CN105367644A - Plant stress tolerance associated transcription factor, encoding gene of plant stress tolerance associated transcription factor, and application of encoding gene - Google Patents
Plant stress tolerance associated transcription factor, encoding gene of plant stress tolerance associated transcription factor, and application of encoding gene Download PDFInfo
- Publication number
- CN105367644A CN105367644A CN201510982617.2A CN201510982617A CN105367644A CN 105367644 A CN105367644 A CN 105367644A CN 201510982617 A CN201510982617 A CN 201510982617A CN 105367644 A CN105367644 A CN 105367644A
- Authority
- CN
- China
- Prior art keywords
- gene
- plant
- pbhb12
- transcription factor
- encoding gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
- C12N15/8273—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for drought, cold, salt resistance
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Molecular Biology (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biophysics (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biomedical Technology (AREA)
- Biochemistry (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Cell Biology (AREA)
- Botany (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention provides a plant stress tolerance associated transcription factor, an encoding gene of the plant stress tolerance associated transcription factor, and application of the encoding gene. The transcription factor is protein consisting of an amino acid sequence shown in SEQ ID NO: 2 or protein which is obtained by adding or missing of an amino acid sequence shown in the SEQ ID NO:2 and related with stress tolerance. The encoding gene of the transcription factor is the 77th-772th nucleotides from 5' end of a sequence shown in the SEQ ID NO: 1 or the sequence shown in the SEQ ID NO: 1. An experiment of transferring a PbHB12 gene into tomatoes testifies that in a salt stress and drought stress experiment, the survival rate, the water content and the chlorophyll content of three PbHB12 transgenic plants of T2 generation are remarkably better than those of wild plants. That is, the PbHB12 gene and protein encoded thereby can remarkably improve the salt tolerance and drought tolerance of plants.
Description
Technical field
The present invention relates to plant genetic engineering field, be specifically related to plant stress tolerance related transcription factor and encoding gene thereof and application.
Background technology
Drought stress and salt stress are the important limiting factors of crop growth and output.The lack of water that drought stress and salt stress cause seriously inhibits blade cell to expand, expansion, thus have impact on the normal development of leaf growth and over-ground part, ultimately limit flowering of plant result.Xylophyta because of its perennial immovability, resistance to inverse study mechanism and resistance to inverse breed breeding particularly important.
Homology frame (homeobox) refers to the abnormally-structured territory (homeodomain, HD) of amino acid homology that coding 60 is conservative.60 amino acids fold are triple-helix structure, combination specific with DNA.Homology frame is prevalent in plant, animal and people, fruit bat etc., comprises 6 family HD-Zip, KNOX, PHD, BELL, WOX and ZF-HD, and wherein family HD-Zip (Homeodomain-leucinezipper) is plant specific transcription factor.HD-Zip transcription factor comprises 4 subfamilies, and after its member participates in normal growing conditions and environment-stress, plant grows.PbHB12 belongs to one of HD-Zip subfamily I member.
Birch-leaf pear (PyrusbetulaefoliaBunge) originates in China, its strong adaptability, possesses the good characteristics such as cold-resistant, drought-enduring, waterlogging, salt tolerant, high with kind avidity, can improve the degeneration-resistant disease and insect resistance of kind after grafting.But owing to lacking theoretical investigation to the degeneration-resistant mechanism system of Pear rootstock, cause and fully cannot develop this stock breeding so far and go out excellent degeneration-resistant strain.
Summary of the invention
The object of this invention is to provide a kind of plant stress tolerance related transcription factor and encoding gene thereof.
Another object of the present invention is to provide recombinant vectors, expression cassette, transgenic cell line or recombinant bacterium containing described gene.
Another object of the present invention is to provide a kind of method of cultivating transgenic plant.
Object of the present invention adopts following technical scheme to realize.
Plant stress tolerance related transcription factor is following 1) or 2) protein:
(1) protein be made up of aminoacid sequence shown in SEQIDNO:2;
(2) by aminoacid sequence shown in SEQIDNO:2 through the disappearance of one or several amino-acid residue or interpolation and the protein that by (1) derived relevant to plant stress tolerance shape.
The present invention also provides the encoding gene of described plant stress tolerance related transcription factor.
In the present invention, the encoding gene of described plant stress tolerance related transcription factor is arbitrary described gene in following (1)-(2):
(1) the 77-772 position Nucleotide held from 5 ' of sequence shown in SEQIDNO:1;
(2) sequence shown in SEQIDNO:1.
The present invention also provides recombinant vectors, expression cassette, transgenic cell line or recombinant bacterium containing described gene.
In the present invention, described recombinant vectors is the recombinant vectors obtained insert gene described in Claims 2 or 3 in carrier pET-22b (+) after; Or the recombinant vectors obtained insert gene described in Claims 2 or 3 in carrier pCAMBIA2301 after.
The present invention also provides described birch-leaf pear stress tolerance correlation transcription factor or described encoding gene cultivating the application in plant with adverse resistance; Described resistance of reverse is drought tolerance, salt tolerance.
The present invention also provides a kind of method of cultivating transgenic plant, is to be imported in object plant by described encoding gene, obtains the transgenic plant with resistance of reverse.
In the present invention, in described encoding gene insertion vector pCAMBIA2301, then import in object plant.
In the present invention, described object plant is paddy rice, tomato, willow, apple, Arabidopis thaliana, tobacco or clover.
In the present invention, described resistance of reverse is salt tolerance and/or drought tolerance.
The plant tissue of conversion by using Ti-plasmids, Ri plasmid, plant viral vector, directly delivered DNA, microinjection, conductance, biological method transformant or the tissue such as agriculture bacillus mediated, and is cultivated into plant by the expression vector carrying encoding gene.The plant host be converted comprises pears, paddy rice, Arabidopis thaliana, apple, tomato, willow, clover etc.
