CN114540381A - Apple histone deacetylase MdHDA6 gene and application thereof - Google Patents

Apple histone deacetylase MdHDA6 gene and application thereof Download PDF

Info

Publication number
CN114540381A
CN114540381A CN202210086727.0A CN202210086727A CN114540381A CN 114540381 A CN114540381 A CN 114540381A CN 202210086727 A CN202210086727 A CN 202210086727A CN 114540381 A CN114540381 A CN 114540381A
Authority
CN
China
Prior art keywords
apple
mdhda6
gene
histone deacetylase
leu
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN202210086727.0A
Other languages
Chinese (zh)
Other versions
CN114540381B (en
Inventor
张蕊芬
马荣群
沙广利
黄粤
孙吉禄
葛红娟
孙红涛
李少旋
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
QINGDAO ACADEMY OF AGRICULTURAL SCIENCES
Original Assignee
QINGDAO ACADEMY OF AGRICULTURAL SCIENCES
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by QINGDAO ACADEMY OF AGRICULTURAL SCIENCES filed Critical QINGDAO ACADEMY OF AGRICULTURAL SCIENCES
Priority to CN202210086727.0A priority Critical patent/CN114540381B/en
Publication of CN114540381A publication Critical patent/CN114540381A/en
Application granted granted Critical
Publication of CN114540381B publication Critical patent/CN114540381B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/78—Hydrolases (3) acting on carbon to nitrogen bonds other than peptide bonds (3.5)
    • C12N9/80—Hydrolases (3) acting on carbon to nitrogen bonds other than peptide bonds (3.5) acting on amide bonds in linear amides (3.5.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y305/00—Hydrolases acting on carbon-nitrogen bonds, other than peptide bonds (3.5)
    • C12Y305/01—Hydrolases acting on carbon-nitrogen bonds, other than peptide bonds (3.5) in linear amides (3.5.1)
    • C12Y305/01098—Histone deacetylase (3.5.1.98), i.e. sirtuin deacetylase
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
    • Y02A40/10—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in agriculture
    • Y02A40/146—Genetically Modified [GMO] plants, e.g. transgenic plants

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Cell Biology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Saccharide Compounds (AREA)

Abstract

The invention discloses an apple histone deacetylase MdHDA6 gene, wherein the coding region nucleotide sequence of the gene is shown in SEQ.ID.NO. 1. The invention also proves that the gene can regulate the stress resistance of plants, and can be particularly applied to improving the stress resistance of apple plants. The invention clones the MdHDA6 gene sequence and the coding region sequence of apple from Gala apple for the first time by a PCR or RT-PCR method. Experiments prove that after the MdHDA6 is over-expressed in the apples, the capability of stress-resistant plants can be improved, and the apple hybrid strain has a very large market application prospect.

Description

Apple histone deacetylase MdHDA6 gene and application thereof
Technical Field
The invention belongs to the technical field of biology, and particularly relates to an apple histone deacetylase MdHDA6 gene and application thereof.
Background
DNA in eukaryotes regulates transcription, DNA repair and replication through post-translational modification of histones. Acetylation is a type of post-translational modification. Regulating the acetylation state of histones are histone acetylases and Histone Deacetylases (HDACS). Among them, HDA6 is a histone deacetylase, which is involved in the regulation of flowering-time, transposon silencing, salt and ABA stress response, leaf development ethylene and jasmonic acid response, and biorhythm regulation in Arabidopsis thaliana. HDA6 has been cloned in species such as upland cotton, kidney bean, etc., but no human has cloned and studied the function of HDA6 in apple.
HDA6 is a RPD3/HDA1 type histone deacetylase, and HDA6 regulates various physiological and biochemical reactions such as auxin, ABA, salt stress and the like in arabidopsis thaliana. The mutant lacking the gene is sensitive to auxin, ABA and salt stress, and the growth amount is reduced. The HDA6 is proved to have very important function on the stress resistance of plants.
In China, flat land is generally used for planting grain crops, and fruit trees are generally planted in mountainous regions and regions with severe environments, so that the improvement of the stress resistance of the fruit trees becomes an important direction for the research of the fruit trees. The HDA6 is cloned in the apple, and a research idea can be provided for improving the stress resistance of apple trees.
Disclosure of Invention
Aiming at the defects in the prior art, the invention provides an apple histone deacetylase MdHDA6 gene and application thereof. Experimental results prove that MdHDA6 has the capability of responding to ABA, and after MdHDA6 is over-expressed in apples, the stress resistance of plants can be improved.
The specific technical scheme is as follows:
one of the purposes of the invention is to provide an apple histone deacetylase MdHDA6 gene, wherein the nucleotide sequence of the coding region is shown in SEQ ID No.1, and the amino acid sequence coded by the nucleotide sequence of the coding region is shown in SEQ ID No. 2.
Wherein the apple is Gala apple.
Furthermore, the apple histone deacetylase MdHDA6 gene is obtained by cloning by a PCR (Polymerase Chain Reaction) or RT-PCR (Reverse Transcription-Polymerase Chain Reaction) method.
Wherein, the nucleotide sequence of the upstream primer for PCR amplification is shown as SEQ.ID.NO.3, and specifically comprises the following components: ATGAAGCCCCACCGTATCCGC, respectively;
wherein, the nucleotide sequence of the downstream primer for PCR amplification is shown as SEQ.ID.NO.4, and specifically comprises the following components: CTATCTTCCTATCGATTCCCAAGACTC are provided.
Sequencing the PCR product obtained after amplification to obtain the MdHDA6 cDNA sequence shown in SEQ. ID. NO. 1.
Specifically, the preparation method of the apple histone deacetylase MdHDA6 gene comprises the following steps:
(1) extracting total DNA in the leaf of the Gala apple; or extracting total RNA in the leaf of the Gala apple, and then reversely transcribing the total RNA into cDNA;
(2) amplifying by using a PCR method by taking total DNA or cDNA as a template to obtain a PCR product; the primer sequences are as described above;
(3) and (5) recovering, purifying and sequencing the PCR product.
The invention also aims to provide application of the apple histone deacetylase MdHDA6 gene in regulating the stress tolerance of plants, in particular to application in improving the stress tolerance of apple plants.
The invention utilizes a transgenic technology of a strong promoter (cauliflower mosaic virus 35S promoter) driving principle to transfer apple MdHDA6 gene and RNA interference (HDA6-RNAi) into apple callus, so that the apple callus is expressed in the apple callus, and the apple callus of MdHDA6 transgene (OX-MdHDA6) and MdHDA silencing (anti-MdHDA6) is obtained. Experiments demonstrated that the fresh weight of transgenic calli overexpressing MdHDA6 was significantly higher than controls, while the fresh weight of silenced calli expressing MdHDA6 was significantly lower than controls, compared to controls 15 days after 100 μ M ABA (abscisic acid) treatment. The MdHDA6 gene is shown to respond to ABA, and when MdHDA6 is over-expressed in apple callus, the MdHDA6 gene is insensitive to ABA compared with a control. Thus, MdHDA6 has the ability to respond to ABA in apples. The experiment proves that after the apple overexpresses MdHDA6, the stress resistance of the plant can be improved.
The invention has the following beneficial effects:
the invention clones the MdHDA6 gene sequence and the coding region sequence of apple from Gala apple for the first time by a PCR or RT-PCR method.
The invention transfers the MdHDA6 gene and RNA interference (HDA6-RNAi) of the apple into the callus of the apple, under the condition of ABA treatment, the fresh weight of the callus is obviously different from that of a control, wherein the fresh weight of over-expression is obviously higher than that of the control, and the fresh weight of silent expression is obviously lower than that of the control. Indicating that MdHDA6 responds to ABA in apples. Thus, MdHDA6 has the ability to respond to ABA in apples. The over-expression of MdHDA6 in apple is proved to improve the capability of stress-resistant plants, and the apple hybrid strain has a very large market application prospect.
The invention simply and quickly obtains the MdHDA6 gene of the apple and the complete coding region sequence thereof, fills the blank of the gene on the apple, and lays a foundation for further researching the function of the gene on the apple. The invention obtains the gene coding region sequence through one RT-PCR, and compared with chromosome walking and RACE technology, the invention has the advantages of small workload, low cost, high efficiency and the like.
Detailed Description
The principles and features of this invention are described below in conjunction with examples, which are set forth to illustrate, but are not to be construed to limit the scope of the invention.
Example 1
The preparation of apple histone deacetylase MdHDA6 gene is carried out, the steps are as follows:
1. extracting total DNA in the leaf of the Gala apple;
using a plant genomic DNA extraction kit (DP305) (Tiangen Biochemical technology, Beijing, Ltd.), the procedures were as follows:
1) weighing 1g of fresh plant callus material by using a balance, putting the callus material into a mortar, adding liquid nitrogen, and fully grinding;
2) rapidly transferring the sample into a centrifuge tube; adding 700 mu L of 65 ℃ preheating buffer solution GP1 into a centrifuge tube by using a pipettor, turning the centrifuge tube upside down and uniformly mixing to fully mix plant materials with GP1, and then putting the centrifuge tube into a 65 ℃ water bath for incubation for 20min, turning the centrifuge tube upside down and uniformly mixing for multiple times;
3) sucking 700 μ L chloroform, mixing well, centrifuging at 12,000rpm for 5 min;
4) transferring the supernatant into a new centrifuge tube by using a pipette, adding 700 mu L of solution GP2, and fully and uniformly mixing;
5) sucking the mixed solution into a well-installed adsorption column by using a gun head, centrifuging at 12,000rpm for 30s, and discarding waste liquid;
6) adding 600 mu L of the buffer GD into an adsorption column by using a pipette, centrifuging at 12,000rpm for 30s, and discarding waste liquid; the adsorption column is put back to the original tube;
7) adding 600 μ L of rinsing solution PW into the adsorption column by using a pipette, centrifuging at 12,000rpm for 30s, discarding the waste liquid, and repeating the steps again;
8) placing the adsorption column back into the collecting tube, centrifuging at 12,000rpm for 2min, fully centrifuging the rest liquid, and discarding the waste liquid; placing the adsorption column at room temperature for 5min, and air drying the liquid completely;
9) adding TE buffer 20 mu L, and centrifuging at 12,000rpm for 30s to obtain total DNA; the DNA was stored at-20 ℃.
2. Extracting total RNA in the leaf of the Gala apple, and then reversely transcribing the total RNA into cDNA;
extracting total RNA of Gala tissue culture leaves by using an RNAPlant Plus plant total RNA extraction reagent (Tiangen Biochemical technology (Beijing) Co., Ltd.), and performing the operation steps according to the instruction of the extraction reagent;
reverse transcription kit (PrimeScript) using cDNA of Baozi organismTMRT reagent Kit with gDNA Eraser) operation steps, removing the DNA by a genome DNA reaction; then, a precious biological kit (PrimeScript) was usedTM II 1st Strand cDNA Synthesis Kit) to synthesize a cDNA template. The operation steps are carried out according to the kit instructions.
3. Respectively taking the total DNA and the cDNA as templates, designing primers, and amplifying by using a PCR method to obtain a PCR product;
the primer sequences are shown in Table 1, and the PCR reaction system is shown in Table 2;
the PCR reaction procedure was as follows: 94 ℃ for 2 min; 94 ℃ for 60s, 60 ℃ for 30s, 72c for 90s, 35 cycles; 10min at 72 ℃.
TABLE 1
Primer name Sequence of
Upstream primer P1(SEQ. ID. NO.3) 5’-ATGAAGCCCCACCGTATCCGC-3’
Downstream primer P2(SEQ. ID. NO.4) 5’-CTATCTTCCTATCGATTCCCAAGACTC-3’
TABLE 2
Sample (I) Volume (50. mu.L system)
2×ES Tap MasterMix 25μL
Upstream primer P1 2μL
Downstream primer P2 2μL
cDNA template 1μL
Deionized water 20μL
4. After the PCR reaction is finished, recovering and purifying a product, and performing gene sequencing;
in the experiment, the Kit TaKaRa MiniBEST Agarose Gel DNAextraction Kit Ver.3 is recycled, and the specific steps are as follows:
1) adding the PCR reaction product into agarose gel, and performing electrophoresis experiment (using fresh electrophoresis buffer); then, quickly cutting the agarose gel under an ultraviolet lamp, and putting the agarose gel into a 1.5mL centrifuge tube;
2) sucking 500 mu L of Buffer GM, adding the Buffer GM into the centrifuge tube, placing the centrifuge tube at 25 ℃, melting the rubber block, and continuously shaking the centrifuge tube during the period to promote the melting of the rubber block;
3) after the gel block is completely melted, observing the color of the solution, if the solution is orange, adding 10 mu L of 3M sodium acetate solution to restore the solution to yellow, and if the solution is yellow, directly entering the next reaction;
4) placing Spin Column on the Collection Tube;
5) sucking the gel block solution, adding into the above Spin Column, centrifuging at room temperature for 1min at 12,000 r;
6) pouring the liquid in the Collection Tube into the Spin Column again for centrifuging again, centrifuging for 1min at 12,000, and then discarding the waste liquid;
7) adding 700 μ L GW, and centrifuging for 1min under 12,000 conditions;
8) repeating the above process;
9) discarding the waste liquid, and drying for 1-2 min;
10) adding 30 μ L of Elution eluent, and placing Spin Column in a clean centrifuge tube;
11) centrifuging for 1min under the condition of 12,000;
12) the recovered product was stored at-20 ℃.
The recovered product was sent to the worker for biological sequencing.
The sequencing result shows that the MdHDA6 cDNA sequence is shown in SEQ ID No. 1.
Example 2
MdHDA6 gene vector construction:
the MdHDA6 gene obtained by amplification is connected with an intermediate vector pMD18-T, then enzyme digestion reaction is carried out through restriction enzyme, and an enzyme digestion product containing a target gene fragment is recovered. The pBI121 expression vector is subjected to enzyme digestion reaction by the same restriction enzyme, the enzyme-digested vector product is recovered, the recovered target gene fragment and the pBI121 are mixed, ligation reaction is carried out at 16 ℃, and after overnight ligation, Escherichia coli competent cells are transformed. Screening positive clones to obtain an expression vector.
Example 3
The effect of MdHDA6 on apple stress resistance was verified:
transforming agrobacterium LBA4404 by the constructed expression vector, selecting a monoclonal colony of agrobacterium, inoculating the colony in 10mL YEP liquid culture medium (containing 50mg/L kanamycin and 50mg/L rifampicin), culturing at 28 ℃ and 200rpm with shaking until OD600 is 0.6-0.8 (about 48 h); adding lmL bacterial solution into 20mL YEP liquid culture medium (containing 50mg/L kanamycin, 50mg/L rifampicin and 100. mu. mol/L acetosyringone), performing shaking culture at 28 deg.C and 200rpm until OD600 is 0.6-0.8 (about 5 h); then, the thalli are collected by centrifugation, and the thalli are suspended by an invasion solution (containing 0.05g/mL of sucrose and 0.03-0.05% of Silweet) for later use.
Infection, transferring apple MdHDA6 gene and RNA interference (HDA6-RNAi) into apple callus, and expressing in apple callus to obtain MdHDA6 transgenic (OX-MdHDA6) and MdHDA silent (anti-MdHDA6) apple callus.
The above apple calli were treated with 100 μ M ABA (abscisic acid) and clear water for 15 days, respectively, and non-transgenic apple calli were used as controls. The fresh weight of the callus after treatment is shown in Table 3.
TABLE 3
Figure BDA0003487167190000071
Experiments prove that compared with a control, the fresh weight of a transgenic callus which excessively expresses MdHDA6 is obviously higher than that of the control after 100 mu M ABA treatment for 15 days, and the fresh weight of a transgenic callus which silences and expresses MdHDA6 is obviously lower than that of the control. The MdHDA6 gene is shown to respond to ABA, and when MdHDA6 is over-expressed in apple callus, the MdHDA6 gene is insensitive to ABA compared with a control. Thus, MdHDA6 has the ability to respond to ABA in apples. The experiment proves that after the apple overexpresses MdHDA6, the stress resistance of the plant can be improved.
The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents, improvements and the like that fall within the spirit and principle of the present invention are intended to be included therein.
Sequence listing
<110> Qingdao city institute of agricultural science
<120> apple histone deacetylase MdHDA6 gene and application thereof
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1932
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
atgaagcccc accgtatccg catggcccac agcctagtcg tccattacgg cctccaccgt 60
cggatggaga tcaaccgccc ctttcccgcc ggccccatcg acatccgccg cttccacgcc 120
gacgactacg tcgacttcct cgcctccgtc acccccgaga ccctcgccga ttccgtccac 180
kcccgtcacc tcaagcgctt caacgtcggc gaggactgcc ccgtatttga cggcctcttg 240
ggtttctgcc aggcctccgc cggcggctca atcggcgccg ccgttaagct caatcgccag 300
gacgctgaca tcgctgttaa ctgggccggt ggcctccatc acgccaagaa ggccgaggct 360
tctggattct gctatgtcaa tgatattgtg ctcggcattc ttgagctcct caaggttcac 420
aggcgtgtgc tttatgtaga cattgatgtg caccatggag atggagttga ggaggcattt 480
tacactactg atagggtcat gactgtgtct ttccataagt tcggggattt ctttcctggc 540
accgggcaca ttaaagatgt tggggcgggg actgggaaaa actacgccct gaatgtcccg 600
ctaaatgatg gaatggatga caagagtttt cgtagtttgt ttcggcccat cctccagaaa 660
gtcatggaga tgtatcagcc agacgcagtt gttcttcagt gcggagcgga ttccttgtct 720
ggtgataggt tggggtgctt caacttgtct gtcagaggcc atgcagattg tcttcgtttt 780
cttagatctt tcaatgttcc tctgatgaca gcagtrgcgg tcggggtgga gcctgataat 840
aatttgccct acaatgaata ctatgagtat tttggaccag attacactct tcacattgcc 900
ccatccaaca tggaaaatct aaacacgccc aaagatatgg agaaaataag gaatgcactg 960
ctcgagcaac ttactcgaat acctcataca cccagtgttc ctttccagac aacaccacca 1020
actacaaaag ttccagaaga ggtggaagag aaattggacg aaagaccaaa gcctcgcatt 1080
tggaacggcg ttatttatga ctctgatcct gaagacgaca agcattggac tatattcccc 1140
accgctgctc gtcagcacgc tgttatggat agagcaaaac gcaatttcrc ttctgcaaaa 1200
tccccaccaa attcgaccgt taagtcccta tccaattcaa aaattcccca tcctacatct 1260
ccaaacctcc atttatcccc caaaacacct ccaaaaccac tcctcttcca cccatggacg 1320
cccaaatccc aacccgccca ccaccccacc cggaaaccaa gacccaggac gatggcaccc 1380
cccgaggatg tcaaaatcct cgccaaattc aagtccatgc acaactacat tcgggtcctc 1440
gaggtctcga aaagggctgg cgaccccttt accggctcaa gactcctcct tcttgacaac 1500
cctggaaaca tccacagcat ctctttcatt ttcaagtccc tcacaagcac ttacttcgac 1560
gtcttcacct ttccgccgat tatccctccc ggacccatag gcattcttgg gttcggggcg 1620
ggatccgtgg caaggtcgat tcttgatctg tacccagaag ttgtggttca tgggtgggag 1680
cttgacccat ctgtgattgg tgtgggcaga gagtactctg gactctcaaa gcttgagagg 1740
caatacacag ataggcttat aattcatgtc ggagatgcct tcaaagtcag cactcgagga 1800
ggtagctgtg tggaggctga agattcactg agacatggga aattggttac ggaagaaact 1860
cttgaaggaa atgcaacggg tttttggaga caagcttttc gtgttgagtc ttgggaatcg 1920
ataggaagat ag 1932
<210> 2
<211> 643
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 2
Met Lys Pro His Arg Ile Arg Met Ala His Ser Leu Val Val His Tyr
1 5 10 15
Gly Leu His Arg Arg Met Glu Ile Asn Arg Pro Phe Pro Ala Gly Pro
20 25 30
Ile Asp Ile Arg Arg Phe His Ala Asp Asp Tyr Val Asp Phe Leu Ala
35 40 45
Ser Val Thr Pro Glu Thr Leu Ala Asp Ser Val His Xaa Arg His Leu
50 55 60
Lys Arg Phe Asn Val Gly Glu Asp Cys Pro Val Phe Asp Gly Leu Leu
65 70 75 80
Gly Phe Cys Gln Ala Ser Ala Gly Gly Ser Ile Gly Ala Ala Val Lys
85 90 95
Leu Asn Arg Gln Asp Ala Asp Ile Ala Val Asn Trp Ala Gly Gly Leu
100 105 110
His His Ala Lys Lys Ala Glu Ala Ser Gly Phe Cys Tyr Val Asn Asp
115 120 125
Ile Val Leu Gly Ile Leu Glu Leu Leu Lys Val His Arg Arg Val Leu
130 135 140
Tyr Val Asp Ile Asp Val His His Gly Asp Gly Val Glu Glu Ala Phe
145 150 155 160
Tyr Thr Thr Asp Arg Val Met Thr Val Ser Phe His Lys Phe Gly Asp
165 170 175
Phe Phe Pro Gly Thr Gly His Ile Lys Asp Val Gly Ala Gly Thr Gly
180 185 190
Lys Asn Tyr Ala Leu Asn Val Pro Leu Asn Asp Gly Met Asp Asp Lys
195 200 205
Ser Phe Arg Ser Leu Phe Arg Pro Ile Leu Gln Lys Val Met Glu Met
210 215 220
Tyr Gln Pro Asp Ala Val Val Leu Gln Cys Gly Ala Asp Ser Leu Ser
225 230 235 240
Gly Asp Arg Leu Gly Cys Phe Asn Leu Ser Val Arg Gly His Ala Asp
245 250 255
Cys Leu Arg Phe Leu Arg Ser Phe Asn Val Pro Leu Met Thr Ala Val
260 265 270
Ala Val Gly Val Glu Pro Asp Asn Asn Leu Pro Tyr Asn Glu Tyr Tyr
275 280 285
Glu Tyr Phe Gly Pro Asp Tyr Thr Leu His Ile Ala Pro Ser Asn Met
290 295 300
Glu Asn Leu Asn Thr Pro Lys Asp Met Glu Lys Ile Arg Asn Ala Leu
305 310 315 320
Leu Glu Gln Leu Thr Arg Ile Pro His Thr Pro Ser Val Pro Phe Gln
325 330 335
Thr Thr Pro Pro Thr Thr Lys Val Pro Glu Glu Val Glu Glu Lys Leu
340 345 350
Asp Glu Arg Pro Lys Pro Arg Ile Trp Asn Gly Val Ile Tyr Asp Ser
355 360 365
Asp Pro Glu Asp Asp Lys His Trp Thr Ile Phe Pro Thr Ala Ala Arg
370 375 380
Gln His Ala Val Met Asp Arg Ala Lys Arg Asn Phe Xaa Ser Ala Lys
385 390 395 400
Ser Pro Pro Asn Ser Thr Val Lys Ser Leu Ser Asn Ser Lys Ile Pro
405 410 415
His Pro Thr Ser Pro Asn Leu His Leu Ser Pro Lys Thr Pro Pro Lys
420 425 430
Pro Leu Leu Phe His Pro Trp Thr Pro Lys Ser Gln Pro Ala His His
435 440 445
Pro Thr Arg Lys Pro Arg Pro Arg Thr Met Ala Pro Pro Glu Asp Val
450 455 460
Lys Ile Leu Ala Lys Phe Lys Ser Met His Asn Tyr Ile Arg Val Leu
465 470 475 480
Glu Val Ser Lys Arg Ala Gly Asp Pro Phe Thr Gly Ser Arg Leu Leu
485 490 495
Leu Leu Asp Asn Pro Gly Asn Ile His Ser Ile Ser Phe Ile Phe Lys
500 505 510
Ser Leu Thr Ser Thr Tyr Phe Asp Val Phe Thr Phe Pro Pro Ile Ile
515 520 525
Pro Pro Gly Pro Ile Gly Ile Leu Gly Phe Gly Ala Gly Ser Val Ala
530 535 540
Arg Ser Ile Leu Asp Leu Tyr Pro Glu Val Val Val His Gly Trp Glu
545 550 555 560
Leu Asp Pro Ser Val Ile Gly Val Gly Arg Glu Tyr Ser Gly Leu Ser
565 570 575
Lys Leu Glu Arg Gln Tyr Thr Asp Arg Leu Ile Ile His Val Gly Asp
580 585 590
Ala Phe Lys Val Ser Thr Arg Gly Gly Ser Cys Val Glu Ala Glu Asp
595 600 605
Ser Leu Arg His Gly Lys Leu Val Thr Glu Glu Thr Leu Glu Gly Asn
610 615 620
Ala Thr Gly Phe Trp Arg Gln Ala Phe Arg Val Glu Ser Trp Glu Ser
625 630 635 640
Ile Gly Arg
<210> 3
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
atgaagcccc accgtatccg c 21
<210> 4
<211> 27
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
ctatcttcct atcgattccc aagactc 27

Claims (8)

1. An apple histone deacetylase MdHDA6 gene is characterized in that the nucleotide sequence of a coding region is shown in SEQ ID No. 1.
2. The apple histone deacetylase MdHDA6 gene according to claim 1, wherein the coding region nucleotide sequence encodes an amino acid sequence shown in SEQ ID No. 2.
3. The apple histone deacetylase MdHDA6 gene according to claim 1, wherein the apple is a Gala apple.
4. The apple histone deacetylase MdHDA6 gene according to any one of claims 1 to 3, which is obtained by cloning by a PCR or RT-PCR method.
5. The apple histone deacetylase MdHDA6 gene according to claim 4, wherein the nucleotide sequences of the upstream primer and the downstream primer for PCR amplification are shown in SEQ ID No.3 and SEQ ID No.4 respectively.
6. The apple histone deacetylase MdHDA6 gene according to claim 5, wherein the preparation method comprises the following steps:
(1) extracting total DNA in the leaf of the Gala apple; or extracting total RNA in the leaf of the Gala apple, and then reversely transcribing the total RNA into cDNA;
(2) amplifying by using a PCR method by taking total DNA or cDNA as a template to obtain a PCR product;
(3) and (3) recovering, purifying and sequencing the PCR product.
7. The use of the apple histone deacetylase MdHDA6 gene according to any one of claims 1 to 6 for regulating the stress tolerance of plants.
8. The use according to claim 7, for improving stress tolerance in apple plants.
CN202210086727.0A 2022-01-25 2022-01-25 Apple histone deacetylase MdHDA6 gene and application thereof Active CN114540381B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202210086727.0A CN114540381B (en) 2022-01-25 2022-01-25 Apple histone deacetylase MdHDA6 gene and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202210086727.0A CN114540381B (en) 2022-01-25 2022-01-25 Apple histone deacetylase MdHDA6 gene and application thereof

Publications (2)

Publication Number Publication Date
CN114540381A true CN114540381A (en) 2022-05-27
CN114540381B CN114540381B (en) 2024-04-12

Family

ID=81671061

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202210086727.0A Active CN114540381B (en) 2022-01-25 2022-01-25 Apple histone deacetylase MdHDA6 gene and application thereof

Country Status (1)

Country Link
CN (1) CN114540381B (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN116949053A (en) * 2022-11-15 2023-10-27 西北农林科技大学 Reduce apple plant H 2 O 2 Gene with content and application thereof and plant culture method

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101827811A (en) * 2007-10-26 2010-09-08 浙江海正药业股份有限公司 NSC 630176 and preparation thereof and purposes

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101827811A (en) * 2007-10-26 2010-09-08 浙江海正药业股份有限公司 NSC 630176 and preparation thereof and purposes

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
"MDP0000238003 (http://www.rosaceae.org/feature/MDP0000238003)", HTTP://WWW.ROSACEAE.ORG, pages 1 - 8 *
张蕊芬;刘会;周李杰;郭颖;郝玉金;由春香;: "苹果组蛋白脱乙酰化酶基因HDA19的生物信息学分析与胁迫响应研究", 园艺学报, no. 04, pages 613 - 622 *
韩召奋等: "植物组蛋白去乙酰化酶的特性及功能", 中国生物化学与分子生物学报, vol. 33, no. 10, pages 2 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN116949053A (en) * 2022-11-15 2023-10-27 西北农林科技大学 Reduce apple plant H 2 O 2 Gene with content and application thereof and plant culture method

Also Published As

Publication number Publication date
CN114540381B (en) 2024-04-12

Similar Documents

Publication Publication Date Title
CN108841863B (en) Method for cultivating high-nodulation nitrogen-fixing plant
CN110904071B (en) Application of RAF49 protein and encoding gene thereof in regulation and control of plant drought resistance
CN107188940B (en) Application of GsA 12 protein and coding gene thereof in regulation and control of plant stress tolerance
CN112779234B (en) Phyllostachys pubescens PeAPX5 gene and application thereof
CN108977445B (en) Application of Arabidopsis thaliana microRNA400 in regulation and control of cadmium tolerance of plants
CN111018959B (en) Application of BMDR protein and coding gene thereof in regulating and controlling plant drought resistance
CN110713526A (en) Wheat stress-resistant protein TaBZR2D and coding gene and application thereof
CN111233989A (en) Application of rice heavy metal transport protein OsHMA6 in reducing copper toxicity
CN109180791B (en) Gene related to plant drought tolerance, and coding protein and application thereof
CN110713994B (en) Plant stress tolerance associated protein TaMAPK3, and coding gene and application thereof
CN114540381B (en) Apple histone deacetylase MdHDA6 gene and application thereof
CN112080507B (en) Key gene GbMYB4 for regulating and controlling ginkgo flavonoid synthesis, protein expressed by gene GbMYB4, vector and application of gene GbMYB4
CN113430180A (en) Sweet potato flavonol synthetase IbFLS1 and coding gene and application thereof
CN112342219A (en) Cassava gene MeSCL30 and application thereof in drought stress resistance
CN113201558B (en) Soybean GmHDA12 gene and protein and application thereof
CN113584052B (en) Peanut transcription factor AhbHLH10 gene and cloning and functional expression method thereof
CN112662688B (en) Application of walnut SnRK1 protein kinase coding gene JrSnRK1 in synthesis and accumulation of oil
CN106674339B (en) Application of protein in regulating and controlling plant stress resistance
CN110387377B (en) Rape drought-tolerant gene BnNAC129 and application thereof in preparing drought-tolerant transgenic plants
CN109880845B (en) Method for improving plant nodulation nitrogen fixation efficiency
CN110004159B (en) Key gene TcNAC1 for regulating salt tolerance of tamarix chinensis and application thereof
CN108276481B (en) Upland cotton GhLEA3 gene and application thereof in low-temperature stress resistance
CN111500595A (en) Ephedra sinica gene CeDREB1 and application thereof
CN112266412B (en) Two-line hybrid wheat yield heterosis related protein TaCCA1-7D and coding gene and application thereof
CN113061172B (en) Plant salt tolerance related LIP1 protein and related biological material and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant