CN104928284A - Soybean vernalization gene GmVRN1 and colonizing method and application thereof - Google Patents
Soybean vernalization gene GmVRN1 and colonizing method and application thereof Download PDFInfo
- Publication number
- CN104928284A CN104928284A CN201510374635.2A CN201510374635A CN104928284A CN 104928284 A CN104928284 A CN 104928284A CN 201510374635 A CN201510374635 A CN 201510374635A CN 104928284 A CN104928284 A CN 104928284A
- Authority
- CN
- China
- Prior art keywords
- gmvrn1
- soybean
- gene
- vernalization
- application
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a soybean vernalization gene GmVRN1 and a colonizing method and application thereof and belongs to the technical field of resources and environment. Related genes of vernalization approaches in a soybean genome is explored through comparative genomics, real-time PCR technology is applied to screening of vernalization approach gene difference expression of AtDREB1A genetically-modified soybean, the soybean vernalization gene GmVRN1 is colonized, and application authentication is performed on a flowering phase regulating and controlling function of the soybean vernalization gene GmVRN1 by converting arabidopsis.
Description
Technical field
The invention belongs to resource and environment technical field, be specifically related to a kind of soybean vernalization gene GmVRN1 and cloning process thereof and application.
Background technology
Soybean originates from China, is one of main grain and oil crop of China since ancient times always.Containing rich in protein and fat in soybean kernel, be important plant protein and the source of food oils, thus there is very large economic worth.In recent years, along with the development of molecular biology and molecular genetics, the research of plant developmental biology achieves considerable progress.The essence disclosing flower development on a molecular scale step by step becomes the target of investigator, therefore, not only contributes to resolving flower development process or reacting path to the excavation of relevant new gene of blooming and function investigation, simultaneously also of far-reaching significance for crop improvement.
In recent years, scientists removed by the research means such as forward, reverse genetics the gene excavating regulation florescence, and for typical photoperiod-sensitive type crop-soybean, investigator's research being absorbed in Photoperiod pathway gene more.Although soybean blossoming does not need vernalization treatment, the research of comparative genomics shows, still remains the gene of vernalization approach in soybean gene group, and the function of these genes but rarely has research.This research, on the basis of laboratory early-stage Study, has been resolved the correlation function of soybean vernalization pathway gene GmVRN1, has been enriched the theory of soybean florescence control, lays the foundation to soybean heredity improvement from now on.
Summary of the invention
The object of the invention is to utilize comparative genomics to explore the genes involved of vernalization approach in soybean gene group, use real-time round pcr AtDREB1A genetically engineered soybean to be carried out to the screening of vernalization pathway gene differential expression, the cloning process of a kind of soybean vernalization gene GmVRN1 is provided.
Another object of the present invention is to the soybean vernalization gene GmVRN1 providing above-mentioned cloning process to obtain.
Another object of the present invention is the application providing above-mentioned soybean vernalization gene GmVRN1; Described is applied as the application that soybean vernalization gene GmVRN1 participates in regulation florescence.
Object of the present invention is achieved through the following technical solutions: the cloning process of a kind of soybean vernalization gene GmVRN1: application primers F: 5-CGCGGATC CATGAGAGACTTTTCATTTCAT-3; Primer R:5-CGGGGTACCCTAATGTGGTGCAC-3 carries out reverse transcription PCR, 94 DEG C of 3min denaturations, 94 DEG C of sex change 30s, 59 DEG C annealing 45s, 72 DEG C extend 1min, 34 circulation latter 72 DEG C extend 10min again; In the cultivated soybean China's spring No. 5, cloned GmVRN1, length is 1863bp, comprises the 5 ' non-translational region of 175bp, the 3 ' non-translational region of 383bp and the open reading frame of 1305bp.
A kind of soybean vernalization gene GmVRN1 is obtained by above-mentioned cloning process, and its nucleotide gene sequence is as follows:
ATGAGAGACTTTTCATTTCATTCCAATGATTTATTAATCTTGCAAGGAAACAACAGAGAGAGGTGGAAGATGGATTATCATCAGGACAACCCTGCAGTTTTCTTCACTACCATCAAGAACACCAAGCAACTGAAAGTCCCAGAGGAGTTTCTGAAGCATTTGAATAAAGACTTGTGGAGTAATTCAGTTCTTATAGGCCCTTCTGGTGATAAGTGGCAAGTAACTATTTTGAAGAAAGGAAATAACGTGTATATGGACAATGGTTGGTCACAATTTCTGAAAGACAATTCAGTGGTGCTTGATGAGTTCTTGCTTTTTACATATCATGGAGGAAACTGCTTCTATGTTCAAATTTTTGGTGGGAATGGATTGGAGAGGCTATGCCGCAAAGAAGCAAGAGAAGAACAAGCTGCTACCCCTCAATTTTTTGATCTGCCTTTCAGCAACAAAGCCTCAATTTCTGATGGATGTGAGATAAAGAAAACAAGACAAGAACAAGCTTCTGCCCCAAGTTTGGCGAGGACAAACAAGAGCAAGCAAAGAAAAACTTTTGTCGGTTCATCACACCTCCATGAATCGAACTCTTACAAAAAAGATCTGCCTTCCAGCAACAAAGGCACACTTTCTAAAGGATGTGAGATAAAGAAAACAAGACAAGAACAAGCTGCCACCCCAAGTTTTTTGAGGCCAAATAAGATTAAACAAAGAAAAACTTCTGCCAGATCATCAAACCTCAATGAATCCAAATCTTGTCAAGAAGGACAAGAACGAGTTGCCACCCTAAGTTGGGCGAGGACAAATAATTATAACAGTACGCAAAGAAAAACTTCAGCCGGTTCATCACACCTGCATGAATCGAATTCTTCCAAAGAAGATCTTCCTTTCAGCAACAAAGCCTCACTTTCTAAGGACTTCCCAAAGCCTCAGAGTTCAATTAATATTGAATGTTCAGAAGCATGTAAATTGGCCGAGTCTTTTACCTCTCGGAATCCTCATTGGAAGCACCTTTTGACAAAATGCAATTTGGAACGGTGCATCTTGCTTATTGCTGCTGAGTTTGCCAGAAAGTACATTCCTGAAGCACTGGAACAGATCTATCTTTGGAATTCGGAAGGAAAATCTTGGGAAGTGCGAGTGCATTATTTTAGAAATCGAAATACATGGTATGCTGCGTTTAAGAGAGGATGGGAAAGATTCGTTCGTGATAACAAGCTCATGAAAGGTGACACTTGCATTTTTGAAGTTGAAGAAGAACAAGGCCATTGGAGTGTTCACATATTCAGAACCGGATGTGCACCACATTAG。
Above-mentioned soybean vernalization gene GmVRN1 is participating in the application in regulation florescence.
Above-mentioned soybean vernalization gene GmVRN1 is participating in the application in regulation florescence, realizes by adopting transgenic arabidopsis the application that soybean vernalization gene GmVRN1 participates in flowering regulation; Especially by blooming of vernalization approach regulation and control Arabidopis thaliana.
Described employing transgenic arabidopsis realizes for adopting flower pesticide infestation method arabidopsis thaliana transformation.
The cloning process of above-mentioned soybean vernalization gene GmVRN1, and participate in flowering regulation by adopting transgenic arabidopsis to realize soybean vernalization gene GmVRN1, specifically comprise the following steps:
(1) clone of soybean GmVRN1 gene: China's spring, No. 5 soybean seeds plant were cultivated, TRIzol extraction method carries out the extraction of RNA, carried out the clone of reverse transcription and goal gene by the primer of design, connect pZeroBack/Blunt vector carrier and check order;
(2) Arabidopis thaliana is that carrier participates in flowering regulation test to realize soybean vernalization gene GmVRN1: the genetic transformation first carrying out Arabidopis thaliana, the screening of GmVRN1 gene transformation Arabidopis thaliana positive plant, the gene of Arabidopis thaliana vernalization approach and autonomous pathway and the key gene in downstream carry out quantitative PCR checking.In order to understand the function of GmVRN1 further, we construct Overexpression vector and carry out heterologous transformant to Arabidopis thaliana.The T0 obtained, moves into the seedling with resistance in Nutrition Soil after 10 days through cultivating containing in the screening culture medium of 20mg/L Totomycin for seed.After obtaining T1 generation, get above 13 strain T1 and extract genome DNA for plant leaf, make positive control by plasmid DNA, WT lines DNA and water make negative control, amplification hygromycin gene.Meanwhile, cause the molecular mechanism of transgenic Arabidopsis plants early blossoming in order to resolve GmVRN1, the key gene of gene and downstream that we have selected Arabidopis thaliana vernalization approach and autonomous pathway carries out quantitative PCR checking.
Detected result shows, the sequence information of the gene Glyma11g13220.1 of an induced flowering from Phytozome v.9.1 database obtain, and called after GmVRN1.We for material, extract RNA reverse transcription becomes cDNA with the cultivated soybean China's spring No. 5, and design primer has cloned the CDS sequence of GmVRN1.Its length is the gene of 1863bp, contains the 5 ' non-translational region of 175bp, the 3 ' non-translational region of 383bp and the open reading frame of 1305bp.Compare after order-checking, the sequence of GmVRN1 is consistent with William 82 reference sequences.In addition, GmVRN1 encodes 434 amino acid, containing 2 B3DNA structural domains, lays respectively at the position of 40-120 and 334-429.Phylogenetic analysis result shows, and GmVRN1 exists the very high homologous gene of sequence identity in soybean, but all not studied mistake of the function of these genes.In addition, we also find that the homologous gene of this gene is mainly present in dicotyledons, especially leguminous plants, but all do not find in lower plant, microorganism, animal, and this illustrates that this genoid is that higher plant is distinctive.Although GmVRN1 and Arabidopis thaliana VRN1 homology are not very high, they all contain 2 conservative B3 DNA binding domain, which imply both and functionally may there is similarity.
Detected result shows, and we construct Overexpression vector and carry out heterologous transformant to Arabidopis thaliana.The T0 obtained, moves into the seedling with resistance in Nutrition Soil after 10 days through cultivating containing in the screening culture medium of 20mg/L Totomycin for seed.After obtaining T1 generation, get above 13 strain T1 and extract genome DNA for plant leaf, make positive control by plasmid DNA, WT lines DNA and water make negative control, amplification hygromycin gene.Result shows, 10 strain Arabidopsis plant can amplify the DNA band with positive control formed objects, and preliminary proof goal gene GmVRN1 has been incorporated in the genome of Arabidopis thaliana.Carried out wild-type Arabidopsis plants to compare, transgenic Arabidopsis plants vernalization pathway gene VIN3, cone production factor FT, bud differentiation Gene A P1 significantly raise, and the expression amount of supressor FLC of blooming, FD is significantly lowered simultaneously.Therefore, we infer that transfer-gen plant early blossoming is because florescence supressor FLC is suppressed, and disclosing GmVRN1 can regulate and control blooming of Arabidopis thaliana by vernalization approach.
The present invention has following advantage and effect relative to prior art:
1, the present invention by Phytozome v.9.1 database obtain the sequence information of the gene Glyma11g13220.1 of an induced flowering, and called after GmVRN1, and GmVRN1 has been cloned in the cultivated soybean China's spring No. 5, length is 1863bp, comprise the 5 ' non-translational region of 175bp, the 3 ' non-translational region of 383bp and the open reading frame of 1305bp.
2, the present invention has cloned soybean vernalization gene GmVRN1, and applies the function of its regulation florescence.The clone and the PCR primer that the present invention includes soybean vernalization gene GmVRN1 design and reaction conditions, further comprises utilizing transgenic technology to set forth the application that soybean vernalization gene GmVRN1 participates in regulation florescence simultaneously.
3, the present invention is first by GmVRN1 overexpression in Arabidopis thaliana, and confirms that this gene is a functional protein, and is bloomed by the regulation and control of vernalization approach.
Accompanying drawing explanation
Fig. 1 is the CDS sequential detection result figure that agarose gel electrophoresis detects the GmVRN1 gene increasing out; M, DL2000 DNA maker; The CDS sequence PCR primer of 1-2, GmVRN1;
Fig. 2 is the response results figure of GmVRN1 to different illumination conditions; DAE, days after emergence, the number of days after cotyledon is unearthed; In figure, data are mean value and the error of three biology repetitions, and each biology repeats and carried out three technology to repeat; LD represents the long day, and SD represents short day;
Fig. 3 is that T1 is for GmVRN1 transgenic arabidopsis PCR qualification result figure; M is DL2000 DNAMarker; P is positive plasmid contrast; H
2o:H
2o is masterplate; WT, WT lines contrasts; 1-13 is transgenic arabidopsis DNA masterplate to be identified;
Fig. 4 is the expression analysis result figure of transgenosis and wild-type Arabidopsis plants and florescence genes involved; A, the expression analysis of gene in transgenosis and wild-type Arabidopsis plants of vernalization approach; B, the expression analysis of gene in transgenosis and wild-type Arabidopsis plants of autonomous pathway; C, the expression analysis of downstream key gene in transgenosis and wild-type Arabidopsis plants; In figure, data are mean value and the error of three biology repetitions, and each biology repeats and carried out three technology to repeat; WT, wild-type Arabidopsis plants; L4, L3, L1, transgenic arabidopsis strain.
Embodiment
Below in conjunction with embodiment and accompanying drawing, the present invention is described in further detail, but embodiments of the present invention are not limited thereto.
The clone of embodiment 1 soybean GmVRN1 gene
Selected China spring No. 5 soybean seeds are through 10%H
2o
2after surface sterilization 1min, clean with distilled water flushing, transfer to and be placed in dark vernalization with in the sand of river.After three days, the seedling selecting neat and consistent is transferred in 1/2Hoagland nutritive medium and continues to cultivate, and culture condition is that 12h illumination/12h is dark, the humidity of 50%.Proper Sampling Period was four leaf phases, and sample time is that illumination starts rear 10h, and sampling point is plant above ground portion, carries out RNA extraction, passes through primers F: 5-CGCGGATCCATGAGAGACTTTTCATTTCAT-3 after liquid nitrogen flash freezer; Primer R:5-CGGGGTACCCTAATGTGGTGCAC-3 carries out reverse transcription PCR, is reclaimed by the recovery of TaKaRa glue and purification kit, reclaims product and connects sequencing vector, carry out the qualification of bacterium liquid PCR after transformation of E. coli, order-checking.Result display (Fig. 1): its length is the gene of 1863bp, contains the 5 ' non-translational region of 175bp, the 3 ' non-translational region of 383bp and the open reading frame of 1305bp.Compare after order-checking, the sequence of GmVRN1 is consistent with William 82 reference sequences.In addition, GmVRN1 encodes 434 amino acid, containing 2 B3DNA structural domains, lays respectively at the position of 40-120 and 334-429.
Sequencing result is as follows:
ATGAGAGACTTTTCATTTCATTCCAATGATTTATTAATCTTGCAAGGAAACAACAGAGAGAGGTGGAAGATGGATTATCATCAGGACAACCCTGCAGTTTTCTTCACTACCATCAAGAACACCAAGCAACTGAAAGTCCCAGAGGAGTTTCTGAAGCATTTGAATAAAGACTTGTGGAGTAATTCAGTTCTTATAGGCCCTTCTGGTGATAAGTGGCAAGTAACTATTTTGAAGAAAGGAAATAACGTGTATATGGACAATGGTTGGTCACAATTTCTGAAAGACAATTCAGTGGTGCTTGATGAGTTCTTGCTTTTTACATATCATGGAGGAAACTGCTTCTATGTTCAAATTTTTGGTGGGAATGGATTGGAGAGGCTATGCCGCAAAGAAGCAAGAGAAGAACAAGCTGCTACCCCTCAATTTTTTGATCTGCCTTTCAGCAACAAAGCCTCAATTTCTGATGGATGTGAGATAAAGAAAACAAGACAAGAACAAGCTTCTGCCCCAAGTTTGGCGAGGACAAACAAGAGCAAGCAAAGAAAAACTTTTGTCGGTTCATCACACCTCCATGAATCGAACTCTTACAAAAAAGATCTGCCTTCCAGCAACAAAGGCACACTTTCTAAAGGATGTGAGATAAAGAAAACAAGACAAGAACAAGCTGCCACCCCAAGTTTTTTGAGGCCAAATAAGATTAAACAAAGAAAAACTTCTGCCAGATCATCAAACCTCAATGAATCCAAATCTTGTCAAGAAGGACAAGAACGAGTTGCCACCCTAAGTTGGGCGAGGACAAATAATTATAACAGTACGCAAAGAAAAACTTCAGCCGGTTCATCACACCTGCATGAATCGAATTCTTCCAAAGAAGATCTTCCTTTCAGCAACAAAGCCTCACTTTCTAAGGACTTCCCAAAGCCTCAGAGTTCAATTAATATTGAATGTTCAGAAGCATGTAAATTGGCCGAGTCTTTTACCTCTCGGAATCCTCATTGGAAGCACCTTTTGACAAAATGCAATTTGGAACGGTGCATCTTGCTTATTGCTGCTGAGTTTGCCAGAAAGTACATTCCTGAAGCACTGGAACAGATCTATCTTTGGAATTCGGAAGGAAAATCTTGGGAAGTGCGAGTGCATTATTTTAGAAATCGAAATACATGGTATGCTGCGTTTAAGAGAGGATGGGAAAGATTCGTTCGTGATAACAAGCTCATGAAAGGTGACACTTGCATTTTTGAAGTTGAAGAAGAACAAGGCCATTGGAGTGTTCACATATTCAGAACCGGATGTGCACCACATTAG。
Embodiment 2 GmVRN1 is to different light response analysis
Under short day condition, the expression amount of GmVRN1 first keeps stable, and when 21 days (Fig. 2), its expression amount reached peak, starts subsequently to decline.Under long-day conditions, the expression amount of GmVRN1 rises gradually, and in 21 days, its expression amount also reaches peak, starts subsequently to decline.Unlike, in 21 days, the expression amount of GmVRN1 under long-day conditions is higher than the expression amount of GmVRN1 under short day condition.Show that GmVRN1 exists response to different illumination conditions.
The genetic transformation of embodiment 3 Arabidopis thaliana and screening
Process before transformation of Arabidopsis thaliana: when the main tongue of Arabidopis thaliana grows to 5-6cm, cut whole inflorescence at inflorescence base portion, remove its apical dominance.Grow 4-6 newborn side tongue after 1 week at axillalry bud position, can be used for transforming when its side tongue inflorescence forms bud and part is bloomed or forms 1-2 angle fruit, need before conversion to cut off the angle fruit grown up to; The agrobacterium liquid stored or the dull and stereotyped Agrobacterium preserved are being activated containing antibiotic flat board being drawn plate; . the positive Agrobacterium of the mono-clonal containing goal gene of picking activation contains in antibiotic YEP liquid training base to 5mL, 28 DEG C, 250rpm activated overnight; Above-mentioned dip-dyeing solution is poured in beaker, plant to be transformed is tipped upside down on rapidly in dip-dyeing solution, take out after making inflorescence submergence 2min.As far as possible careful during operation, do not allow soil bits etc. fall to and contaminate in substratum; Suck too much bacterium liquid with thieving paper after conversion, but do not need to inhale too dry.Plant is kept flat, and covers Arabidopis thaliana over-ground part with black plastic bag.After moisturizing light culture 16-24h, carefully remove plastics bag, and water sufficient water, recover normal illumination; After about two weeks, if viridescent plant grows, tentatively can judge that it is transfer-gen plant, be moved in soil and continue to cultivate, for sowing and follow-up Molecular Identification.Nontransgenic plants can not normal growth under the screening of Totomycin, finally can yellow dead, detected the hygromycin gene of transfer-gen plant by PCR simultaneously.
Result shows (Fig. 3): the T0 obtained, moves into the seedling with resistance in Nutrition Soil after 10 days through cultivating containing in the screening culture medium of 20mg/L Totomycin for seed.After obtaining T1 generation, get above 13 strain T1 and extract genome DNA for plant leaf, make positive control by plasmid DNA, WT lines DNA and water make negative control, amplification hygromycin gene.Result shows, 10 strain Arabidopsis plant can amplify the DNA band with positive control formed objects, and preliminary proof goal gene GmVRN1 has been incorporated in the genome of Arabidopis thaliana.
The expression analysis of embodiment 4 florescence genes involved
Cause the molecular mechanism of transgenic Arabidopsis plants early blossoming to resolve GmVRN1, the key gene of gene and downstream that we have selected Arabidopis thaliana vernalization approach and autonomous pathway carries out quantitative PCR checking.As shown in Figure 4, compared with wild-type Arabidopsis plants, transgenic Arabidopsis plants vernalization pathway gene VIN3, cone production factor FT, bud differentiation Gene A P1 significantly raise result, and the expression amount of supressor FLC of blooming, FD is significantly lowered.Therefore, we infer that transfer-gen plant early blossoming is because florescence supressor FLC is suppressed, and hint GmVRN1 can regulate and control blooming of Arabidopis thaliana by vernalization approach.
Above-described embodiment is the present invention's preferably embodiment; but embodiments of the present invention are not restricted to the described embodiments; change, the modification done under other any does not deviate from spirit of the present invention and principle, substitute, combine, simplify; all should be the substitute mode of equivalence, be included within protection scope of the present invention.
Claims (5)
1. a cloning process of soybean vernalization gene GmVRN1, is characterized in that: application primers F is as shown in SEQ ID NO:2; Primer R, as shown in SEQ ID NO:3, carries out reverse transcription PCR, 94 DEG C of 3min denaturations, 94 DEG C of sex change 30s, 59 DEG C annealing 45s, 72 DEG C extend 1min, 34 circulation latter 72 DEG C extend 10min again; GmVRN1 is cloned in the cultivated soybean China's spring No. 5.
2. a soybean vernalization gene GmVRN1, is characterized in that: obtained by cloning process according to claim 1, and the nucleotide gene sequence of described soybean vernalization gene GmVRN1 is as shown in SEQ ID NO:1.
3. soybean vernalization gene GmVRN1 according to claim 2 is participating in the application in regulation florescence.
4. soybean vernalization gene GmVRN1 according to claim 3 is participating in the application in regulation florescence, it is characterized in that: realize by adopting transgenic arabidopsis the application that soybean vernalization gene GmVRN1 participates in flowering regulation.
5. soybean vernalization gene GmVRN1 according to claim 4 is participating in the application in regulation florescence, it is characterized in that: described employing transgenic arabidopsis realizes for adopting flower pesticide infestation method arabidopsis thaliana transformation.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510374635.2A CN104928284A (en) | 2015-06-30 | 2015-06-30 | Soybean vernalization gene GmVRN1 and colonizing method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510374635.2A CN104928284A (en) | 2015-06-30 | 2015-06-30 | Soybean vernalization gene GmVRN1 and colonizing method and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN104928284A true CN104928284A (en) | 2015-09-23 |
Family
ID=54115711
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510374635.2A Pending CN104928284A (en) | 2015-06-30 | 2015-06-30 | Soybean vernalization gene GmVRN1 and colonizing method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104928284A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107641624A (en) * | 2016-12-26 | 2018-01-30 | 华南农业大学 | The cloning process of soybean Tolerant to low P gene Gm100776332 a kind of and functional verification |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2001021822A1 (en) * | 1999-09-17 | 2001-03-29 | Plant Bioscience Limited | Methods and means for modification of plant flowering characteristics |
| WO2003000904A2 (en) * | 2001-06-22 | 2003-01-03 | Syngenta Participations Ag | Identification and characterization of plant genes |
| CN102912027A (en) * | 2012-11-05 | 2013-02-06 | 新疆农垦科学院 | Primer pairs used for identification of wheat vernalization gene VRN-1 and application thereof |
-
2015
- 2015-06-30 CN CN201510374635.2A patent/CN104928284A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2001021822A1 (en) * | 1999-09-17 | 2001-03-29 | Plant Bioscience Limited | Methods and means for modification of plant flowering characteristics |
| WO2003000904A2 (en) * | 2001-06-22 | 2003-01-03 | Syngenta Participations Ag | Identification and characterization of plant genes |
| CN102912027A (en) * | 2012-11-05 | 2013-02-06 | 新疆农垦科学院 | Primer pairs used for identification of wheat vernalization gene VRN-1 and application thereof |
Non-Patent Citations (3)
| Title |
|---|
| CHOL-HEE JUNG等: "Comparative Genomic Analysis of Soybean Flowering Genes", 《PLOS ONE》 * |
| GEORGES BERNIER等: "A physiological overview of the genetics of flowering time control", 《PLANT BIOTECHNOLOGY JOURNAL》 * |
| SCHMUTZ等: "XM_006590856.1", 《GENBANK》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107641624A (en) * | 2016-12-26 | 2018-01-30 | 华南农业大学 | The cloning process of soybean Tolerant to low P gene Gm100776332 a kind of and functional verification |
| CN107641624B (en) * | 2016-12-26 | 2021-02-26 | 华南农业大学 | Cloning method and functional verification of soybean low-phosphorus-resistant gene Gm100776332 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109750047B (en) | Tea tree hexose transporter gene CsSWEET17 and application thereof in regulating and controlling vegetative growth and seed size of plants | |
| CN112876551B (en) | Transcription factor SpbHLH89 for regulating and controlling drought tolerance of tomato and application thereof | |
| CN104480117A (en) | NBS-LRR (nucleotide binding site-leucine-rich repeat) gene in arachis hypogaea.L and application thereof to bacterial wilt resistance of tobaccos | |
| CN110643618A (en) | Jatropha curcas MYB transcription factor JcMYB16 gene and application thereof in improving drought resistance of plants | |
| CN113621625B (en) | Application of sesame SiERF103 gene in enhancing plant resistance | |
| CN107868123B (en) | Gene capable of simultaneously improving plant yield and resistance and application thereof | |
| CN102533811A (en) | Cloning of poncirustrifoliata mitogen-activated protein kinase (PtrMAPK) and application of PtrMAPK to improvement of drought resistance of plant | |
| CN108570469A (en) | Sedum lineare resistant gene of salt SLTATS and its application | |
| CN108570471A (en) | Sedum lineare resistant gene of salt SLEIPP and its application | |
| CN104928284A (en) | Soybean vernalization gene GmVRN1 and colonizing method and application thereof | |
| CN107641624B (en) | Cloning method and functional verification of soybean low-phosphorus-resistant gene Gm100776332 | |
| CN116064568A (en) | Alfalfa MsASG166 gene and application thereof in improving drought tolerance of plants | |
| CN104098665B (en) | A kind of soybean GmHKT albumen and encoding gene and application | |
| CN102899296A (en) | Rice stress tolerance-related receptor-like protein OsSIK3, its coding gene and application | |
| CN102146128B (en) | Protein MtMYB1 related to stress tolerance of plants and encoding gene and application thereof | |
| CN103102402A (en) | Soybean transcription active protein GmPHD5, and coding gene and application thereof | |
| CN103451190A (en) | Gene coding sequence for regulating and controlling organ development of cauliflowers and application of gene coding sequence | |
| CN102659936A (en) | Plant-stress-tolerance related protein, its encoding gene and application | |
| CN113151293B (en) | Stress-resistant gene line AcDwEm and application thereof in improving salt resistance, drought resistance and high temperature resistance of crops | |
| CN104098662A (en) | Rice drought resistance related protein, coding gene and application thereof | |
| CN103804479B (en) | Sea purslane aquaporin SpAQP1 and encoding gene thereof are in the application improving in plant salt tolerance | |
| CN103374060B (en) | Cotton Trihelix transcription factor GhGT23, coding genes and applications | |
| CN103626856A (en) | Transcription factor AtGT4, coding gene thereof and applications | |
| CN103172718A (en) | Plant low nitrogen stress resistant related protein GmDUF-CBS and encoding gene and application thereof | |
| CN115851821B (en) | Application of BBX16 gene in improving plant salt tolerance |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB03 | Change of inventor or designer information |
Inventor after: Nian Hai Inventor after: Lv Jing Inventor after: Zhang Xiuxiang Inventor after: Ma Qibin Inventor after: Meng Xing Inventor after: Song Ruifeng Inventor before: Zhang Xiuxiang Inventor before: Nian Hai Inventor before: Lv Jing Inventor before: Ma Qibin Inventor before: Meng Xing Inventor before: Song Ruifeng |
|
| COR | Change of bibliographic data | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20150923 |
|
| RJ01 | Rejection of invention patent application after publication |