The experiment that PbHB12 gene of the present invention is proceeded to tomato is provable: in salt stress and drought stress experiment, 3 of T2 generation turn PbHB12 gene plant, and survival rate, water content and chlorophyll content are significantly better than Wild plant.Illustrate that the albumen of PbHB12 gene provided by the invention and its coding can significantly improve the salt tolerant Drought resistance of plant.To cultivation abiotic stress tolerance plant variety, there is important theory and practical significance, can be used for cultivation and the qualification of plant with adverse resistance kind.
Accompanying drawing explanation
The expression of Fig. 1 semi-quantitative RT-PCR analysis PbHB12 gene in birch-leaf pear different tissues; Marked the Gene Name that each adhesive tape is analyzed on the left side of figure, gene for the purpose of PbHB12, Actin is reference gene; Sample source has been marked, Root: root, Leaf: leaf, Stem: stem, Flower: flower, Fruit: fruit above each swimming lane.
Fig. 2 fluorescence quantitative RT-RCR and semi-quantitative RT-PCR analysis are at arid, high-salt stress process different time, PbHB12 allelic expression, wherein A is that after fluorescence quantitative RT-RCR analyzes NaCl or PEG6000 Stress treatment, PbHB12 gene expresses sequential in birch-leaf pear leaf; B is that after semi-quantitative RT-PCR analysis NaCl or PEG6000 Stress treatment, PbHB12 gene is expression conditions in birch-leaf pear leaf and root.In B, the left side has marked the gene that each adhesive tape is analyzed, gene for the purpose of PbHB12, and Actin is reference gene; The right has marked the Stress treatment condition of sample in each adhesive tape; Figure top has marked sample source in each row adhesive tape, and Leaves represents leaf, and Roots represents root; The time of sample through Stress treatment has been marked above each swimming lane in figure.
The growth curve that Fig. 3 is recombinant bacterium BL21-pET-22b (+) and BL21-pET-22b (+)-PbHB12 without coercing, in high salt and simulating drought (10%PEG6000) are coerced, wherein A indicates without under stress conditions, B represents that high salt condition is coerced down, under C represents Drought stress simulation condition.
PbHB12 expression conditions (qRT-PCR analysis) in recombinant bacterium BL21-pET-22b (+) (contrast bacterium) and BL21-pET-22b (+)-PbHB12 under each culture condition of Fig. 4 semi-quantitative RT-PCR analysis, wherein A represents that each recombinant bacterium is affecting PbHB12 expression conditions without IPTG induction under stress conditions, and B represents recombinant bacterium BL21-pET-22b (+)-PbHB12 PbHB12 expression conditions under stress conditions.The left side of figure has marked the gene that each adhesive tape is analyzed, and gene for the purpose of PbHB12,16SrDNA is reference gene.The right side of figure has marked each sample treatment condition in each adhesive tape.
The each Transgenic wheat line RT-PCR of Fig. 5 detects and Semiquatitative RT-PCR assay detects electrophorogram, and figure A represents the RT-PCR product electrophorogram of pMD18-PbHB12 plasmid DNA, WT (Wild plant), P1A, P2B, P5B; Figure B represents the expression (Semiquatitative RT-PCR assay) of PbHB12 gene of WT (Wild plant), P1A, P2B, P5B, and Actin is reference gene.
After Fig. 6 height Ficus caricaL and drought stress process, the survival rate turning PbHB12 transgenic tomato and Wild plant compares, and wherein A is drought stress process, and B is high-salt stress process, and WT represents Wild plant, and P1A, P2B, P5B represent and turn PbHB12 transgenic tomato plant.
After Fig. 7 height Ficus caricaL and drought stress process, turn PbHB12 transgenic tomato and Wild plant chlorophyll content compares, wherein A is high-salt stress process, and B is drought stress process, and WT represents Wild plant, and P1A, P2B, P5B represent and turn PbHB12 transgenic tomato plant.CK represents that Abiotic stress conditions cultivates contrast.
After Fig. 8 height Ficus caricaL and drought stress process, the water content turning PbHB12 transgenic tomato and Wild plant compares, wherein A is high-salt stress process, B is drought stress process, WT represents Wild plant, P1A, P2B, P5B represent and turn PbHB12 transgenic tomato plant, and CK represents that Abiotic stress conditions cultivates contrast.
Embodiment
The screening of embodiment 1 birch-leaf pear stress tolerance correlation transcription factor PbHB12 encoding gene PbHB12 gene and cDNA clone thereof
With Arabidopis thaliana ATHB7 (NM_130233.4) for probe, carry out the comparison of NCBI homology, according to apple Malusxdomestica class MdHB7 (HM122586.1) and MdHB16 (HM122573.1) sequence, design primer pair (upstream primer PbHB12_F1 and downstream primer PbHB12_F2) is for the stress tolerance correlation transcription factor PbHB12 gene that increases from birch-leaf pear.
Adopt 150mMNaCl aqueous solution process birch-leaf pear to take root seedling, clip birch-leaf pear blade after 24h, extracts the birch-leaf pear blade total serum IgE after Stress treatment in conventional manner.Adopt cDNA first chain synthetic agent box (M-MuLVFirstStrandcDNASynthesisKit, Shanghai Sheng Gong biotechnology company limited) synthesize cDNA first chain, then be template with cDNA, adopt upstream primer PbHB12_F1 and downstream primer PbHB12_F2 and adapter-primer to carry out nest-type PRC to (OUTER and INNER).
PbHB12_F1 (SEQIDNO:3) sequence: 5 '-ATTGTTCATCTATTGTTGAGAGCAT-3 '-3 ';
PbHB12_F2 (SEQIDNO:4) sequence: 5 '-CACATTCACTTAAAAATTAATACTT-3 '.
OUTER (SEQIDNO:5) sequence: 5 '-GCTGTCAACGATACGCTACGTAAC-3 ';
INNER (SEQIDNO:6) sequence: 5 '-GCTACGTAACGGCATGACAGTG-3 '.
Nest-type PRC reaction system is:
Nest-type PRC response procedures is:
0.8% agarose gel electrophoresis detection is carried out to nested PCR product, obtains the band that molecular weight is about 1000bp, conform to expected results.Reclaim test kit (TaKaRaMiniBESTDNAFragmentPurificationKitVer4.0, precious biotechnology (Dalian) company limited) by PCR primer, reclaim PCR primer.This PCR primer is inserted plasmid p-MD18 (precious biotechnology (Dalian) company limited) and obtains recombinant plasmid p-MD18-PbHB12.By recombinant plasmid p-MD18-PbHB12 transformation of E. coli DH5a competent cell (precious biotechnology (Dalian) company limited), with penbritin (Amp) label screening positive colony, the recombinant plasmid obtained containing reclaiming fragment sends to order-checking.Order-checking shows that PCR primer is by 1029bp based composition, and sequence is as shown in SEQIDNO:1.By this PCR primer called after PbHB12 gene, ORF is 77-772 position Nucleotide.The protein sequence of PbHB12 genes encoding is as shown in SEQIDNO:2.Above experimental procedure all illustrates by test kit and operates.
Embodiment 2, PbHB12 gene organization expression characteristic and adverse circumstance expression study
In order to confirm the regulation and control of the PbHB12 gene whether resistance to reversed reaction of involved in plant, the present invention adopts Semiquatitative RT-PCR assay and real-time fluorescence quantitative RT-PCR to analyze the expression pattern of PbHB12 gene under birch-leaf pear different tissues and different adverse circumstance.
1. under normal growing conditions, PbHB12 gene organization expression analysis
Birch-leaf pear root, stem, leaf, flower, fruit under collection normal growing conditions, quick-frozen is in liquid nitrogen, about 200mg is got respectively in each position, grinding powder in liquid nitrogen, adopts TRIzon test kit (Shanghai LifeTechnologiesCorporation) to extract RNA.The RNA extracted with each position respectively for template, with Reverse Transcription box (
primeScript tM rTreagentKitwithgDNAEraser,precious biotechnology (Dalian) company limited), adopt the expression amount of semi-quantitative RT-PCR analysis PbHB12 gene.Using pears Beta-Actin gene as reference gene, Beta-Actin gene amplification primer is Actin_F and Actin_R; PbHB12 gene amplification primer is PbHB12_F and PbHB12__R.
Semiquatitative RT-PCR assay reaction system is:
| ReactionComponent | Target gene | Actin gene |
| 2×GCBufferI | 10 | 10 |
| F(10μM) | 1(PbHB12_F) | 1(Actin_F) |
| R(10μM) | 1(PbHB12_R) | 1(Actin_R) |
| dNTP(10mM) | 0.2 | 0.2 |
| ddH20 | 10.6 | 10.6 |
| Template | 2(cDNA) | 2(cDNA) |
| Taq enzyme (5U/ μ l) | 0.2 | 0.2 |
| Total | 25μl | 25μl |
Semiquatitative RT-PCR assay response procedures is: 94 DEG C of denaturation 5min; 94 DEG C of sex change 30s, 60 DEG C of annealing 30s, 72 DEG C extend 1min, 26 circulations; 72 DEG C extend 10min again.
Actin_F (SEQIDNO:7) sequence is: 5 '-CTCCCAGGGCTGTGTTTCCTA-3 ';
Actin_R (SEQIDNO:8) sequence is: 5 '-CTCCATGTCATCCCAGTTGCT-3 ';
PbHB12_F (SEQIDNO:9) sequence is:
5'-GAGGAAAGAGGAGTGCTATGAAGA-3’；
PbHB12_R (SEQIDNO:10) sequence is: 5'-AAACCGCCTCGTGTTCTTG-3'.
Result as shown in Figure 1, can be found out PbHB12 gene strong expression in root, also have expression in leaf, faint expression in stem, and does not express in flower and fruit.
2. under Stress treatment condition, PbHB12 gene organization expression analysis
The birch-leaf pear clone of preserving with this laboratory takes root tissue cultured seedling for material, grows 4 weeks, adopts following nutrient solution to carry out Stress treatment respectively:
1) salt stress process nutrient solution: adding final concentration in MS substratum is 150mmolL
-1naCl;
2) osmotic stress process nutrient solution: add the PEG6000 that final concentration is 20% (mass percentage concentration) in MS substratum.
Often kind of nutrient solution treatment time reaches the fresh blade of 0,24,72 hr collections, and at 0,12,24 hr collections roots, in liquid nitrogen, quick-frozen is preserved.Trizol method is utilized to extract the blade of collection of each moment and the total serum IgE of root respectively, with the first chain cDNA (operation steps is with the present embodiment title 1) of Reverse Transcription box synthesis PbHB12 gene, then utilize the expression of fluorescence quantitative RT-RCR and semi-quantitative RT-PCR analysis PbHB12 gene.Wherein, fluorescence quantitative RT-RCR is tested, PCR system is configured by SYBRPremixExTaq II test kit (precious biotechnology (Dalian) company limited), carry out real-time quantitative fluorescence PCR detection in ABI7300 type quantitative real time PCR Instrument, response procedures is: 94 DEG C of denaturation 5min; 94 DEG C of sex change 30s, 60 DEG C of annealing 30s, 72 DEG C extend 1min, 30 circulations; 72 DEG C extend 10min again.Measure its C
tvalue, using pears Actin gene as reference gene, gets F=2
-Δ Δ Ct(F:foldchange relative expression quantity; Δ Δ Ct=(treatment group goal gene Ct-treatment group reference gene Ct)-(control group goal gene Ct-control group reference gene Ct), Ct:Cyclenumber cycle number) calculate the expression amount difference of goal gene between each sample.Semiquantitive RT-PCR is with title in the present embodiment 1.
Result shows as shown in Figure 2, after salt stress and PEG6000 process 24h, expresses in birch-leaf pear blade induction of PbHB12 gene; And in root, after induction, namely this gene of 12h expresses.
Embodiment 2 illustrates, PbHB12 gene is expressed in birch-leaf pear root, stem and leaf, and this gene is salt stress and drought stress responsive genes, may participate in the response of birch-leaf pear to high salt and drought stress.
Embodiment 3, turn PbHB12 Escherichia coli Growth curve and gene expression analysis
By the recombinant plasmid p-MD18-PbHB12 that prokaryotic expression carrier pET-22b (+) and embodiment 1 obtain, EcoR I and HindIII (ThermoScientific company of the U.S.) is used to carry out double digestion respectively, TaKaRaMiniBESTAgaroseGelDNAExtractionKitVer4.0 (precious biotechnology (Dalian) company limited) is adopted to carry out glue recovery, reclaim product T4DNALigase enzyme (ThermoScientific company of the U.S.) and connect rear transformation of E. coli E.coliDH5 α competent cell (precious biotechnology (Dalian) company limited), picking recombinant plasmid on the LB flat board of penbritin (Amp) resistance, carry out enzyme and cut qualification and sequence verification, by expression vector called after pET-22b (+)-PbHB12 of successful fusion goal gene.
Empty carrier pET-22b (+) and pET-22b (+)-PbHB12 is transformed BL21 (DE3) respectively, obtains recombinant bacterium BL21-pET-22b (+) and BL21-pET-22b (+)-PbHB12.
Investigate the growth curve of each recombinant bacterium under high salt and drought stress conditions and the expression of PbHB12 gene.In 5mL LB liquid medium, (be added with final concentration is 100 μ gmL to each recombinant bacterium difference picking list colony inoculation
-1penbritin) in, 37 DEG C of shaking culture are spent the night, and obtain seed liquor.
Seed liquor is transferred to new LB liquid medium by inoculum size 1%, and (being added with final concentration is 100 μ gmL
-1penbritin) in, in 37 DEG C of shaking culture to OD
600=0.5, get part culture collection and induce thalline without IPTG; Separately getting part culture, to add final concentration be 0.5mmolL
-1iPTG (Yi Bing Ji – β – D – Thiogalactopyranoside) induce, collect after abduction delivering 3h IPTG induce thalline.Extract the total serum IgE that IPTG induces forward and backward thalline, according to PowerScript II
tMthermoScript II (TaKaRa company) specification sheets synthesis cDNA first chain, with PbHB12_F (SEQIDNO:9) and PbHB12_R (SEQIDNO:10) for primer, amplification PbHB12 gene, 16SrDNA is as reference gene (Chaurasiaetal., 2008), carry out Semiquatitative RT-PCR assay detection, analyze the expression of PbHB12 gene.
Be 1% proceed to seed liquor respectively in control medium, high-salt stress substratum and Drought stress simulation substratum and cultivate according to inoculum size.Control medium is LB nutrient solution, high-salt stress substratum is be added with the LB nutrient solution that final concentration is 150mM sodium-chlor, and Drought stress simulation substratum is added with the LB nutrient solution that final concentration is 10% (mass percentage concentration) polyethylene glycol 6000 in being.The OD of each culture is measured every 3h
600, for drawing growth curve; And after treatment 0,3,6 and 12h sample from each culture collect thalline, extract the total serum IgE of each thalline, according to PowerScript II
tMthermoScript II (TaKaRa company) specification sheets synthesis cDNA first chain, with PbHB12_F (SEQIDNO:9) and PbHB12_R (SEQIDNO:10) for primer, amplification PbHB12 gene, 16SrDNA is as reference gene, carry out Semiquatitative RT-PCR assay detection, analyze the expression of PbHB12 gene.
Fig. 3 result shows, in LB liquid medium, the growth curve of BL21-pET-22b (+)-PbHB12 and the growth curve of BL21-pET-22b (+) reach unanimity (Fig. 3 A); High-salt stress substratum (containing 150mMNaCl) significantly suppress the growth of BL21-pET-22b (+), the growth of BL21-pET-22b (+)-PbHB12 is not subject to remarkably influenced (Fig. 3 B), Drought stress simulation substratum (10%PEG) growth to BL21-pET-22b (+) has restraining effect, and the growth of BL21-pET-22b (+)-PbHB12 is not subject to remarkably influenced (Fig. 3 C).
Fig. 4 result shows: without IPTG induction, PbHB12 gene is slightly expressed in BL21-pET-22b (+)-PbHB12, does not express in BL21-pET-22b (+) bacterial strain; After ITPG induces 3h, in BL21-pET-22b (+)-PbHB12, PbHB12 gene expression amount strengthens, and does not express (Fig. 4 A) in BL21-pET-22b (+).Under high-salt stress condition (150mMNaCl), PbHB12 gene is significantly expressed in BL21-pET-22b (+)-PbHB12, and does not express in BL21-pET-22b (+); Under Drought stress simulation condition (10%PEG), slight induction PbHB12 gene is expressed (Fig. 4 B) in BL21-pET-22b (+)-PbHB12.
Example 3 illustrates PbHB12 gene to proceed to intestinal bacteria and improve the tolerance of intestinal bacteria to high-salt stress and osmotic stress.
Embodiment 4, turn PbHB12 gene cultivate plant with adverse resistance
1) acquisition and the qualification of PbHB12 gene strain is turned
With BamHI (ThermoScientific company of the U.S.) and PstI (ThermoScientific company of the U.S.), double digestion (operation steps is shown in specification sheets) is carried out to pCAMBIA2301 carrier and p-MD18-PbHB12 recombinant plasmid, digestion products 0.8% electrophoresis detection, utilizes TaKaRaMiniBESTAgaroseGelDNAExtractionKitVer4.0 (precious biotechnology (Dalian) company limited) to carry out glue recovery.PbHB12 gene and pCAMBIA2301 carrier (operation steps is shown in specification sheets) is connected with T4DNAligase (ThermoScientific company of the U.S.), freeze-thaw method transformation of E. coli competence E.coli5 ɑ (precious biotechnology (Dalian) company limited), chooses mono-clonal next day and carries out order-checking qualification.Success obtains the pCAMBIA2301 recombinant vectors carrying PbHB12 gene.By described recombinant vectors transform Agrobacterium tumefaciens LBA4404 (precious biotechnology (Dalian) company limited), step of converting is shown in Agrobacterium LBA4404 specification sheets.To the Agrobacterium-mediated Transformation tomato Moneymaker of recombinant vectors be carried, and obtain turning PbHB12 transgenic tomato.Empty carrier pCAMBIA2301 is transformed into tomato Moneymaker, obtains adjoining tree.Method for transformation and conversion condition reference literature SunH-J, UchiiS, WatanabeS, EzuraH (2006) AHighlyEfficientTransformationProtocolforMicro-Tom, aModelCultivarforTomatoFunctionalGenomics.PlantandCellPh ysiology47:426-431.
Extract the RNA turning PbHB12 transgenic tomato tender leaf, synthesis cDNA first chain, primer PbHB12_F (SEQIDNO:9) and PbHB12_R (SEQIDNO:10) is utilized to carry out RT-PCR qualification, prove that this turns PbHB12 transgenic tomato and carries PbHB12 gene, this is turned PbHB12 transgenic tomato called after T0 for transgenic line.T0 is moved to heliogreenhouse for transgenic line cultivate, treat tomato result, individual plant results seed.Each single-strain seed is sowed at respectively and is added with final concentration is 50.0mgL
-1in the MS substratum of kantlex, treat that T1 grows true leaf for plant and moves to greenhouse-grown.By T1 for after individual plant results seed, getting RT-PCR and be accredited as positive seed and sow respectively, is 50.0mgL with being added with final concentration
-1the MS substratum of kantlex continues screening, to observe T2 for plant separation case.T2 is when for seed, on the MS substratum containing kantlex, percentage of germination is 100%, and this T2 is isozygoty to turn PbHB12 gene strain seed for seed, obtains stable 10 altogether and isozygotys and turn PbHB12 gene strain seed.
Choose 3 T2 after planting to cultivate for Transgenic wheat line seed (P1A, P2H and P5B), extract blade total serum IgE, with cDNA first chain for template, utilize the expression of semi-quantitative RT-PCR analysis PbHB12 gene in 3 transfer-gen plants.Set up the contrast of Wild plant tomato Moneymaker simultaneously.Result shows, PbHB12 gene expression amount in P1A is the highest, takes second place in P2H, the most weak in P5B (in Fig. 5 A and B)
Transgenosis plant in the present age is shown in note: T0 representative, the plant that T1 representative is shown the seed that T0 produces for selfing and grown up to by it, and T2 represents the seed showing that T1 produces for selfing and the plant grown up to by it.
2) Salt-Tolerance Identification of PbHB12 gene strain is turned
Get 3 T2 for each 30 of Transgenic wheat line seed (P1A, P2H and P5B), be built in aseptic triangular flask at Bechtop, carry out following sterilisation step: seed 100ml75% aqueous ethanolic solution soaks 30s; 100ml10% clorox soaks seed 20min, and period constantly shakes; With sterile distilled water cleaning 3-5 time (each 3min).Then by planting seed on 1/2MS substratum, to be placed on by culturing bottle in constant incubator (25 DEG C, dark), to cultivate 3 days, changing culture condition is: at 25 DEG C-22 DEG C, and illumination every day 16h, dark 8h, cultivate 2-3 all.Carefully seedling is moved on to from substratum (organic grow soil in 10cm flowerpot, matrix is: organic content 58 ~ 72%, nitrogen, phosphorus, potassium total amount 2.2 ~ 4.5%, calcium 27.3g/kg, the various trace elements needed for plant such as iron 9.5g/kg, zinc 0.7g/kg etc.Be placed in heliogreenhouse growth.One week twice water, each 300ml water, grows 8 weeks, and every 15 is one group, totally 2 groups.Every other day add NaCl, make NaCl in medium concentration increase 25mM, until two groups of NaCl in medium final concentrations reach 250mM and 300mM respectively.After plant grows 7d in 250mM and 300mMNaCl, measure Plant Leaf chlorophyll contents, survival rate and water content.Set up the contrast of Wild plant tomato Moneymaker, the same transfer-gen plant of culture condition simultaneously.Chlorophyll content adopts SPAD (Konica, Osaka, Japan) instrument to detect, measuring method reference literature
wangH,
liuG,
liC,
powellAL,
reid mS,
zhangZ,
jiangCZ(2013) Defenceresponsesregulatedbyjasmonateanddelayedsenescence causedbyethylenereceptormutationcontributetothetolerance ofpetuniatoBotrytiscinerea.
molecularPlantPathology.14 (5): 453-69.
Result shows, no matter be Wild plant or transfer-gen plant, the injury of 300mMNaCl process to plant is greater than 250mMNaCl process; After the salt stress process of two kinds of concentration, turn the chlorophyll content (Fig. 7 A, WT Wild plant) of PbHB12 gene plant, survival rate (Fig. 6 B) and water content (Fig. 8 A) apparently higher than Wild plant; Wherein, P1A indices is the highest, and P2H takes second place, and P5B is lower.Shown in the above results with Fig. 5 B, Semiquatitative RT-PCR assay result conforms to, and in P1A, PbHB12 expresses the highest, and P2H takes second place, and P5B is lower.Test-results illustrates, the salt tolerance turning PbHB12 gene plant is obviously better than Wild plant, and its salt tolerance is relevant with PbHB12 expression amount simultaneously.
3) the drought tolerance qualification of PbHB12 gene strain is turned
Once arid and 3 drought stresses, two kinds of processing modes are adopted to carry out drought tolerance qualification (a drought stress process and three drought stress process) to transfer-gen plant P1A, P2H and P5B, set up the contrast of Wild plant tomato Moneymaker, the same transfer-gen plant of culture condition simultaneously; In addition to transfer-gen plant and Wild plant tomato Moneymaker, set up Abiotic stress conditions to cultivate contrast, the mode of watering is: biweekly, each 300ml.Measure Plant Leaf chlorophyll contents, survival rate and water content after each processing mode.
A drought stress process: the culturing process before tomato the 8th true leaf launches completely is with the present embodiment title 2) in add before NaCl, after 8th true leaf launches, start to carry out drought stress, disposable control water 16d, until soil fluid loss is 75%, waters subsequently and make plant recover 7d (300ml water every day).
Three drought stress process: the culturing process before tomato the 8th true leaf launches completely is with the present embodiment title 2) in add before NaCl, after 8th true leaf launches, start to carry out Osmotic treatment (control water 8 days), carry out Recovery processing (water 300ml) subsequently, carry out arid, recovery, Osmotic treatment again, water subsequently and recover 7d (300ml water every day).
Result shows, after two kinds of drought stress process, Wild plant chlorophyll is lost all higher, and forfeiture rate is respectively 40.21 and 44.44%; And the chlorophyll content of transfer-gen plant P1A, P2H and P5B still maintains a higher level, and between three plant, chlorophyll content difference is not obvious, and under two kinds of process, losing on average rate is respectively 8.73% and 19.9% (Fig. 7 B).Under a drought stress, compared with Wild plant, the survival rate of transfer-gen plant P1A, P2H and P5B improves 2.52,2.52 and 2.42 times (Fig. 6 A) respectively.Under three drought stresses, the survival rate of P1A, P2H and P5B improves 3.92,3.65 and 3.09 times (Fig. 6 A) respectively than Wild plant.Under abiotic stress, Wild plant water content is 89.75%, and transfer-gen plant P1A, P2H and P5B water content is respectively 89.56%, 88.49% and 89.24%.After a drought stress, the water content of Wild plant reduces to 71.25%, and P1A, P2H and P5B water content still remains higher, is respectively 91.23%, 90.25% and 87.45% (Fig. 8 B).After three drought stresses, the water content of Wild plant reduces to 64.25%, and P1A, P2H and P5B water content reduces to 87.56%, 84.25% and 81.23 (Fig. 8 B) respectively.These results suggest that, the drought-resistance ability turning PbHB12 gene plant is obviously better than Wild plant.
Example 4 illustrates compared with wild strain, turn the resistance of reverse of PbHB12 transgenic tomato to high salt and drought stress and significantly improve, in the abiotic stress breedings such as resistance to high salt, arid, PbHB12 gene application prospect is very good.
SEQUENCELISTING
<110> Jiangsu Province Agriculture Science Institute
<120> plant stress tolerance related transcription factor and encoding gene thereof and application
<130>20151223
<160>10
<170>PatentInversion3.3
<210>1
<211>1029
<212>DNA
<213> birch-leaf pear
<400>1
attgttcatctattgttgagagcattacgagtcgatatcaatcaagcccaacaacaaata60
atcgagaaccaaagtcatggagaggaggaaagaggagtgctatgaagaagaaactttaga120
ctacggcatagagccgcagtctgcgatgaaaaggaagaagaacaagagcaagaacacgag180
gcggtttagcgacgaacaaatcagcttgttggagtctatattcgaagcagactcgaagct240
cgagccaaggaggaaggtgcagttggcaagagagcttgggttgcaacctcgccaggttgc300
gatatggtttcagaacagaagagctagatggaggtccaaacagatagagcaagactacag360
aagtctcagagaagattatgacaagttagcatctcggttcgaatctttgaaggaggagaa420
gcagtctttgcttatgcagttgcagaagttacacgatcttgtgggaacatctcgtgctgg480
cgcccctaccgaagattctctcgcaaatcagacggcagatggatcgagttacaaagatgg540
gaattgtaagactactgctcgagtaagactagaagaggcattggagaagacaggagccat600
agataaacatacaagcaatgatgttggtggggagtttggagatgaaaggcacgagcttct660
gaacattggtcaattggatgcctctgtgacacctctaggattgcataggttggattcagg720
caacattctgtttgatcgttgtaattcacactggttaaatttctggacctgaaatttcca780
accccccccactcagcacataaaagtttggtgtaattggtgtcaagattttgttctataa840
tccatgtattgaggtcaactaacagcttctatcgacgtcaaacagtaagcggaccggact900
atgcagcagcttattcttctgagctcaatacttgttgagttgttgcataatttggttcgc960
taattgttctcaacagactattcaaagagaaaaaaaaaaaaaaaaaacactgtcatgccg1020
ttacgtagc1029
<210>2
<211>231
<212>PRT
<213> birch-leaf pear
<400>2
MetGluArgArgLysGluGluCysTyrGluGluGluThrLeuAspTyr
151015
GlyIleGluProGlnSerAlaMetLysArgLysLysAsnLysSerLys
202530
AsnThrArgArgPheSerAspGluGlnIleSerLeuLeuGluSerIle
354045
PheGluAlaAspSerLysLeuGluProArgArgLysValGlnLeuAla
505560
ArgGluLeuGlyLeuGlnProArgGlnValAlaIleTrpPheGlnAsn
65707580
ArgArgAlaArgTrpLysSerLysGlnIleGluGlnAspTyrArgSer
859095
LeuArgGluAspTyrAspLysLeuAlaSerArgPheGluSerLeuLys
100105110
GluGluLysGlnSerLeuLeuMetGlnLeuGlnLysLeuHisAspLeu
115120125
ValGlyThrSerArgAlaGlyAlaProThrGluAspSerLeuAlaAsn
130135140
GlnThrAlaAspGlySerSerTyrLysAspGlyAsnCysLysThrThr
145150155160
AlaArgValArgLeuGluGluAlaLeuGluLysThrGlyAlaIleAsp
165170175
LysHisThrSerAsnAspValGlyGlyGluPheGlyAspGluArgHis
180185190
GluLeuLeuAsnIleGlyGlnLeuAspAlaSerValThrProLeuGly
195200205
LeuHisArgLeuAspSerGlyAsnIleLeuPheAspArgCysAsnSer
210215220
HisTrpLeuAsnPheTrpThr
225230
<210>3
<211>25
<212>DNA
<213>artificial
<220>
<223>PbHB12_F1
<400>3
attgttcatctattgttgagagcat25
<210>4
<211>25
<212>DNA
<213>artificial
<220>
<223>PbHB12_F2
<400>4
cacattcacttaaaaattaatactt25
<210>5
<211>24
<212>DNA
<213>artificial
<220>
<223>OUTER
<400>5
gctgtcaacgatacgctacgtaac24
<210>6
<211>22
<212>DNA
<213>artificial
<220>
<223>INNER
<400>6
gctacgtaacggcatgacagtg22
<210>7
<211>21
<212>DNA
<213>artificial
<220>
<223>Actin_F
<400>7
ctcccagggctgtgtttccta21
<210>8
<211>21
<212>DNA
<213>artificial
<220>
<223>Actin_R
<400>8
ctccatgtcatcccagttgct21
<210>9
<211>24
<212>DNA
<213>artificial
<220>
<223>PbHB12_F
<400>9
gaggaaagaggagtgctatgaaga24
<210>10
<211>19
<212>DNA
<213>artificial
<220>
<223>PbHB12_R
<400>10
aaaccgcctcgtgttcttg19
Claims (10)
1. plant stress tolerance related transcription factor is following 1) or 2) protein:
(1) protein be made up of aminoacid sequence shown in SEQIDNO:2;
(2) by aminoacid sequence shown in SEQIDNO:2 through the disappearance of one or several amino-acid residue or interpolation and the protein that by (1) derived relevant to plant stress tolerance shape.
2. the encoding gene of plant stress tolerance related transcription factor described in claim 1.
3. encoding gene according to claim 2, is characterized in that: the encoding gene of described plant stress tolerance related transcription factor is arbitrary described gene in following (1)-(2):
(1) the 77-772 position Nucleotide held from 5 ' of sequence shown in SEQIDNO:1;
(2) sequence shown in SEQIDNO:1.
4. the recombinant vectors containing gene described in Claims 2 or 3, expression cassette, transgenic cell line or recombinant bacterium.
5. recombinant vectors according to claim 4, is characterized in that: described recombinant vectors is the recombinant vectors obtained insert gene described in Claims 2 or 3 in carrier pET-22b (+) after; Or the recombinant vectors obtained insert gene described in Claims 2 or 3 in carrier pCAMBIA2301 after.
6. the described encoding gene of one of birch-leaf pear stress tolerance correlation transcription factor or claim 2-3 described in claim 1 is cultivating the application in plant with adverse resistance; Described resistance of reverse is drought tolerance, salt tolerance.
7. cultivate a method for transgenic plant, be that the encoding gene described in Claims 2 or 3 is imported in object plant, obtain the transgenic plant with resistance of reverse.
8. method according to claim 7, is characterized in that: in described encoding gene insertion vector pCAMBIA2301, then imports in object plant.
9. method according to claim 8, is characterized in that: described object plant is pears, paddy rice, tomato, willow, apple, Arabidopis thaliana, tobacco or clover.
10. according to the described method of one of claim 7-9, it is characterized in that: described resistance of reverse is salt tolerance and/or drought tolerance.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510982617.2A CN105367644B (en) | 2015-12-23 | 2015-12-23 | Plant stress tolerance related transcription factor and its encoding gene and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510982617.2A CN105367644B (en) | 2015-12-23 | 2015-12-23 | Plant stress tolerance related transcription factor and its encoding gene and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105367644A true CN105367644A (en) | 2016-03-02 |
| CN105367644B CN105367644B (en) | 2019-04-12 |
Family
ID=55370324
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510982617.2A Active CN105367644B (en) | 2015-12-23 | 2015-12-23 | Plant stress tolerance related transcription factor and its encoding gene and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105367644B (en) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106222182A (en) * | 2016-08-11 | 2016-12-14 | 江苏省农业科学院 | The IbERF5 gene of coding sweet potato ERF transcription and application |
| CN107858341A (en) * | 2017-12-07 | 2018-03-30 | 鲁东大学 | Diversiform-leaved poplar PeMIPS1 genes and its application |
| CN108530524A (en) * | 2018-04-18 | 2018-09-14 | 山东省果树研究所 | The application of birch-leaf pear Pb4RMYB genes and its coding albumen in improving plant salt endurance |
| CN112458100A (en) * | 2020-12-10 | 2021-03-09 | 西北农林科技大学 | Application of apple HD-Zip I transcription factor gene MdHB-7 in improving plant water utilization efficiency |
| CN112626086A (en) * | 2021-01-20 | 2021-04-09 | 山东大学 | Application of medicago truncatula gene MtREVOLUTA in improving salt tolerance of medicago sativa of kindred forage grass of leguminosae |
| CN116042704A (en) * | 2022-10-21 | 2023-05-02 | 中国农业科学院生物技术研究所 | Application of AsMinpp1 gene in improving drought tolerance and salt tolerance of plants |
-
2015
- 2015-12-23 CN CN201510982617.2A patent/CN105367644B/en active Active
Non-Patent Citations (3)
| Title |
|---|
| HONG WANG等: "Genome-wide identification of pear HD-Zip gene family and expression patterns under stress induced by drought, salinity, and pathogen", 《ACTA PHYSIOLOGIAE PLANTARUM》 * |
| NONE: "Accession ID: XP_009361303，PREDICTED: homeobox-leucine zipper protein ATHB-12-like [Pyrus x bretschneideri]", 《GENBANK DATABASE》 * |
| 王宏等: "植物HD-Zip转录因子的生物学功能", 《遗传》 * |
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106222182A (en) * | 2016-08-11 | 2016-12-14 | 江苏省农业科学院 | The IbERF5 gene of coding sweet potato ERF transcription and application |
| CN106222182B (en) * | 2016-08-11 | 2018-11-02 | 江苏省农业科学院 | The IbERF5 genes of coding sweet potato ERF transcription and application |
| CN107858341A (en) * | 2017-12-07 | 2018-03-30 | 鲁东大学 | Diversiform-leaved poplar PeMIPS1 genes and its application |
| CN107858341B (en) * | 2017-12-07 | 2020-12-15 | 鲁东大学 | Populus euphratica PeMIPS1 gene and application thereof |
| CN108530524A (en) * | 2018-04-18 | 2018-09-14 | 山东省果树研究所 | The application of birch-leaf pear Pb4RMYB genes and its coding albumen in improving plant salt endurance |
| CN112458100A (en) * | 2020-12-10 | 2021-03-09 | 西北农林科技大学 | Application of apple HD-Zip I transcription factor gene MdHB-7 in improving plant water utilization efficiency |
| CN112626086A (en) * | 2021-01-20 | 2021-04-09 | 山东大学 | Application of medicago truncatula gene MtREVOLUTA in improving salt tolerance of medicago sativa of kindred forage grass of leguminosae |
| CN116042704A (en) * | 2022-10-21 | 2023-05-02 | 中国农业科学院生物技术研究所 | Application of AsMinpp1 gene in improving drought tolerance and salt tolerance of plants |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105367644B (en) | 2019-04-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105367644A (en) | Plant stress tolerance associated transcription factor, encoding gene of plant stress tolerance associated transcription factor, and application of encoding gene | |
| CN101503467B (en) | Plant stress tolerance related transcription factor GmNAC20, coding gene and use thereof | |
| CN109456982B (en) | Application of rice OsMYB6 gene and encoding protein thereof in drought resistance and salt resistance | |
| CN109536516A (en) | The clone of drought-resistant maize gene ZmDSR and its application | |
| CN109232725A (en) | Soybean C2H2 type single-zinc finger protein transcription factor and encoding gene and application | |
| CN113621625B (en) | Application of sesame SiERF103 gene in enhancing plant resistance | |
| CN102399268B (en) | Plant stress tolerance-related transcription factor GmNAC11, coding gene and application thereof | |
| CN105838726B (en) | A kind of Salt Tolerance Gene in Alfalfa gene M sCDPK and its coding albumen and application | |
| CN102154321A (en) | Method for breeding stress-resistance transgenic rice | |
| CN109485705A (en) | Rice drought tolerance associated transcription factor OsTLP6 and encoding gene and application | |
| CN101659699B (en) | Plant stress resistance-related protein GmSIK2 and coding gene and application thereof | |
| CN103408646B (en) | Banana ERF transcription MaERF and expression vector | |
| CN102533802B (en) | Tobacco drought response gene NtRHF1 and application of encoding protein thereof | |
| CN101173286B (en) | Arabidopsis thaliana salt-tolerance gene SRAT2 and uses thereof | |
| CN110408627A (en) | Anti reversion relative protein matter and its encoding gene and application | |
| CN109456983A (en) | Soybean GmERF10 gene and its application | |
| CN104892740A (en) | Plant stress tolerance associated protein GmEF13, and encoding gene and application thereof | |
| CN101993479B (en) | Plant stress tolerance related transcription factor TaWRKY1 as well as coding gene and application thereof | |
| CN102417911B (en) | Method for over-expressing brassica napus BnLAS gene for improving plant drought resistance | |
| CN102174525B (en) | Brassica napus resistance-related gene (i)BnWRERF50(/i) and preparation method as well as application | |
| CN101921776B (en) | Brassica napus disease-resistance related gene BnERF56 and application thereof | |
| CN105255914A (en) | Lycium barbarum mitogen activated protein kinase kinase and application in improving saline-alkaline tolerance of plant | |
| CN101182522B (en) | Arabidopis thaliana salt tolerance gene SRAT1 and uses thereof | |
| CN109355270A (en) | A kind of rice kinases OSK1 and its application | |
| CN109354620A (en) | Rice transcription factor Os07g05010 gene and its application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB02 | Change of applicant information |
Address after: 211225 Base of Jiangsu Academy of Agricultural Sciences, Baima Town National Agricultural Science and Technology Park, Lishui District, Nanjing City, Jiangsu Province Applicant after: Jiangsu Academy of Agricultural Sciences Address before: 210014 No. 50 Zhongling Street, Xuanwu District, Nanjing City, Jiangsu Province Applicant before: Jiangsu Academy of Agricultural Sciences |
|
| CB02 | Change of applicant information | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |