CN101921776B - Brassica napus disease-resistance related gene BnERF56 and application thereof - Google Patents

Abstract

The invention discloses a gene BnERF56 for enhancing the resistance of plants against saprophytic nutritional fungi, as well as a preparation method and application thereof. The sequence of a separated gene is a nucleotide sequence shown as the SEQ ID No.1. The sequence of a separated polypeptide is an amino acid sequence shown as SEQ ID No.2. The invention relates to the application of the gene BnERF56 in enhancing the resistance of the plants against the saprophytic nutritional fungi of Sclerotinia sclertiorum and Botrytis cinerea. The gene has obvious induced expression after disease sources are infected. The invention also relates to separation clone, expression regulation and control and application of the disease-resistance related gene BnERF56. The gene BnERF56 can enhance the resistance of the plants against the saprophytic nutritional fungi of the Sclerotinia sclertiorum and the Botrytis cinerea. The resistance of the plants against the saprophytic nutritional fungi of the Sclerotinia sclertiorum and the Botrytis cinerea can be enhanced by improving the expression of the gene BnERF56 through a gene engineering technique, and the gene can be used as a resistance mark for breeding rape disease-resistance varieties or as a candidate gene of the gene engineering for molecular breeding.

Description

Brassica napus disease-resistance related gene BnERF 56 and application thereof

Technical field

The present invention relates to plant genetic engineering and biological technical field.Be specifically related to the BnERF56 gene of a kind of enhancement of plant to resistance to sclerotinia sclerotiorum; Also relate to the preparation method of a kind of enhancement of plant simultaneously to the BnERF56 gene of resistance to sclerotinia sclerotiorum, also relate to the BnERF56 gene in enhancement of plant to the sclerotinite resistance, to the application in the botrytis cinerea resistance.

Background technology

Plant responds and suppresses cause of disease and infect through activating a series of resistances; Reach the purpose (Feys of self-protection; B.J.; And Parker, J.E.Interplay of signal ing pathways in plant disease resistance.Trends Genet.2000.16:449-455.Glazebrook, J.Genes controlling expression of defense responses in Arabidopsis-2001 status.Curr.Opin.Plant Biol.2001.4:301-308.) identification of special cause of disease has been started these cell responses fast; Activated one or more resistance signal transduction path; Caused the rapid induction of a series of resistant genes to express (Bostock, R.M.Signal crosstalk and induced resistance:Straddling the line between cost and benefit.Annu.Rev.Phytopathol.2005.43:545-580 Rojo, E.; Solano; R., and Sanchez-Serrano, J.J.Interactions between signaling compounds involved in plant defense.J.Plant Growth Regul.2003.22:82-98).These resistance approach are mainly by Whitfield's ointment; Jasmonic; Ethene and their verivate are regulated (Thatcher LF, Anderson JP; Singh KB Plant defense responses:What have we learnt from Arabidopsis? Funct Plant Biol 2005,31:1-19).They are relevant with different pathogeny resistance, and big quantity research shows, Whitfield's ointment is being brought into play keying action (Durrant W.E., and Dong in the part of plant opposing biotroph pathogeny and systemic acquired resistance; X.Systemic acquired resistance.Annu.Rev.Phytopathol.2004.42:185-209.Gaffney T., Friedrich, L., Vernooij; B., Negrotto, D., Nye; G., Uknes, S.; Ward, E., Kessmann; H., and Ryals, J.Requirement of salicylic acid for the induction of systemic acquired resistance.Science 1993.261:754-756); And induced systemic resistance depends on jasmonic and Ethylene Signal approach, and these two kinds of hormone signal approach are for plant opposing saprophytic form pathogeny, like grey mold etc.; Be very important (Thomma B., Eggermont, K.; Penninckx, I., Mauch-Mani; B., Vogelsang, R.; Cammue, B., and Broekaert; W.Separate jasmonate-dependent and salicylate-dependent defense-response pathways in Arabidopsis are essential for resistance to distinct microbial pathogens.Proc.Natl.Acad.Sci.U.S.A.1998.95:15107-15111.T homma B., Eggermont, K.; Tierens; K., and Broekaert, W.Requirement of functional ethylene-insensitive 2 gene for efficient resistance of Arabidopsis to infection by Botrytis cinerea.Plant Physiol.1999.121:1093-1102.).Yet this simple dichotomy isolates SA and MJ/ET signal and comes, and thinks that promptly they are directed to the view of biotroph and saprophytic nutrition type pathogeny respectively, maybe be too simple; Recently, the Whitfield's ointment signal also comes to light and has participated in the local resistance to saprophytic nutrition type pathogeny grey mold, with (the Ferrari S. that infects that has suppressed grey mold after the bigcatkin willow s.t. significantly; Plotnikova; J.M., De, L.G.; And Ausubel; F.M.Arabidopsis local resistance to Botrytis cinerea involves salicylic acid and camalexin and requires EDS4 and PAD2, but not SID2, EDS5 or PAD4.Plant are J.2003.35:193-205.).The activated that infects of pathogeny is not a single signal pathway, but the signal network of a complex interactions.

It is complicated that the resistance of plant is regulated; Involve into a large amount of transcription factor families (Singh KB; Foley RC, On ~ ate-Sa ' nchez L (2002) Transcription factors in plant defense and stress responses.Curr Opin Plant Biol 5:430-436), identify and utilize crucial transcription factor; For transforming farm crop; It is very important improving resistance, and one of them transcription factor family that is utilized is exactly the ethylene responses factor (ERF) family, and it belongs to the part of AP2/ERF superfamily.In Arabidopis thaliana, nearly 147 members of AP2/ERF superfamily, they have different functions at encoded protein; Be relevant to the whole vital process of plant, comprise regulating and grow (van der Graaff E, Dulk-Ras AD; Hooykaas PJ, Keller B (2000) Activation tagging of the LEAFY PETIOLE gene affects leaf petiole development in Arabidopsis thaliana.Development 127:4971-4980 Banno H, Ikeda Y; Niu QW, Chua NH (2001) Overexpression of Arabidopsis ESR1 induces initiation of shoot regeneration.Plant Cell 13:2609-2618), in response to abiotic pressure; Like arid, (Liu Q, Kasuga M such as cold; Sakuma Y, Abe H, Miura S; Yamaguchi-Shinozaki K, Shinozaki K (1998) Two transcription factors, DREB1 and DREB2; With an EREBP/AP2 DNA binding domain separate two cellular signal transduction pathways in drought-and low-temperature-responsive gene expression; Respectively, in Arabidopsis.Plant Cell 10:1391-1406 Stockinger EJ, Gilmour SJ; Thomashow MF (1997) Arabidopsis thaliana CBF1 encodes an AP2 domain-containing transcriptional activator that binds to the C-repeat/DRE; A cis-acting DNA regulatory element that stimulates transcription in response to low temperature and water deficit.Proc Natl Acad Sci USA 94:1035-1040), organism pressure is like fungal infection (Berrocal-Lobo M; Molina A; Solano R Constitutive expression of ETHYLENE-RESPONSE-FACTOR1 in Arabidopsis confers resistance to several necrotrophic fungi.Plant J, 200229:23-32 Luis Onate-Sanchez, Jonathan P.Anderson; Jodi Young; And Karam B.Singh* AtERF14, aMember of the ERF Family of Transcription Factors, Plays a Nonredundant Role in PlantDefense Plant Physiology; 2007,143; 400-409, Martial Pre ', Mirna Atallah; Antony Champion; Martin De Vos2, Corne ' M.J.Pieterse, and Johan Memelink* The AP2/ERF Domain Transcription Factor ORA59Integrates Jasmonic Acid and Ethylene Signals in Plant Defense Plant Physiology; 2008,147; 1347-1357).The AP2/ERF superfamily all contains an AP2/ERF conserved domain, and it is made up of 60-70 amino acid, combines relevant with DNA; The AP2/ERF superfamily is divided into ERF, three subfamilies of AP2 and RAV.The ERF subfamily has comprised all disease-resistant relevant AP2/ERF gene (Gutterson N; Reuber TL; Regulation of disease resistance pathways by AP2/ERF transcription factors.Curr Opin Plant Biol, 2004,7:465-471).ERF1 and ORA59 are proved to be the node of jasmonic and Ethylene Signal in the Arabidopis thaliana, and constitutive expression ERF1 has activated the expression of a series of resistance related genes, comprises PDF1.2 and ChiB; Resistance (Solano, R., Stepanova have significantly been strengthened to fungies such as grey mold; A., Chao, Q.M.and Ecker; J.R. (1998) Nuclear events in ethylene signaling:a transcriptional cascade mediated by ETHYLENE-INSENSITIVE3 and ETHYLENERESPONSE-FACTOR1.Genes Dev; 12,3703-3714.Berrocal-Lobo M, Molina A; Solano R (2002) Constitutive expression of ETHYLENE-RESPONSE-FACTOR1 in Arabidopsis confers resistance to several necrotrophic fungi.Plant J 29:23-32 Lorenzo O; Piqueras R, Sanchez-Serrano JJ, Solano R (2003) ETHYLENE RESPONSE FACTOR1 integrates signals from ethylene and jasmonate pathways in plant defense.Plant Cell 15:165-178 Martial Pre '; Mirna Atallah; Antony Champion, Martin De Vos2, Corne ' M.J.Pieterse; And Johan Memelink* The AP2/ERF Domain Transcription Factor ORA59Integrates Jasmonic Acid and Ethylene Signals in Plant Defense Plant Physiology; July 2008, Vol.147, pp.1347-1357).Constitutive expression AtERF2 in Arabidopis thaliana (McGrath KC, Dombrecht B, Manners JM; Schenk PM; Edgar CI, Maclean DJ, Scheible WR; Udvardi MK; Kazan K (2005) Repressor-and activatortype ethylene response factors functioning in jasmonate signaling and disease resistance identified via a genome-wide screen of Arabidopsis transcription factor gene expression.Plant Physiol 139:949-959) and AtERF14 (Luis Onate-Sanchez, Jonathan P.Anderson, Jodi Young; And Karam B.Singh* AtERF14; AMember of the ERF Family of Transcription Factors, Plays a Nonredundant Role in Plant Defense Plant Physiology, January 2007; Vol.143 pp.400-409) also is in the news and causes the expression of high-caliber resistance related gene PDF1.2 and ChiB; Yet AtERF4 but suppresses expression (McGrath KC, the Dombrecht B of resistance related gene PDF1.2; Manners JM; Schenk PM, Edgar CI, Maclean DJ; Scheible WR; Udvardi MK, Kazan K Repressor-and activatortype ethylene response factors functioning in jasmonate signaling and disease resistance identified via a genome-wide screen of Arabidopsis transcription factor gene expression.Plant Physiol.2005.139:949-959), the regulating effect of member's antagonism genes involved of hint ERF family is various; By just regulating and control, negative regulation is arranged also.

Sclerotium disease is a kind of saprophytic nutrition type fungi that is similar to grey mold, and this destructive pathogeny infects and surpasses 400 kind of plant, distributes extensively.Rape is one of the most important oil crops, and sclerotium disease causes the root of rape, and rotting of stem and angle fruit caused huge production loss.Although the sclerotium disease serious threat agriculture prodn, plant is to the molecular mechanism of the host-resistance of sclerotinite, we still know little about it.Also there are not to find immunity fully or high anti-rape cultivation kind (Liu, S., Wang, H., Zhang up till now; J., Fitt, B.D., Xu; Z., Evans, N., Liu; Y., Yang, W., and Guo; X.2005.In vitro mutation and selection of doubled-haploid Brassica napus lines with improved resistance to Sclerotinia sclerotiorum.Plant Cell Rep.24:133-144.), therefore, probe into the resistance mechanism of plant, find that new resistant gene has far reaching significance this pathogeny.

Therefore, the present invention has developed the BnERF56 gene of an enhancement of plant to saprophytic nutrition type fungus resistant.Through this gene of fluorescence quantitative PCR detection mainly at root, stem is expressed in the leaf; After infecting, sclerotinite significantly induces this expression of gene; The overexpression of this gene has significantly improved pathogeny genes involved PDF1.2, ChiB, and the expression of PR-1 and PR-2 has strengthened the resistance to saprophytic nutrition type fungi sclerotinite and grey mold.Indicating that this gene has suitable application prospect in the rape resistance breeding.

Summary of the invention

The objective of the invention is to be to provide the BnERF56 gene of a kind of enhancement of plant to saprophytic nutrition type fungus resistant; This gene in the sclerotinite infection processs by abduction delivering; The constitutive expression of this gene can enhancement of plant to the resistance of saprophytic nutrition type fungi sclerotinite and grey mold, be applied to resistance breeding.

Another object of the present invention is the preparation method who has been to provide a kind of rape BnERF56 gene; Carry out the gene fragment order information that wild cabbage, swede type rape and turnip type rape gene order-checking result provide according to this laboratory; Est database through BLAST comparison rape; After obtaining the electronic cloning of rape full length sequence, use the sequence that simple PCR method promptly can obtain this gene.

A further object of the present invention be to provide a kind of rape BnERF56 gene in enhancement of plant to the application in the resistance of saprophytic nutrition type fungi sclerotinite.The overexpression of BnERF56 gene has significantly strengthened the resistance of plant to sclerotinite.

A further object of the present invention be to provide a kind of rape BnERF56 gene in enhancement of plant to the application in the resistance of saprophytic nutrition type botrytis cinerea.The overexpression of BnERF56 gene has significantly strengthened the resistance of plant to botrytis cinerea.

In order to accomplish above-mentioned purpose, the present invention adopts following technical scheme:

In order to obtain the present invention; The applicant has carried out deeply and comprehensively research the sclerotinia rot of colza resistance related gene, and the result has found a new gene, and this gene infects the back by remarkable abduction delivering sclerotinite; This gene overexpression has significantly improved pathogeny genes involved PDF1.2; ChiB, the expression of PR-1 and PR-2 has strengthened the resistance to saprophytic nutrition type fungi sclerotinite and grey mold.

According to an aspect of the present invention, above-mentioned purpose can realize through plant sclerotinite responsive genes is provided, said gene contain SEQ ID No.1 nucleotide sequence or with SEQ ID No.1 homologous nucleotide sequence in fact.

According to an aspect of the present invention, above-mentioned purpose can realize through plant sclerotinite response protein is provided, described albumen contain SEQ ID No.2 nucleotide sequence or with SEQ ID No.2 homologous aminoacid sequence in fact.

According to another aspect of the present invention, above-mentioned purpose contains BnERF56 gene overexpression recombinant vectors OX-BnERF56 (applicant's structure) and realizes the inhibition to BnERF56 gene expression amount in the plant materials through providing.

According to another aspect of the present invention; Above-mentioned purpose can be through providing with said recombinant vectors OX-BnERF56 microorganism transformed (agrobacterium tumefaciens EHA105; Available from the precious biotinylated biomolecule in Dalian Products Co., Ltd; Below identical) realize conversion to Arabidopis thaliana and other plant, thereby strengthen BnERF56 expression of gene amount in Arabidopis thaliana and the other plant.

According to another aspect of the present invention; Above-mentioned purpose can realize the regulation and control to the sclerotinite resistance through providing with said mikrobe (the agrobacterium tumefaciens EHA105 that includes the OX-BnERF56 recombinant vectors) transgenic plant transformed, obtains the resistant transgenic plant.

A kind of enhancement of plant to the BnERF56 gene of resistance to sclerotinia sclerotiorum in enhancement of plant to the sclerotinite resistance, to the application in the botrytis cinerea resistance, the steps include:

1, the clone of rape BnERF56 gene:

In liquid nitrogen, plant young leaflet tablet sample is ground to powdery, the extraction of RNA is carried out in the requirement that utilizes Trirol to extract test kit (available from Invitrogen company, below identical).The total RNA that extracts is dissolved in the distilled water of no RNase.DNase I (available from Promega company, below identical) remove maybe be residual DNA.(DU 650BECKMAN USA) detects RNA respectively at 260 nanometers and 280 nanometer absorbance values, identifies purity and the concentration of RNA in conjunction with 1% (mass volume ratio) agarose gel electrophoresis with the Protein Detection appearance.RNA to obtain is that template is carried out rt, and is subsequent use in-20 ℃ of preservations after the cDNA packing that obtains.

According to Arabidopis thaliana AtERF56 gene order (at5g61600) among the GenBank, on the NCBI website with BLASTN ( Http:// www.ncbi.nlm.nih.gov/BLAST) compare with wild cabbage, swede type rape and the turnip type rape gene fragment order of this laboratory order-checking acquisition; Obtain CDS (Coding sequence with Arabidopis thaliana AtERF56 gene order 5 ' end homologous swede type rape; Encoding sequence, below identical) sequence and with the CDS sequence of Arabidopis thaliana AtFRF56 gene order 3 ' end homologous swede type rape.Then according to CDS sequence and the Arabidopis thaliana AtERF56 gene start codon and the terminator codon homology zone design primer of the swede type rape BnERF56 gene that obtains, thereby guarantee that amplified production is a full length sequence.Root, stem, leaf, flower, angle cDNA really with swede type rape are masterplate, carry out pcr amplification.Reclaim and the purifying amplification PCR products; Be connected on the pMD18-T carrier (available from Promega company, below identical), with freeze-thaw method transformed into escherichia coli (J. Sa nurse Brooker .D.W. Russell work; Huang Peitang etc. translate molecular cloning test guide (third edition) Science Press; 96-99), coating the LB solid that contains penbritin 50 μ g/mL (fills a prescription as follows: take by weighing 10 gram Tryptoness respectively, 5 gram yeast extracts and 10 gram sodium-chlor; 8 gram agar are dissolved in the zero(ppm) water successively, and constant volume is in 1000 milliliters.Be sub-packed in 500 milliliters of triangular flasks, 121 ℃, autoclave sterilization is 15 minutes under 6.859 * 104Pa.4 ℃ of refrigerations are subsequent use) on the flat board, 37 ℃ of overnight cultures are respectively selected three of hickies, and be bacterium colony PCR and detect: the primer sequence is: M13F 5 '-AGCGGATAACAATTTCACACAGGA-3; M13R 5 '-GTAAAACGACGGCCAGT-3, below identical), reaction system is: 10 * Taq enzyme reaction buffer solution 2ul, 25mM MgCL ₂1.2ul, 2mM dNTP 1.5ul, 10uM primer 0.2ul, 0.3 Taq of unit enzyme, add sterilized water to 20 μ l.Response procedures is: 94 ℃ of sex change 5min, and 94 ℃ of 45s, 55 ℃ of 45s, 72 ℃ of 2min 32 circulations, 72 ℃ are extended 5min (below identical).With M13F/M13R is primer (front is stated), and the pMD18T carrier that connected is carried out sequencing, and analytical results has obtained a kind of isolating gene, and its sequence is the nucleotide sequence shown in the SEQ ID No.1.Utilize the ORFs of NCBI, finder (ORF founder) is confirmed the ORFs of BnERF56 gene, derives nucleotide sequence coded polypeptide, and a kind of isolated polypeptide, its sequence are the aminoacid sequence shown in the SEQ ID No.2.

According to the above-mentioned nucleotide sequence (SEQ ID No.1) that obtains; Through making up BnERF56 overexpression plant recombinant vectors (OX-BnERF56); Arabidopsis thaliana transformation; The applicant obtains 23 strain transgenic arabidopsis, inoculates saprophytic fungus sclerotinite and botrytis cinerea respectively and carries out disease-resistant evaluation, and the result shows that the BnERF56 overexpression has significantly strengthened the resistance of transgenic arabidopsis to sclerotinite and botrytis cinerea.

Proteinic molecular weight and theoretical iso-electric point are carried out at line computation (http://us.expasyorg/tools/pi tool.htm).Show that with the online conservative region analytical results that carries out of the Conserved Domains instrument (http://wwwncb.inlm.nih.gov/Structure/cdd/wrpsb.cgi) of NCBI this gene belongs to the ethylene responses factor (ERF) family; Through the Blastx program NR DB of NCBI is carried out the homology comparison, and the disease-resistant relevant ERF protein D NAMAN with homology, different plant species source is carried out the multisequencing comparison; With this proteinic substruction territory of Prosite software on-line analysis.Result such as Fig. 1,2,3.

2, rape BnERF56 expression of gene pattern:

The used rape of the present invention is swede type rape (Brassica napus L.) zhongshuang 9.Supply the examination material to be seeded in the land for growing field crops, normal field management.

Get root, stem, leaf, flower, angle fruit from the identical fertile plant of same grown in field condition, every kind of material is got three repetitions at least, and each repeats at least one strain, and the sampling back is positioned in the liquid nitrogen-80 ℃ of preservations rapidly with the masking foil parcel.The extraction of RNA is carried out in the requirement that utilizes Trirol to extract test kit (front is stated).

The PCR appearance is DNA-Engine (BIO-RAD), adopts rape Actin as internal standard gene (accession number AF111812), the Actin gene primer is 5 '-CTGGAATTGCTGACCGTATGAG-3 ' and 5 '-ATCTGTTGGAAAGTGCTGAGGG-3 '.The BnERF56 gene primer is 5 '-TGAAGATAGATGGCAACTAAGCAAGAAG-3 ' and 5 '-AATTCAGAAGTTTCAAGTAGCGGAGC-3 '.

Sxemiquantitative PCR reacts every group of experiment and all accomplishes three biology repetitions, and each biology repeats to do at least three technology and repeats.Detect the expression of BnERF56 in rape tissue (root, stem, leaf, flower, angle fruit) respectively.The result is as shown in Figure 4, and BnERF56 mainly expresses in the root kind, secondly is stem and leaf, does not express basically in flower and the angle fruit.

3, the BnERF56 expression of gene is infected by sclerotinite to induce.

Cabbage type rape variety M083 (high anti-) and 84039 (high senses) to the different resistances of sclerotium disease are provided by biotechnology breeding seminar of Inst. of Oil Crops, Chinese Academy of Agriculture, and the sclerotinite sclerotium is cultivated and adopted the PDA substratum.PDA substratum (1L) prescription: yam 200g, sucrose 10-20g, agar powder 17-20g, distilled water 1000g; To remove the peel yam and be cut into small pieces, and add water 800ml, and boil 0.5h, and with gauze elimination residue, add water and supply 1000ml, and add sugar and agar then, heating is melted agar fully, and packing while hot is subsequent use behind the autoclaving.

The rape variety M083 and the 84039 seeds using soil of the different resistances of sclerotium disease are potted plant, and strict its growth conditions of control, growth of rape to four leaf carry out the inoculation of mycelia piece live body during one heart stage handles.Respectively after inoculation 0,6,24, different time points such as 72h gets local leaf, every kind of material is got three repetitions at least, the sampling back is positioned in the liquid nitrogen-80 ℃ of preservations rapidly with the masking foil parcel.The extraction of RNA is carried out in the requirement that utilizes Trirol to extract test kit (front is stated).Carry out reverse transcription reaction after the DNaseI digestion, subsequent use after the cDNA packing that obtains in-80 ℃ of preservations.

Quantitative real time PCR Instrument is RTTM-Cycler (Bo Ao), adopts rape Actin as internal standard gene (accession number AF111812), the Actin gene primer is 5 '-CTGGAATTGCTGACCGTATGAG-3 ' and 5 '-ATCTGTTGGAAAGTGCTGAGGG-3 '.The BnERF56 gene primer is 5 '-GGAGGAAGAGACGGTGCCGGTTAGG-3 ' and 5 '-GCGGAGCTGGGAGACGTCGGAGTTA-3 '.Quantitative fluorescent PCR reacts every group of experiment and all accomplishes three biology repetitions, and each biology repeats to do at least three technology and repeats.Detect the BnERF56 gene respectively in different resistant varieties, infect the expression of back different time points.

Calculate the relative expression quantity of gene with comparing Ct method (Δ Δ Ct).Pass through 2- ^{Δ Δ Ct}Relative expression quantity and systematic error (Kenneth J Livak.Thomas D Schmittgen.2001, the Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2 of estimation goal gene ^{-Δ Δ c}T Method.METHODS 25,402-408.).When calculating relative expression quantity, be reference with nonvaccinated sample, be about to its value and convert 1 (standard value) to, other sample compares with it again, obtains relative expression's value.The result is as shown in Figure 5, and BnERF56 is one and is receiving sclerotinite to infect the inductive gene that the expression in resistant variety is higher than the expression in the perceptual kind, shows that BnERF56 is a resistance related gene.

4, the structure of BnERF56 gene overexpression vector (OX-BnERF56) and agrobacterium tumefaciens bacterial strain EHA105 transform (purchasing in Shanghai, Shanghai bio tech ltd still):

The recombinant vectors that makes up is plasmid PG4A (Zheng Wang, Han Mao, the Caihua Dong that the laboratory is made up; Ruiqin Ji, Li Cai, Hao Fu; And Shengyi Liu Overexpression of Brassica napus MPK4 Enhances Resistance to Sclerotinia sclerotiorum in Oilseed Rape MPMI; 22 (3), 2009, the goal gene on 235-244.) is with BnERF56 gene replacement that early stage, the clone obtained.For accomplishing this purpose, at first, cut PG4A plasmid (front is stated) with the PstI/XhoI enzyme simultaneously with PstI/XhoI double digestion clone's BnERF56 gene fragment.Endonuclease reaction carries out in 37 degree incubators, after about 4-6 hour, detects with 1% agarose gel electrophoresis.BnERF56 gene fragment after enzyme cut and PG4A plasmid (front is stated) are gone up the big fragment of downcutting and are reclaimed test kit (front is stated) with dna gel and reclaim.Than the mixed sample of PG4A plasmid (front is stated) carrier segments, add T4DNA ligase enzyme 5 units to the BnERF56 gene fragment by 3: 1 (molar concentration rate), 10 * reaction buffer, sterilized water replenishes volume to 20 μ L, and 16 ℃ of connections are spent the night.After the conversion, screen containing on kantlex (50 μ g/mL) the solid LB flat board, choose spot and be bacterium colony PCR, and the upgrading grain, enzyme is cut the correct recombinant plasmid called after OX-BnERF56 of checking, and the carrier that obtains is checked order with the checking accuracy.Carrier structure such as Fig. 6.

Utilize freeze-thaw method (front is stated) to change OX-BnERF56 over to agrobacterium tumefaciens EHA105 (available from the precious biotinylated biomolecule in Dalian Products Co., Ltd then; Below identical); Coating the LB solid that contains 50 μ g/mL kantlex and Rifampin (50 μ g/mL) (fills a prescription as follows: take by weighing 10 gram Tryptoness respectively; 5 gram yeast extracts and 10 gram sodium-chlor, 8 gram agar are dissolved in the zero(ppm) water successively, and constant volume is in 1000 milliliters.Be sub-packed in 500 milliliters of triangular flasks, 121 ℃, autoclave sterilization is 15 minutes under 6.859 * 104Pa.4 ℃ of refrigerations are subsequent use) on the flat board, 37 ℃ of overnight cultures are respectively selected three of hickies, and be bacterium colony PCR and detect (front is stated).

The recombinant plant expression vector of research used in the present invention BnERF56 gene function contains the coding region nucleotide sequence of said BnERF56 gene, and the composing type 35S promoter can strengthen BnERF56 expression of gene level.This carrier size is fit to, and in plant, is prone to and conversion, and the weedicide marker gene Bar expression intensity that is had is high, detects easily.Can obtain resistance to sclerotinia sclerotiorum enhanced Arabidopis thaliana transfer-gen plant through this carrier arabidopsis thaliana transformation.

5, the genetic transformation of BnERF56 gene overexpression vector (OX-BnERF56)

Method in the reference literature is carried out Arabidopis thaliana and is transformed (Zhang X.R.et al.Agrobacterium-mediated transformation of Arabidopsis thaliana using the floral dip method.Nature, 2006,1: 1-6).Preparation contains agrobacterium tumefaciens EHA105 (front is stated) the bacterium liquid that builds carrier, changes in the LB liquid nutrient medium that contains kantlex 50 μ g/ml, Rifampin 50 μ g/ml 28 ℃ of incubated overnight over to previous day in conversion.Second day, the light absorption value with ultraviolet spectrophotometer (SPEKOL 1300) detects down in the 276nm nano wave length took out when the light absorption value of bacterium liquid reaches between 1.6-2.0.Room temperature (20-25 ℃, below identical) with the centrifugal 10min of 4000g, is abandoned supernatant, and deposition is suspended in isopyknic 5% sucrose (mass volume ratio).The sucrose solution of muddiness is poured in the big petridish, added the Silwet L-77 that final concentration is 0.02% (volume ratio) (available from the Five continents, Beijing unit industry science and trade center, below identical) before transforming.The whole inflorescence of Arabidopis thaliana to be transformed being immersed in the sucrose gently, silent number 15s take out plant behind the mixing.Plant after the conversion is wrapped with a black plastic bag, is placed on growth and cultivates.Plastics bag was opened in second day, cultivate in the place that is placed on light intensity.At a distance from the conversion that tries again in a week.Cultivate and gathered in the crops seed in about one month, seed under incubator or daylight dry 3-5 days.The T0 that transforms results is broadcast in the vermiculite that is mixed with the PNS nutritive medium for seed; (PNS nutritive medium composition is: every liter contains 5ml 1M KNO3; 2ml 1M Ca (NO3) 24H2O, 2ml 1M MgSO47H2O, 2.5ml 20mM Fe.EDTA; 2.5ml 1M phosphoric acid buffer (pH5.5), 1ml MS trace element); 4 ℃ of one weeks of vernalization, between 21-22 ℃ growth in about the self-sow fortnight, the sprinkling of carrying out weedicide Glufosinate ammonium (30mg/L) in early days of waiting the four leaf phases that arrived is carried out sprinkling second time for the first time after the week.Green seedling to survival after twice sprinkling carries out the PCR positive detection, obtains Arabidopis thaliana transgenic positive seedling.

6, BnERF56 gene overexpression vector (OX-BnERF56) screening and the PCR that transform seedling identifies: the weedicide Glufosinate ammonium concentration gradient screening experiment that carries out according to this laboratory; Confirm weedicide (Glufosinate ammonium; Available from Bayer AG, below identical) screening concentration is 30mg/L.T1 sprays the 30mg/L weedicide for plant in seedling stage (after planting 10 days), obtains into plant alive.Adopt CTAB method (M.G.Murray and W.F.Thompson; Rapid isolation of high molecular weight plant DNA; _ Nucleic Acids Research, 1980, Vol.8; No.194321-4326, below identical) extract the Arabidopis thaliana and the wild-type Arabidopsis leaf DNA of the survival of screening back.According to external source BnERF56 gene order on the expression vector, the design primer carries out PCR and detects (sequence is F-5 ' TGAAGATAGATGGCAACTAAGCAAGAAG3 ' R-5 ' AATTCAGAAGTTTCAAGTAGCGGAGC '), and the expection amplification length is 680bp.To pass through positive plant numbering and mark that PCR detects.

7, the overexpression of BnERF56 gene has strengthened the pathogeny correlative protein expression

Verify jamming effectiveness and observe transgenic arabidopsis T1 representative type through quantitative fluorescent PCR.The observations demonstration, under the normal growth situation, each BnERF56 gene overexpression transfer-gen plant and wild-type plant and no significant difference; PCR identifies that the back obtains the seedling of transgenic T2 for each strain system of overexpression (OX-BnERF56).Win the blade of these seedling, quick-frozen is analyzed the expression level of target gene BnERF56 with Q-PCR in liquid nitrogen.Concrete grammar is following: the PCR that learnt from else's experience detects the blade of the T2 of back acquisition for positive plant, in liquid nitrogen, plant young leaflet tablet sample is ground to powdery, and the extraction of RNA is carried out in the requirement that utilizes Trirol to extract test kit.The total RNA that extracts is dissolved in the distilled water of no RNase.DNase I removes the residual DNA of possibility.(DU 650 BECKMAN USA) detect RNA respectively at 260 nanometers and 280 nanometer absorbance values, identify purity and the concentration of RNA in conjunction with 1% (mass volume ratio) agarose gel electrophoresis with the Protein Detection appearance.RNA to obtain is that template is carried out rt (front is stated), and is subsequent use in-20 ℃ of preservations after the cDNA packing that obtains.

Quantitative real time PCR Instrument is RT ^TM-Cycler (Bo Ao) adopts Arabidopis thaliana Actin as internal standard gene.The BnERF56 primer is 5 '-GGAGGAAGAGACGGTGCCGGTTAGG-3 ' and 5 '-GCGGAGCTGGGAGACGTCGGAGTTA-3 '; Arabidopis thaliana PDF1.2 primer is 5 '-TGTTCTCTTTGCTGCTTTCGACG-3 ' and 5 '-GCATGATCCATGTTTGGCTCCT-3 '; Arabidopis thaliana ChiB primer is 5 '-ATCAGCGCTGCAAAGTCCTTC-3 ' and 5 '-GTGCTGTAGCCCATCCACCTG-3 '; Arabidopis thaliana PR-1 primer is 5 '-TTCTCCCTCGAAAGCTCAA-3 ' and 5 '-AAGGCCCACCAGAGTGTATG-3 '; Arabidopis thaliana PR-2 primer is 5 '-AAGGAGCTTAGCCTCACCAC-3 ' and 5 '-CCCGTAGCATACTCCGATTT-3 ';

The quantitative fluorescent PCR reaction system is 20 μ L: contain SYBR Mix 10 μ L, and each 0.8 μ L of forward and reverse primer (10 μ mol/L), template 2 μ L, the sterilized water that DEPC handled complements to 20 μ L.Amplification condition is: 94 ℃, and 5min; 94 ℃ of 15s, 60 ℃ of 20s, 72 ℃ of 30s, 40 circulations; Each is circulated in 72 ℃ of renaturation ends and carries out fluoroscopic examination.Reaction is heated to 95 ℃ earlier after finishing, and reduces to 72 ℃ then, slowly is warming up to 95 ℃ again, writes down the variation of fluorescent signal, draws the melting curve of amplified production.Every group of experiment all accomplished three biology and repeated, and each biology repeats to do at least three technology and repeats.

Calculate the relative expression quantity of gene with comparing Ct method (Δ Δ Ct).Utilize software that instrument is with; At first optimize internal standard gene and goal gene amplification condition; Measure the Ct value of Actin and goal gene respectively; Choose that the most approaching three results (Ct valve system error is less than 0.3) average in nine measured value of experiment, through internal standard gene goal gene is proofreaied and correct then and obtained Δ Δ Ct, at last through 2 ^{-Δ Δ Ct}The relative expression quantity and the systematic error (front is stated) of estimation goal gene.When calculating relative expression quantity, be reference with the sample of wild-type Arabidopsis leaf, be about to its value and convert 1 to, other sample again with its relatively, obtain relative expression's value.The result shows that BnERF56 overexpression efficient is very obvious, as shown in Figure 7: and in the BnERF56 gene overexpression transfer-gen plant, the expression of BnERF56 is significantly raised 17-30 doubly; Accordingly; Pathogeny GAP-associated protein GAP PDF1.2, ChiB, the expression of PR-1 and PR-2 is also significantly raised; The overexpression that shows the BnERF56 gene has strengthened the pathogeny correlative protein expression

8, BnERF56 gene overexpression significantly strengthens the resistance of plant to saprophytic form fungi sclerotinite and botrytis cinerea

Sclerotinite (Scleortinia sclerotiorum) sclerotium picks up from land for growing field crops, Wuhan rape cane; Select intact sclerotium, steeped 1 minute with 75% alcohol (volume ratio) earlier, again with 0.1%HgCl2 sterilization 8-10 minute, aseptic water washing 3-5 time.Cut two ends to the sterilization sclerotium, middle portion is cut into the mung bean size, and tangent plane is inoculated in the Minimal flat board down.Common every sclerotium connects a plate, once inoculates the 8-9 plate.Leave standstill in 22 ℃ and to cultivate 3-4 days, when sclerotium is about to be paved with flat board, along the punching of mycelia outer rim, get the mycelia piece, be used for inoculating with φ 2mm punch tool.Minimal substratum (1L) prescription: NaOH 1g, DL-oxysuccinic acid 3g, NH ₄NO ₃2g, MgSO ₄7H ₂O 0.1g, bacterial agar 39g; In order top medicine is dissolved in the zero(ppm) water that fills 800ml, when adding medicine, adds a kind of medicine down after the medicine of adding fully dissolves again, medicine adds Hou Jiashui and supplies 1000mL, adds bacterial agar then, in 117 ℃ of sterilization 15min.

Botrytis cinerea (B.cinerea) is provided by professor Li Guoqing of Hua Zhong Agriculture University, derives from land for growing field crops, Wuhan rape leaf.Strain culturing is (front is stated) on the PDA substratum, cultivates 8d for 28 ℃.With sterilized water wash-out gray mold protospore from the substratum, be mixed with and contain 5 * 10 ⁵And 1 * 10 ⁶Spores mL ^-1Spore suspension for use.

Arabidopis thaliana OX-BnERF56 overexpression strain and wild-type WT are seeded in 23 ℃ of indoor cultivations of preserving moisture of illumination cultivation (16h illumination every day, 8h is dark); The Arabidopis thaliana seedling of choosing for 4 ages in week is used for (comprising strain of OX-BnERF56 overexpression and wild-type WT) inoculation experiments of sclerotinite and grey mold, and every kind of genotype is inoculated 12 strains at least, two leaves of every strain inoculation, test triplicate.For the sclerotinite inoculation, mycelial growth is on the mini substratum, and the agar block that contains the sclerotinite mycelia of the about 2mm of diameter is inoculated into the paraxial surface of leaf; For the grey mold inoculation, mycelial growth is on the PDA substratum, and the spore of collecting on the PDA substratum is diluted with water to 5 * 10 ⁵And 1 * 10 ⁶Spores mL ^-1, earlier leaf is stabbed with fine needle during inoculation, each inoculation point drips the suspension-s of the grey mold spore of 3ul then.Sclerotinite and botrytis cinerea inoculation plant all need keep high humidity, are consistent before temperature and illumination and the inoculation.Morbidity back different time statistics lesion area, result such as Fig. 8 and Fig. 9 compare with wild-type, and the strain of OX-BnERF56 overexpression has significantly strengthened the resistance to sclerotinite and grey mold, shows that BnERF56 is the resistance related gene of saprophytic form fungi sclerotinite and grey mold.

Advantage of the present invention:

1 through this gene of clone, studies the effect of this gene in plant disease-resistant, and clear and definite this gene has and strengthens the function of plant to the resistance of saprophytic form fungi.Express through crossing of this gene, the applicant can artificially create the resistance strongthener, for realizing the resistance molecular breeding new resistant gene is provided.

2 through clone this gene, study the response that this gene pairs sclerotinite is infected, and in resistant variety and perceptual kind, receive sclerotinite infect the abduction delivering level.Promptly study its expression in the plant disease-resistant response, thereby in the anti-saprophytic disease of plant, use.

3 through making up the overexpression vector (OX-BnERF56) of this gene, and arabidopsis thaliana transformation obtains effective overexpression (OX-BnERF56) transfer-gen plant, for the research gene function provides an effective means.

4, identify through the disease-resistant inoculation of sclerotinite that transgenic arabidopsis is carried out and grey mold, obtained the result of the remarkable enhancement of plant of overexpression of this gene saprophytic fungus sclerotinite and grey mold resistance.Explain that this gene is the resistance related gene of plant.

Description of drawings

Fig. 1 is the comparison figure of the amino acid conserved regions of a kind of BnERF56 and other ERF gene, shows that the BNERF56 gene is highly similar on the ERF conserved domain with other ERF gene.

Fig. 2 is the comparison figure of the protein complete sequence of a kind of BnERF56 and other ERF gene, show BNERF56 gene and other ERF gene on protein sequence by difference.

The protein sequence systematic evolution tree analysis of Fig. 3 BnERF56 and other ERF gene, show BNERF56 gene and other ERF gene on protein sequence by difference.

Fig. 4 is a kind of tissue specific expression electrophorogram of swede type rape BnERF56 gene.The swimming lane root, stem, leaf, flower, the angle fruit is represented respectively through root, stem, leaf, flower, the pcr amplification result of the cDNA that really organize at the angle;

Fig. 5 is the expression of a kind of BnERF56 response diagram to infecting with sclerotinite.The Y axle is represented the relative expression quantity of BnERF56 gene, the back different time points that X axle sclerotinite is infected.

Fig. 6 is the structure synoptic diagram of a kind of BnERF56 gene overexpression vector OX-BnERF56

Fig. 7 is in a kind of BnERF56 overexpression transformant, relative expression's level view of BnERF56 gene and pathogeny related protein gene.The Y axle is represented the relative expression quantity of BnERF56 gene, and the X axle is represented not homophyletic system.A figure is relative expression's level view of BnERF56 gene, and B figure is relative expression's level view of PDF1.2 gene, and C figure is relative expression's level view of ChiB gene, and D figure is relative expression's level view of PR-1 gene, and E figure is relative expression's level view of PR-2 gene.

Fig. 8 is the disease-resistant evaluation figure of a kind of BnERF56 gene overexpression and the sclerotinite that disturbs transformant.The Y axle is represented lesion area, different time after X is coupling kind.

Fig. 9 is the disease-resistant evaluation of a kind of BnERF56 gene overexpression and the botrytis cinerea that disturbs transformant.The Y axle is represented lesion area, different time after X is coupling kind.

Embodiment

According to following examples, can better understand the present invention, but described embodiment is in order better to explain the present invention rather than limitation of the present invention.

Embodiment 1.:

The clone of a kind of rape resistance related gene BnERF56 and expression pattern analysis:

1, the clone of a kind of rape resistance related gene BnERF56

Extract the requirement of test kit (front is stated) according to Trirol and carry out the extraction of RNA; Concrete grammar is following: root, stem, leaf, flower, the angle fruit sample of getting 0.05-0.1g respectively; In liquid nitrogen, be ground to powdery, extract the requirement of test kit according to Trirol and carry out the extraction of RNA.The total RNA that extracts is dissolved in the distilled water of no RNase of 60uL.DNase I removes the residual DNA of possibility.(DU 650 BECKMAN USA) detect the absorbance value of RNA under 260 nanometers and 280 nanometers respectively, identify purity and the concentration of RNA in conjunction with 1% (mass volume ratio) agarose gel electrophoresis with the Protein Detection appearance.RNA with above-mentioned acquisition is that template is carried out rt by following scheme: add 1 μ L Oligo (dT) among the 2 μ g RNA, 70 ℃ of incubation 5min place 5min on ice immediately; Of short duration centrifugal, add 5 * M-MLV Buffer, 4 μ L, dNTP (10mmol/L) 1 μ L; RNase Inhibitor 20 units, M-MLV reversed transcriptive enzyme (available from Promega company) 200 units are mended to TV 20 μ L with the sterilized water that DEPC handled; Mixing; 42 ℃ of incubation 1h, 70 ℃ of water-bath 15min, subsequent use after the cDNA packing that obtains in-20 ℃ of preservations.

According to Arabidopis thaliana AtERF56 gene order (at5g61600) among the GenBank, on the NCBI website with BLASTN ( Http:// www.ncbi.nlm.nih.gov/BLAST) compare with wild cabbage, swede type rape and the turnip type rape gene fragment order of this laboratory order-checking acquisition; Obtain CDS (Coding sequence with Arabidopis thaliana AtBNERF56 gene order 5 ' end homologous swede type rape; Encoding sequence, below identical) sequence and with the CDS sequence of Arabidopis thaliana AtERF56 gene order 3 ' end homologous swede type rape.Then according to CDS sequence and the Arabidopis thaliana BNERF56 gene start codon and the terminator codon homology zone design primer of the swede type rape BNERF56 gene that obtains, thereby guarantee that amplified production is a full length sequence.Rape BnERF56 amplimer sequence is respectively: 5 '-TGAAGATAGATGGCAACTAAGCAAGAAG-3 ' (5 ' end primer); 5 '-AATTCAGAAGTTTCAAGTAGCGGAGC-3 ' (3 ' end primer).The PCR program is: 94 ℃, and 5min; 94 ℃, 45s, 55 ℃, 45s, 72 ℃, 1min, 33 circulations; 72 ℃, 10min.The result is as shown in Figure 1.The PCR reaction product is electrophoresis on (mass volume ratio) low melting-point agarose of 1%, downcuts the amplified production band from glue and puts into 1.5ml Eppendoff centrifuge tube, and 65 ℃ of water-bath 15min add equal-volume phenol (PH7.9); Put upside down and shake up 5min, 13000 rev/mins centrifugal 8 minutes, get supernatant; Add the equal-volume chloroform: primary isoamyl alcohol (volume ratio 24: 1) is put upside down and is shaken up 5min, 13000 rev/mins centrifugal 8 minutes, get supernatant; 3 mol sodium-acetate (PH5.2) solution that add 1/10 volume, 95% (mass volume ratio, below identical) ethanol of 2 times of volume precoolings; In rearmounted-20 ℃ of refrigerators of mixing more than the 20min, 13000 rev/mins centrifugal 15 minutes, use 75% (mass volume ratio again after outwelling 95% (front is stated) ethanol; Below identical) ethanol embathes deposition, natural air drying, the DNA deposition is dissolved in 20 μ l aseptic deionized waters.Press pMD18-T (available from TaKaRa company) carrier specification sheets, be connected on the pMD18-T carrier, (J. Sa nurse Brooker .D.W. Russell work, Huang Peitang etc. translate molecular cloning test guide (third edition) Science Press to transformed into escherichia coli, 96-99).Method is following: PCR selects positive colony through bacterium colony, and primer sequence is: M13F 5 '-AGCGGATAACAATTTCACACAGGA-3; M13R 5 '-GTAAAACGACGGCCAGT-3), reaction system is: 10 * Taq enzyme reaction buffer solution 2ul, 25mM MgCL ₂1.2ul, 2mM dNTP 1.5ul, 10uM primer 0.2ul, 0.3 Taq of unit enzyme, add sterilized water to 20 μ l.Response procedures is: 94 ℃ of sex change 5min, and 94 ℃ of 45s, 55 ℃ of 45s, 72 ℃ of 2min 32 circulations, 72 ℃ are extended 5min.Each PCR product is selected 3 clones respectively and is shaken bacterium and extract plasmid, and order-checking obtains BnERF56 full length gene sequence, a kind of isolating gene, and its sequence is a nucleotide sequence shown in the SEQ ID No.1.Utilize the ORFs of NCBI, finder (ORF founder) is confirmed the ORFs of BnERF56 gene, derives nucleotide sequence coded polypeptide, and a kind of isolated polypeptide, its sequence are the aminoacid sequence shown in the SEQ ID No.2.

According to the above-mentioned nucleotide sequence (SEQ ID No.1) that obtains; Through making up BnERF56 overexpression plant recombinant vectors (OX-BnERF56); Arabidopsis thaliana transformation; The applicant obtains 23 strain transgenic arabidopsis, inoculates saprophytic fungus sclerotinite and botrytis cinerea respectively and carries out disease-resistant evaluation, and the result shows the remarkable resistance of transgenic arabidopsis to sclerotinite and botrytis cinerea that strengthened.

Proteinic molecular weight and theoretical iso-electric point are carried out at line computation (http://us.expasyorg/tools/pi tool.htm).Show that with the online conservative region analytical results that carries out of the Conserved Domains instrument (http://wwwncb.inlm.nih.gov/Structure/cdd/wrpsb.cgi) of NCBI this gene contains a conservative ERF structural domain, belongs to ethylene responses transcription factor (ERF) family; Through the Blastx program NR DB of NCBI is carried out the homology comparison, and the ERF albumen with homology, different plant species source is carried out the multisequencing comparison with ClustalX1.83; With this proteinic substruction territory of Prosite software on-line analysis.Show according to the aforesaid method analytical results: 218 amino acid of protein sequence coding that the opening code-reading frame of this gene is derived.Be approximately 24155Da at the proteinic molecular weight of line computation, theoretical iso-electric point is about 10.08.BLASTp on-line analysis software carries out homology relatively with proteins encoded of deriving and the sequence among the Genebank; The homology of protein amino acid sequence on the ERF conserved domain of finding this sequence and AtBNERF56, ERF1, ORA59, AtERF4, AtERF5, AtERF14, Pti4 and Tsi1 reaches 91.4%, 68.9%, 70.7%, 74.1%, 84.5%, 75.9%, 74.1% and 63.8% respectively, sees Fig. 1; But similarity is lower on the albumen complete sequence, is respectively 68.2%, 25.7%, 24.8%, 23.4%, 21.5%, 28.4%, 23.2% and 26.2%, sees Fig. 2; Show that BnERF56 is the ERF transcription factor of a new unknown function.The BnERF56 albumen of having cloned is carried out the homology that genealogical tree analysis revealed BnERF56 and Arabidopis thaliana AtPABP5 have height, and BnERF56 has similar function with AtPABP5, sees Fig. 3.

Embodiment 2.:

The expression pattern of a kind of rape resistance related gene BnERF56 and infection process response modes are analyzed:

1, the expression pattern analysis of a kind of rape resistance related gene BNERF56:

The used rape of the present invention (Brassica napus L.) is in the wild cabbage property rape two No. 9.Supply the examination material to be seeded in the land for growing field crops, normal field management.

Get root, stem, leaf, flower, angle fruit from the identical fertile plant of same grown in field condition, every kind of material is got three repetitions at least, and each repeats at least one strain, and the sampling back is positioned in the liquid nitrogen-80 ℃ of preservations rapidly with the masking foil parcel.Extract RNA (the method front is stated).

The PCR appearance is DNA-Engine (BIO-RAD), adopts rape Actin as internal standard gene (accession number AF111812), the Actin gene primer is 5 '-CTGGAATTGCTGACCGTATGAG-3 ' and 5 '-ATCTGTTGGAAAGTGCTGAGGG-3 '.The BnERF56 gene primer is 5 '-TGAAGATAGATGGCAACTAAGCAAGAAG-3 ' and 5 '-AATTCAGAAGTTTCAAGTAGCGGAGC-3 '.

The PCR reaction system is 10 μ L, each 0.4 μ L of forward and reverse primer (10 μ mol/L), and template 1 μ L adds sterilized water and complements to 10 μ L.Amplification condition is: 94 ℃, and 5min:94 ℃, 30s, 55 ℃, 30s, 72 ℃, 50s, 25 circulations.Detect the expression of BNERF56 in rape tissue (root, stem, leaf, flower, angle fruit) respectively.

Sxemiquantitative PCR reacts every group of experiment and all accomplishes three biology repetitions, and each biology repeats to do at least three technology and repeats.Detect the expression of BnERF56 in rape tissue (root, stem, leaf, flower, angle fruit) respectively.The result is as shown in Figure 4, and BnERF56 mainly expresses in the root kind, secondly is stem and leaf, does not express basically in flower and the angle fruit.

2, the BnERF56 expression of gene is infected by sclerotinite to induce.

Cabbage type rape variety M083 (high anti-) and 84039 (high senses) to the different resistances of sclerotium disease are provided by biotechnology breeding seminar of Inst. of Oil Crops, Chinese Academy of Agriculture, and the sclerotinite sclerotium is cultivated and adopted PDA substratum (front is stated).

The rape variety M083 and the 84039 seeds using soil of the different resistances of sclerotium disease are potted plant, and strict its growth conditions of control, growth of rape to four leaf carry out the inoculation of mycelia piece live body during one heart stage handles.Respectively after inoculation 0,6,24, different time points such as 72h gets local leaf, every kind of material is got three repetitions at least, the sampling back is positioned in the liquid nitrogen-80 ℃ of preservations rapidly with the masking foil parcel.The extraction of RNA is carried out in the requirement that utilizes Trirol to extract test kit (front is stated).Carry out reverse transcription reaction after the DNase I digestion, subsequent use after the cDNA packing that obtains in-80 ℃ of preservations.

Quantitative real time PCR Instrument is RT ^TM-Cycler (Bo Ao) adopts rape Actin as internal standard gene (accession number AF111812), and the Actin gene primer is 5 '-CTGGAATTGCTGACCGTATGAG-3 ' and 5 '-ATCTGTTGGAAAGTGCTGAGGG-3 '.The BnERF56 gene primer is 5 '-GGAGGAAGAGACGGTGCCGGTTAGG-3 ' and 5 '-GCGGAGCTGGGAGACGTCGGAGTTA-3 '.The quantitative fluorescent PCR reaction system is 20 μ L: contain SYBR Mix 10 μ L, and each 0.8 μ L of forward and reverse primer (10 μ mol/L), template 2 μ L, the sterilized water that DEPC handled complements to 20 μ L.Amplification condition is: 94 ℃, and 5min; 94 ℃ of 15s, 60 ℃ of 20s, 72 ℃ of 30s, 40 circulations; Each is circulated in 72 ℃ of renaturation ends and carries out fluoroscopic examination.Reaction is heated to 95 ℃ earlier after finishing, and reduces to 72 ℃ then, slowly is warming up to 95 ℃ again, writes down the variation of fluorescent signal, draws the melting curve of amplified production.Every group of experiment all accomplished three biology and repeated, and each biology repeats to do at least three technology and repeats.Detect the BnERF56 gene respectively in different resistant varieties, infect the expression of back different time points.

Calculate the relative expression quantity of gene with comparing Ct method (Δ Δ Ct).Utilize software that instrument is with; At first optimize internal standard gene and goal gene amplification condition; Measure the Ct value of Actin and goal gene respectively; Choose that the most approaching three results (Ct valve system error is less than 0.3) average in nine measured value of experiment, through internal standard gene goal gene is proofreaied and correct then and obtained Δ Δ Ct, at last through 2 ^{-Δ Δ Ct}The relative expression quantity and the systematic error (front is stated) of estimation goal gene.When calculating relative expression quantity, be reference with the Arabidopsis leaf sample of water treatment, be about to its value and convert 1 to, other handle sample again with its relatively, obtain relative expression's value.The result is as shown in Figure 5, and BnERF56 is one and is receiving sclerotinite to infect the inductive gene that the expression in resistant variety is higher than the expression in the perceptual kind, shows that BnERF56 is a resistance related gene.

Embodiment 3:

The BnERF56 gene that a kind of resistance is correlated with, the steps include: to the sclerotinite resistance, to the application in the botrytis cinerea resistance in enhancement of plant

1, the structure of BnERF56 gene overexpression vector (OX-BnERF56) and agrobacterium tumefaciens bacterial strain EHA105 transform (purchasing in Shanghai, Shanghai bio tech ltd still):

The recombinant vectors that makes up is plasmid PG4A (Zheng Wang, Han Mao, the Caihua Dong that the laboratory is made up; Ruiqin Ji, Li Cai, Hao Fu; And Shengyi Liu Overexpression of Brassica napus MPK4 Enhances Resistance to Sclerotinia sclerotiorum in Oilseed Rape MPMI; 22 (3), 2009, the goal gene on 235-244.) is with BnERF56 gene replacement that early stage, the clone obtained.For accomplishing this purpose, at first, cut PG4A plasmid (front is stated) with the PstI/XhoI enzyme simultaneously with PstI/XhoI double digestion clone's BnERF56 gene fragment.Endonuclease reaction carries out in 37 degree incubators, after about 4-6 hour, detects with 1% agarose gel electrophoresis.BnERF56 gene fragment after enzyme cut and PG4A plasmid (front is stated) are gone up the big fragment of downcutting and are reclaimed test kit (front is stated) with dna gel and reclaim.Than the mixed sample of PG4A plasmid (front is stated) carrier segments, add T4 dna ligase 5 units to the BnERF56 gene fragment by 3: 1 (molar concentration rate), 10 * reaction buffer, sterilized water replenishes volume to 20 μ L, and 16 ℃ of connections are spent the night.After the conversion, screen containing on kantlex (50 μ g/mL) the solid LB flat board, choose spot and be bacterium colony PCR, and the upgrading grain, enzyme is cut the correct recombinant plasmid called after OX-BnERF56 of checking, and the carrier that obtains is checked order with the checking accuracy.Carrier structure such as Fig. 6.

Utilize freeze-thaw method (front is stated) to change OX-BnERF56 over to agrobacterium tumefaciens EHA105 (available from the precious biotinylated biomolecule in Dalian Products Co., Ltd then; Below identical); Coating the LB solid that contains 50 μ g/mL kantlex and Rifampin (50 μ g/mL) (fills a prescription as follows: take by weighing 10 gram Tryptoness respectively; 5 gram yeast extracts and 10 gram sodium-chlor, 8 gram agar are dissolved in the zero(ppm) water successively, and constant volume is in 1000 milliliters.Be sub-packed in 500 milliliters of triangular flasks, 121 ℃, autoclave sterilization is 15 minutes under 6.859 * 104Pa.4 ℃ of refrigerations are subsequent use) on the flat board, 37 ℃ of overnight cultures are respectively selected three of hickies, and be bacterium colony PCR and detect (front is stated).

The recombinant plant expression vector of research used in the present invention BnERF56 gene function contains the coding region nucleotide sequence of said BnERF56 gene, and the composing type 35S promoter can strengthen BnERF56 expression of gene level.This carrier size is fit to, and in plant, is prone to and conversion, and the weedicide marker gene Bar expression intensity that is had is high, detects easily.Can obtain resistance to sclerotinia sclerotiorum enhanced Arabidopis thaliana transfer-gen plant through this carrier arabidopsis thaliana transformation.

2, the genetic transformation of BnERF56 gene overexpression vector (OX-BnERF56)

Method in the reference literature is carried out Arabidopis thaliana and is transformed (Zhang X.R.et al.Agrobacterium-mediated transformation of Arabidopsis thaliana using the floral dip method.Nature, 2006,1: 1-6).Preparation contains agrobacterium tumefaciens EHA105 (front is stated) the bacterium liquid that builds carrier, changes in the LB liquid nutrient medium that contains kantlex 50 μ g/ml, Rifampin 50 μ g/ml 28 ℃ of incubated overnight over to previous day in conversion.Second day, the light absorption value with ultraviolet spectrophotometer (SPEKOL 1300) detects down in the 276nm nano wave length took out when the light absorption value of bacterium liquid reaches between 1.6-2.0.Room temperature (20-25 ℃, below identical) with the centrifugal 10min of 4000g, is abandoned supernatant, and deposition is suspended in isopyknic 5% sucrose (mass volume ratio).The sucrose solution of muddiness is poured in the big petridish, added the Silwet L-77 that final concentration is 0.02% (volume ratio) (available from the Five continents, Beijing unit industry science and trade center, below identical) before transforming.The whole inflorescence of Arabidopis thaliana to be transformed being immersed in the sucrose gently, silent number 15s take out plant behind the mixing.Plant after the conversion is wrapped with a black plastic bag, is placed on growth and cultivates.Plastics bag was opened in second day, cultivate in the place that is placed on light intensity.At a distance from the conversion that tries again in a week.Cultivate and gathered in the crops seed in about one month, seed under incubator or daylight dry 3-5 days.Idiographic flow is following:

1. the liquid concentrator of Rifampin preparation becoming 50Mg/ml, be put in 4 degree and preserve, will blow and beat evenly before using, dilute 100 times of uses.

2. in the LB of 5ml liquid nutrient medium, add 5 microlitre Rifampin liquid concentrators, shake up, choose into single bacterium colony, activation is spent the night.

3. see that sucking-off was no less than 2ml activatory bacterium liquid when activatory bacterium liquid was very muddy, be added in the LB liquid nutrient medium of 200ml that 28 degree 200 change overnight cultures to OD value 1.6-2.0.

4. centrifugal 10 minutes of 4000g room temperature (desk centrifuge SIGMA2-16K), 4500 change, and abandon supernatant, on filter paper, buckles dried.

5. prepare 200 milliliters of 5% (mass volume ratio) sucrose solutions, with the resolution of precipitate that last collection obtains, even with rifle piping and druming.

6. will dissolve good bacterium liquid and be added in the plate, 50 ml solns/plate add SiLwet-L-77 (front the is stated) mixing of 40 microlitres then.

7. the inflorescence with the plant of Arabidopis thaliana immerses in the plate, with hand branched flower is held together together, immerses gently wherein 15 seconds.

8. with opaque sack the Arabidopis thaliana plant that each plasmid transforms is overlapped, lucifuge is preserved moisture and was got final product in one day.

9. repeat again after the week to transform once.

The T0 that transforms results is broadcast in the vermiculite that is mixed with the PNS nutritive medium for seed; (PNS nutritive medium composition is: every liter contains 5ml 1M KNO3; 2ml 1M Ca (NO3) 24H2O, 2ml 1M MgSO47H2O, 2.5ml20mM Fe.EDTA; 2.5ml 1M phosphoric acid buffer (pH5.5), 1ml MS trace element); 4 ℃ of one weeks of vernalization, between 21-22 ℃ growth in about the self-sow fortnight, the sprinkling of carrying out weedicide Glufosinate ammonium (30mg/L) in early days of waiting the four leaf phases that arrived is carried out sprinkling second time for the first time after the week.Green seedling to survival after twice sprinkling carries out the PCR positive detection, obtains Arabidopis thaliana transgenic positive seedling.

The screening and the PCR that transform seedling identify: according to the weedicide Glufosinate ammonium concentration gradient screening experiment that carry out in this laboratory, confirm weedicide (Glufosinate ammonium, available from Bayer AG, below identical) screening concentration is 30mg/L.T1 sprays the 30mg/L weedicide for plant in seedling stage (after planting 10 days), obtains into plant alive.PCR detects the screening seedling: treated for four leaf seedling periods; Get a slice true leaf (seedtime is approximately the four stars phase) and extract genomic dna with CTAB method (front is stated); According to external source BnERF56 gene order on the expression vector, the design primer carries out PCR and detects (sequence is F-5 ' TGAAGATAGATGGCAACTAAGCAAGAAG3 ' R-5 ' AATTCAGAAGTTTCAAGTAGCGGAGC '); The PCR reaction system is following: genomic dna template 1 μ L (about 50ng), 10 * Taq enzyme reaction buffer solution 2ul, 25mM MgCL ₂1.2ul, 2mM dNTP 1.5ul, each 0.2ul of 10uM primer, 0.3 Taq of unit enzyme, add sterilized water to 20 μ l.Response procedures is: 94 ℃ of sex change 5min, and 94 ℃ of 45s, 55 ℃ of 45s, 72 ℃ of 2min 32 circulations, 72 ℃ are extended 5min.Detect the PCR reaction product with 1% (mass volume ratio) agarose gel electrophoresis, the result shows that this overexpression (OX-BnERF56) carrier has successfully changed Arabidopis thaliana over to.

Embodiment 4:

The relevant BnERF56 gene of a kind of resistance in enhancement of plant to the sclerotinite resistance, to the application in the botrytis cinerea resistance.The steps include:

1, the overexpression of BnERF56 gene has strengthened the pathogeny correlative protein expression

Verify jamming effectiveness and observe transgenic arabidopsis T1 representative type through quantitative fluorescent PCR.The observations demonstration, under the normal growth situation, each BnERF56 gene overexpression transfer-gen plant and wild-type plant and no significant difference; PCR identifies that the back obtains the seedling of transgenic T2 for each strain system of overexpression (OX-BnERF56).Win the blade of these seedling, quick-frozen is analyzed the expression level of target gene BnERF56 with Q-PCR in liquid nitrogen.Concrete grammar is following: the PCR that learnt from else's experience detects the blade of the T2 of back acquisition for positive plant, in liquid nitrogen, plant young leaflet tablet sample is ground to powdery, and the extraction of RNA is carried out in the requirement that utilizes Trirol to extract test kit.The total RNA that extracts is dissolved in the distilled water of no RNase.DNase I removes the residual DNA of possibility.(DU 650 BECKMAN USA) detect RNA respectively at 260 nanometers and 280 nanometer absorbance values, identify purity and the concentration of RNA in conjunction with 1% (mass volume ratio) agarose gel electrophoresis with the Protein Detection appearance.RNA to obtain is that template is carried out rt (front is stated), and is subsequent use in-20 ℃ of preservations after the cDNA packing that obtains.

Quantitative real time PCR Instrument is RT ^TM-Cycler (Bo Ao) adopts Arabidopis thaliana Actin as internal standard gene.The BnERF56 primer is 5 '-GGAGGAAGAGACGGTGCCGGTTAGG-3 ' and 5 '-GCGGAGCTGGGAGACGTCGGAGTTA-3 '; Arabidopis thaliana PDF1.2 primer is 5 '-TGTTCTCTTTGCTGCTTTCGACG-3 ' and 5 '-GCATGATCCATGTTTGGCTCCT-3 '; Arabidopis thaliana ChiB primer is 5 '-ATCAGCGCTGCAAAGTCCTTC-3 ' and 5 '-GTGCTGTAGCCCATCCACCTG-3 '; Arabidopis thaliana PR-1 primer is 5 '-TTCTCCCTCGAAAGCTCAA-3 ' and 5 '-AAGGCCCACCAGAGTGTATG-3 '; Arabidopis thaliana PR-2 primer is 5 '-AAGGAGCTTAGCCTCACCAC-3 ' and 5 '-CCCGTAGCATACTCCGATTT-3 ';

The quantitative fluorescent PCR reaction system is 20 μ L: contain SYBR Mix 10 μ L, and each 0.8 μ L of forward and reverse primer (10 μ mol/L), template 2 μ L, the sterilized water that DEPC handled complements to 20 μ L.Amplification condition is: 94 ℃, and 5min; 94 ℃ of 15s, 60 ℃ of 20s, 72 ℃ of 30s, 40 circulations; Each is circulated in 72 ℃ of renaturation ends and carries out fluoroscopic examination.Reaction is heated to 95 ℃ earlier after finishing, and reduces to 72 ℃ then, slowly is warming up to 95 ℃ again, writes down the variation of fluorescent signal, draws the melting curve of amplified production.Every group of experiment all accomplished three biology and repeated, and each biology repeats to do at least three technology and repeats.

Calculate the relative expression quantity of gene with comparing Ct method (Δ Δ Ct).Utilize software that instrument is with; At first optimize internal standard gene and goal gene amplification condition; Measure the Ct value of Actin and goal gene respectively; Choose that the most approaching three results (Ct valve system error is less than 0.3) average in nine measured value of experiment, through internal standard gene goal gene is proofreaied and correct then and obtained Δ Δ Ct, at last through 2 ^{-Δ Δ Ct}The relative expression quantity and the systematic error (front is stated) of estimation goal gene.When calculating relative expression quantity, be reference with the sample of wild-type Arabidopsis leaf, be about to its value and convert 1 to, other sample again with its relatively, obtain relative expression's value.The result shows that BnERF56 overexpression efficient is very obvious, as shown in Figure 7: and in the BnERF56 gene overexpression transfer-gen plant, the expression of BnERF56 is significantly raised 17-30 doubly; Accordingly; Pathogeny GAP-associated protein GAP PDF1.2, ChiB, the expression of PR-1 and PR-2 is also significantly raised; The overexpression that shows the BnERF56 gene pathogeny correlative protein expression that raise has strengthened the resistance against diseases of plant.

Embodiment 5:

The BnERF56 gene that a kind of resistance is correlated with, the steps include: to the sclerotinite resistance, to the application in the botrytis cinerea resistance in enhancement of plant

1, BnERF56 gene overexpression significantly strengthens the resistance of plant to saprophytic form fungi sclerotinite and botrytis cinerea

Sclerotinite (Scleortinia sclerotiorum) sclerotium picks up from land for growing field crops, Wuhan rape cane; Select intact sclerotium, steeped 1 minute with 75% alcohol (volume ratio) earlier, use 0.1%HgCl again ₂Sterilized aseptic water washing 3-5 time 8-10 minute.Cut two ends to the sterilization sclerotium, middle portion is cut into the mung bean size, and tangent plane is inoculated in the Minimal flat board down.Common every sclerotium connects a plate, once inoculates the 8-9 plate.Leave standstill in 22 ℃ and to cultivate 3-4 days, when sclerotium is about to be paved with flat board, along the punching of mycelia outer rim, get the mycelia piece, be used for inoculating with φ 2mm punch tool.Minimal substratum (1L) prescription: NaOH 1g, DL-oxysuccinic acid 3g, NH4NO3 2g, MgSO ₄7H ₂O 0.1g, bacterial agar 39g; In order top medicine is dissolved in the zero(ppm) water that fills 800ml, when adding medicine, adds a kind of medicine down after the medicine of adding fully dissolves again, medicine adds Hou Jiashui and supplies 1000mL, adds bacterial agar then, in 117 ℃ of sterilization 15min.

Botrytis cinerea (B.cinerea) is provided by professor Li Guoqing of Hua Zhong Agriculture University, derives from land for growing field crops, Wuhan rape leaf.Strain culturing is (front is stated) on the PDA substratum, cultivates 8d for 28 ℃.With sterilized water wash-out gray mold protospore from the substratum, be mixed with and contain 5 * 10 ⁵And 1 * 10 ⁶Spores mL ^-1Spore suspension for use.

Arabidopis thaliana OX-BnERF56 overexpression strain and wild-type WT are seeded in 23 ℃ of indoor cultivations of preserving moisture of illumination cultivation (16h illumination every day, 8h is dark); The Arabidopis thaliana seedling of choosing for 4 ages in week is used for (comprising strain of OX-BnERF56 overexpression and wild-type WT) inoculation experiments of sclerotinite and grey mold, and every kind of genotype is inoculated 12 strains at least, two leaves of every strain inoculation, test triplicate.For the sclerotinite inoculation, mycelial growth is on the mini substratum, and the agar block that contains the sclerotinite mycelia of the about 2mm of diameter is inoculated into the paraxial surface of leaf; For the grey mold inoculation, mycelial growth is on the PDA substratum, and the spore of collecting on the PDA substratum is diluted with water to 5 * 10 ⁵And 1 * 10 ⁶Spores mL ^-1, earlier leaf is stabbed with fine needle during inoculation, each inoculation point drips the suspension-s of the grey mold spore of 3ul then.Sclerotinite and botrytis cinerea inoculation plant all need keep high humidity, are consistent before temperature and illumination and the inoculation.Morbidity back different time statistics lesion area, result such as Fig. 8 and Fig. 9 compare with wild-type, and the strain of OX-BnERF56 overexpression has significantly strengthened the resistance to sclerotinite and grey mold, shows that BnERF56 is the resistance related gene of saprophytic form fungi sclerotinite and grey mold.

Claims (4)

1. isolating gene, its sequence is a nucleotide sequence shown in the SEQ ID No.1.

2. isolated polypeptide, its sequence is the aminoacid sequence shown in the SEQ ID No.2.

3. the described a kind of isolating gene of claim 1 is strengthening Arabidopis thaliana to the application in the saprophytic nutrition type fungi sclerotinite resistance.

4. the described a kind of isolating gene of claim 1 is strengthening Arabidopis thaliana to the application in the saprophytic nutrition type botrytis cinerea resistance.

Images