild-type under normal growth conditions.

Since SOD eliminates the toxic effect of oxygen radicals on plant cells, the enhancement of its activity generally increases the stress tolerance and antioxidant capacity of plants. POD and CAT can scavenge active oxygen produced in cell stress reaction and maintain oxygen metabolism balance to reduce the toxic effect of active oxygen on organelle, so that the plant can respond to environmental stress by enhancing the activity of POD and CAT to raise the stress tolerance of plant. MDA is a product of membrane lipid peroxidation, and excessive accumulation thereof can cause damage to cells and membrane structures thereof, and generally, a decrease in MDA content in plants indicates a decrease in the degree of adversity damage. In the research, compared with wild tobacco, SOD, POD and CAT activities in transgenic tobacco leaves after salt treatment are all up-regulated to different degrees, and the MDA content is reduced, so that the EsSTR4A gene can improve the salt tolerance and the oxidation resistance of transgenic tobacco plants.

3) Analysis of antifungal capability of EsSTR4A transgenic tobacco

Activation of strains and plating: respectively inoculating mycelia from Botrytis cinerea (Botrytis cinerea) and Fusarium oxysporum (Fusarium oxysporum) plates to PDA liquid culture medium, and culturing at 28 deg.C and 250rpm for 2 days to activate the strains; and respectively coating the activated bacteria liquid of the botrytis cinerea and the fusarium oxysporum on a PDA solid culture medium. Each experiment was set up in 3 replicates.

Extraction of enzyme solution: root tissues of wild type tobacco and EsSTR4A transgenic tobacco which have been grown for about 4 weeks are sampled, and 1g of the root tissue of tobacco is weighed, and appropriate quartz sand and buffer (10mM NaH) are added₂PO₄，15mM Na₂HPO₄100mM KCl, 2mM PMSF, 1mM EDTA, 10mM thiourea), grinding in liquid nitrogen, transferring the grinding liquid to an Ep tube, centrifuging at 4 ℃ and 10000r/min for 10min, taking supernatant, and filtering with a 0.22 mu m sterilizing filter membrane to obtain the extracted enzyme liquid. Each experiment was set up in 3 replicates.

Soaking the round filter paper sheets in enzyme solutions of wild tobacco and transgenic tobacco respectively, placing the round filter paper sheets on a flat plate coated with Botrytis cinerea respectively, and performing inverted culture at 28 ℃; after 5 days, the size of the zone of inhibition was observed and measured. The experiment was set up in 3 replicates. The results are shown in graph A in FIG. 7, where the diameter of the zone of inhibition generated by the transgenic tobacco root tissue enzyme solution on the Botrytis cinerea coated plate is significantly larger than that generated by the wild type tobacco enzyme solution, indicating that the transgenic tobacco root tissue enzyme solution has stronger resistance to Botrytis cinerea than that of the wild type tobacco.

Soaking the round filter paper sheets in enzyme solutions of wild tobacco and transgenic tobacco respectively, placing the round filter paper sheets on plates coated with fusarium oxysporum respectively, and performing inverted culture at 28 ℃; after 5 days, the size of the zone of inhibition was observed and measured. The experiment was set up in 3 replicates. The results are shown in graph B of FIG. 7, where the diameter of the zone of inhibition generated by the transgenic tobacco root tissue enzyme solution on the F.oxysporum coated plate is significantly larger than that of the wild type tobacco enzyme solution, indicating that the transgenic tobacco root tissue enzyme solution has stronger resistance to F.oxysporum than the wild type tobacco.

The botrytis cinerea can grow under the low-temperature condition (0 ℃), and has the advantages of latent infection and low-temperature pathogenicity; meanwhile, due to the popularization of greenhouse and greenhouse planting technologies, the crop botrytis cinerea is serious in disease, and the botrytis cinerea becomes a main limiting factor influencing the cultivation and production of vegetables, flowers and forest seedlings at present. Fusarium oxysporum is a kind of facultative parasitic fungus which can infect plants and survive in soil, has wide distribution and host range, and can cause blight of more than 100 plants such as melons, solanaceae, bananas, cotton, leguminous, flowers and the like. As the Thellungiella halophila EsSTR4A gene improves the resistance of the transgenic tobacco to botrytis cinerea and fusarium oxysporum, the EsSTR4A gene has potential application value in the aspect of preventing and treating fungal diseases of plants.

Sequence listing

<110> university of Shandong Master

<120> rhodanese EsSTR4A related to salt tolerance, oxidation resistance and antifungal capacity of plants, and coding gene and application thereof

<160>3

<170>SIPOSequenceListing 1.0

<210>1

<211>270

<212>PRT

<213> Thellungiella halophila (Eutrema Salsugineum)

<400>1

Met Thr Ser Leu Pro Ile Ile Leu Ser Ala Ser Ser Pro Pro Leu Arg

1 5 10 15

Asn Leu Cys Lys Pro Ser Ser Ser Arg Ile Pro Asp Ser Asp Gln Ser

20 25 30

Pro Ile Thr Pro Leu Lys Leu Ser Pro Ser Leu Gln Leu Leu Ser Lys

35 40 45

Thr His Leu Ser Leu Ala Val Ser Gln Ile Ile Ser Thr Ser Pro Val

50 55 60

Leu Ala Ser Glu Ser Phe Thr Ser Ile Thr Asp Pro Ser Ser Thr Gly

65 70 75 80

Lys Ile Asp Leu Glu Ser Val Leu Ile Ser Ile Asp Asn Phe Phe Asn

85 90 95

Lys Tyr Pro Phe Phe Val Ala Gly Cys Thr Phe Ile Tyr Leu Val Val

100 105 110

Val Pro Val Val Ile Phe Tyr Leu Arg Lys Tyr Lys Pro Ile Ser Ala

115 120 125

Met Asn Ala Phe Arg Lys Leu Lys Ser Gln Pro Asp Ser Gln Leu Leu

130 135 140

Asp Ile Arg Asp Glu Lys Thr Leu Ala Ser Leu Ala Ser Pro Asn Leu

145 150 155 160

Lys Phe Leu Gly Lys Ser Ser Ile Gln Val Pro Tyr Ser Glu Glu Asp

165 170 175

Glu Ser Gly Phe Leu Lys Arg Val Lys Gly Ser Phe Ser Asp Pro Glu

180 185 190

Asn Thr Val Val Cys Val Leu Asp Asn Phe Asp Gly Asn Ser Val Lys

195 200 205

Val Ala Glu Leu Leu Val Glu Asn Gly Phe Lys Glu Ala Tyr Tyr Ile

210 215 220

Lys Gly Gly Ala Arg Gly Lys Asn Gly Trp Leu Ala Ile Gln Glu Glu

225230 235 240

Leu Leu Pro Pro Pro Val His Met Tyr Thr Ser Lys Asn Thr Lys Ala

245 250 255

Pro Ser Lys Asn Glu Glu Pro Ser Val Val Gly Thr Glu Asn

260 265 270

<210>2

<211>1145

<212>DNA

<213> Thellungiella halophila (Eutrema Salsugineum)

<400>2

atgacgtctc ttccgattat cctctcagcc tcttctcctc ctctgcgaaa cttatgcaaa 60

ccttcctctt ctcgaatccc agattccgac caatctccca taactccact caaactctcg 120

ccttcattac agcttctatc caaaacccat ctctctctcg ccgtttcaca gatcatctca 180

acttcccctg ttctcgcgtc agaatccttc acctcaatca cagatccttc atctactggg 240

aaaatcgatt tggagtcagt tttgatttcg atcgataatt tcttcaacaa gtacccgttt 300

ttcgtggcgg gatgtacatt catctacctc gtggttgtgc ctgtggttat cttctacctg 360

aggaagtata aaccaatatc cgccatgaat gcgtttcgaa agctcaagag ccaacccgat 420

tcgcagcttt tggatatcag agatgagaag actttggctt cgttggcatc gccgaatctc 480

aagtttcttg gtaagagctc gattcaggtt ccgtatagtg aagaagacga gtcgggtttc 540

ttgaagagag tcaaaggaag cttctctgat ccggagaata cagttgtttg tgttcttgac 600

aagtaagggt taaaccaaaa gcttcaaact tttagcaaaa ttgggatgtt gcttaaaacc 660

aaaagcttca aacttttatt gtgatcattg tcaccaaaca acatgtttcc aatgtctttg 720

aagatttttg tggaaattga tagttgcaga gagatctcac atgtttattt aaactttgat 780

gtggaaggca gttttgatgg taactccgtg aaagtggctg aattgcttgt agagaatggc 840

ttcaaagagg cttattacat caaaggcggc gcaagaggga agaatggttg gttggtatgt 900

tacttacatc tctctttctc tctggaatca gtatgatgtt tatgttttgc ttttggtagc 960

tagactccat tgattctgtc acaaatcccg agggtctggt ctttgtattg ctgccttatt 1020

aacaatgatg ttcacaggcc attcaagagg agcttttgcc tccacctgtg catatgtata 1080

catcaaaaaa cactaaagct ccaagcaaga acgaggagcc gtccgttgtt ggaactgaaa 1140

actga 1145

<210>3

<211>813

<212>DNA

<213> Thellungiella halophila (Eutrema Salsugineum)

<400>3

atgacgtctc ttccgattat cctctcagcc tcttctcctc ctctgcgaaa cttatgcaaa 60

ccttcctctt ctcgaatccc agattccgac caatctccca taactccact caaactctcg 120

ccttcattac agcttctatc caaaacccat ctctctctcg ccgtttcaca gatcatctca 180

acttcccctg ttctcgcgtc agaatccttc acctcaatca cagatccttc atctactggg 240

aaaatcgatt tggagtcagt tttgatttcg atcgataatt tcttcaacaa gtacccgttt 300

ttcgtggcgg gatgtacatt catctacctc gtggttgtgc ctgtggttat cttctacctg 360

aggaagtata aaccaatatc cgccatgaat gcgtttcgaa agctcaagag ccaacccgat 420

tcgcagcttt tggatatcag agatgagaag actttggctt cgttggcatc gccgaatctc 480

aagtttcttg gtaagagctc gattcaggtt ccgtatagtg aagaagacga gtcgggtttc 540

ttgaagagag tcaaaggaag cttctctgat ccggagaata cagttgtttg tgttcttgac 600

aattttgatg gtaactccgt gaaagtggct gaattgcttg tagagaatgg cttcaaagag 660

gcttattaca tcaaaggcgg cgcaagaggg aagaatggtt ggttggccat tcaagaggag 720

cttttgcctc cacctgtgca tatgtataca tcaaaaaaca ctaaagctcc aagcaagaac 780

gaggagccgt ccgttgttgg aactgaaaac tga 813

Claims

1. The rhodanese EsSTR4A related to salt tolerance, oxidation resistance and antifungal capacity of plants is characterized in that the amino acid sequence is shown as SEQ ID No. 1.

2. A rhodanese EsSTR4A coding gene, characterized in that it codes for rhodanese EsSTR4A related to the salt tolerance, antioxidant and antifungal abilities of the plant of claim 1.

3. The rhodanese EsSTR4A encoding gene according to claim 2, characterized in that its nucleotide sequence is shown in SEQ ID No.2 or SEQ ID No. 3.

4. A recombinant expression vector comprising the rhodanese es str4A encoding gene of claim 2.

5. A recombinant strain comprising the gene encoding rhodanese es str4A according to claim 2.

6. The use of rhodanese EsSTR4A related to the salt tolerance, antioxidant and antifungal ability of a plant as claimed in claim 1.

7. The use of the gene encoding Thellungiella halophila rhodanese EsSTR4A as claimed in claim 2.

8. The use of the rhodanese EsSTR4A coding gene as claimed in claim 2 for improving salt tolerance, antioxidant capacity and antifungal capacity of plants.