CN107604054B - Method based on fluorescence SSR capillary electrophoresis technique Rapid identification locust tree polyploid - Google Patents
Method based on fluorescence SSR capillary electrophoresis technique Rapid identification locust tree polyploid Download PDFInfo
- Publication number
- CN107604054B CN107604054B CN201710858810.4A CN201710858810A CN107604054B CN 107604054 B CN107604054 B CN 107604054B CN 201710858810 A CN201710858810 A CN 201710858810A CN 107604054 B CN107604054 B CN 107604054B
- Authority
- CN
- China
- Prior art keywords
- locust tree
- ssr
- polyploid
- capillary electrophoresis
- rapid identification
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of method based on fluorescence SSR capillary electrophoresis technique Rapid identification locust tree polyploid, this method carries out SSR-PCR amplification using locust tree genomic DNA as template, using the primer as shown in SEQ ID NO.1-2；Pcr amplification product Capillary Electrophoresis；Locust tree SSR finger-print is constructed according to electrophoresis result；According to the locust tree SSR finger-print of building, if number of alleles is more than or equal to 3, it can confirm that the plant is polyploid.The method of the present invention easy, quickly can identify whether locust tree plant is polyploid; a kind of new method practical, easy to operate is provided for the ploidy analysis of locust tree and identification, saves for the selection of locust tree hybrid parent, genetic resources and haves laid a good foundation with evaluation, New variety protection etc..
Description
Technical field
The invention belongs to plant polyploid identification technology fields, and in particular to a kind of quick using fluorescence SSR labelling technique
Identification locust tree plant whether be polyploid method.
Background technique
Locust tree (Robinia pseudoacacia L.) is pulse family (Leguminosae) robinia (Robinia) broad-leaved
Arbor, it is drought-resistant, barren-resistant, resistance to it is slight it is saline and alkaline, contamination resistance is strong, natural renovation ability is strong, be that afforestation and water and soil are protected
Vanguard tree seed is held, there is very high ornamental, nectar source and feeding value.Locust tree timber is tough and tensile, shock resistance, resistance to rotten, resistance to water-wet, is
Important building, ore pillar, vehicle, shipbuilding material；Locust tree timber calorific value is high, and burning velocity is slow, is high-quality fire wood and excellent life
Substance energy tree species.Locust tree originates in North America, and worldwide introduction and acclimatization starts from 1601, and Paris botanical garden director Luo Bao will be pierced
Chinese scholartree introduces France, becomes first forest tree species for introducing Europe from North America, is gradually introduced a fine variety later by other countries and regions, such as
The Soviet Union, Switzerland, Italy, Germany, Austria, Hungary, Czechoslovakia, Yugoslavia, Romania, the Middle East, Japan,
South Korea and China and South America, Africa and Australia (Kai Laisitaishe, 1993).The locust tree introduction and acclimatization of China starts from clearly
(1877-1878) during the time ruled by Emperor Guang Xu, Chinese officials Zhang Lu are born from Japanese introducing, are colonized in Nanjing dragon inner Xue's hut of coiling and do ornamental use.
Qingdao of Shandong province suburb afforestation, (Chen Yishan, 2005) were introduced by German in 1897.20 years before and after founding of New, China is again
Several locust tree provenances have been introduced respectively from Japan, the U.S. and Korea, are planted in China east area of the Liao River, coextensive with eastern and southern Liaoning Province, Tianshui city, Changsha and China
The ground such as north (Gu Wanchun etc., 1991).Since locust tree has extensive adaptability to weather conditions, edaphic condition, from 1949
Since, cultivation range is gradually extended to 23 ° -46 ° of north latitude, and 124 ° -86 ° of east longitude of 27 provinces (city, autonomous region) are widely distributed in Liaoning
On the south Tieling, Inner Mongol Huhehaote, packet header, Ningxia, Yinchuan, south is to Foochow, and to the east of Taiwan, Jiangsu, Along Zhejiang Coast, northwest is extremely
Shihezi of Xinjiang, Yining, Aksu, Yecheng, Xining, Qinghai, southwest to Ya'an Sichuan province, Kunming, Yunnan (Chinese tree will,
1985), gradually it is evolved into the indigenous tree in China.
Polyploid plant is very common in nature, usually has the spies such as the speed of growth is fast, biological yield is high, resistance is strong
Sign.Beijing Forestry University introduces the feed form tetraploid locust K1-K5 in China for 1997 from South Korea, is by artificial induction diploid
Locust tree somatic doubling and be bred as.At present both at home and abroad still without other discoveries or the report of cultivation tetraploid locust.Locust tree makees
One of three big tree species the most successful are introduced a fine variety for the world, this seminar speculates that locust tree certainly exists the more of many generation natural variations
Times body.The method of plant identification polyploid more commonly used at present mainly has plant forms identification method, chromosome counting method (core
Type analysis) and Flow cytometry, wherein Morphological Identification method is most intuitive, and it is most extensive, but the accuracy identified is not high, is only capable of
Main method as Preliminary Identification polyploid；The qualification result of chromosome counting method is the most classical, reliable, but to plant
The requirement of period locating for position and cell of drawing materials is very high, and operating process is cumbersome, heavy workload；Flow cytometry (FCM)
Although can quickly identify the determination of ploidy level of chromosome of plant, sample preparation time was no more than 20 minutes, the otherwise peak DNA
Value position can shift, to influence measurement result, and measure costly.So being badly in need of a kind of easy, quick, efficient
Identification polyploid plant method.South Korea's brightness (2012) is carrying out heredity point to citrus polyploid using EST-SSR in recent years
After analysis, it is believed that SSR molecular marker can be used as a reference of Different Ploidy plant ploidy confirmation；Jia Huixia etc.
(2015) it is found when carrying out SSR fingerprint map construction to 24 parts of poplar germplasm, middle bosom No. 1, extra large No. 1 gloomy, extra large No. 2 gloomy, Cathay poplar
3 not iso-allele sites are amplified with 5 parts of germplasm of Poplar Zhonglin-46, FCM testing result confirms that this 5 parts of germplasm are three times
Body, so drawing a conclusion, SSR marker can accurately reflect the ploidy of plant.However, there is no utilization both at home and abroad at present through retrieving
The method that fluorescence SSR marker technology carries out Rapid identification to locust tree polyploid.
Summary of the invention
Based on the above-mentioned prior art, it is fast based on fluorescence SSR capillary electrophoresis technique that the purpose of the present invention is to provide one kind
The method of speed identification locust tree polyploid.
To achieve the goals above, following technical scheme is provided:
A method of based on fluorescence SSR capillary electrophoresis technique Rapid identification locust tree polyploid, comprising the following steps:
(1) locust tree Genome DNA extraction is (preferred: to extract thorn using plant tissue genome DNA extracting reagent kit (paramagnetic particle method)
Chinese scholartree total DNA)；
(2) carry out PCR amplification using SSR primer: the locust tree total DNA sample extracted using step (1) is template, such as
Primer shown in SEQIDNO.1-2 carries out SSR-PCR amplification；
(3) pcr amplification product Capillary Electrophoresis；
(4) locust tree SSR finger-print is constructed according to the electrophoresis result in step (3)；
It (5), can be true if number of alleles is more than or equal to 3 according to the locust tree SSR finger-print constructed in step (4)
Recognizing the plant is polyploid.
Preferred: the primer in the step (2) further includes the primer as shown in SEQIDNO.3-4.
Preferred: the amplification system in the step (2) uses 10 μ L systems: the locust tree total DNA that step (1) is extracted
(20ng·μL-1) 0.5 μ L, 4.3 μ L, 2 × Taq PCR Master Mix of sterile deionized water, 5 μ L, positive anti-primer (that is: primer
SEQIDNO.1-4) each 0.1 μ L.
It is preferred: the response procedures of PCR amplification in the step (2) are as follows: 95 DEG C of initial denaturation 5min；95 DEG C of denaturation 30s,
57 DEG C of annealing 30s (each circulation reduces by 0.5 DEG C), 72 DEG C of extension 40s, 14 circulations；95 DEG C of denaturation 30s, 50 DEG C of annealing 30s,
72 DEG C of extension 40s, 20 circulations；72 DEG C of extension 10min.
It is preferred: the specific steps of the step (3) are as follows: take each 0.3 μ L of PCR product, 0.5 μ L of molecular weight internal standard and go from
PCR plate is added in sub- 9.5 μ L of formamide mixing, and 95 DEG C of denaturation 5min are centrifuged, machine examination on 1 × Buffer buffer after 4 DEG C of coolings
Survey allele number.
Preferred: the number of alleles visual inspection is surveyed, and parameter used is as follows: operating voltage 15.0kV, sample introduction voltage
1.6kV, injection duration 15s, 30.0 μ A of electric current of voltage regulation.
Preferred: the number of alleles visual inspection, which is surveyed, uses capillary electrophoresis ABI3730XL.
It is preferred: the specific steps of the step (4) are as follows: data preparation point is carried out using Genemarker2.2.0 software
Analysis, according to the peak value of each pair of SSR primer, combination forms each clonal SSR finger-print.
Compared with prior art, the invention has the following advantages:
1, the exemplary method based on fluorescence SSR capillary electrophoresis technique Rapid identification locust tree polyploid of the present invention utilizes
The method of two pairs of fluorescence SSR primers combination building finger-print, be not only one kind from molecular level quickly, efficiently identify locust tree
Kind or clone whether be polyploid method, additionally it is possible to for carrying out locust tree Genetic diversity evaluation, while being locust tree
It introduces a fine variety and provides the theoretical foundation of science with genetic breeding Selection parent, be the side such as locust tree Germplasm resources management and intellectual property protection
Establish solid foundation in face.
2, the exemplary method based on fluorescence SSR capillary electrophoresis technique Rapid identification locust tree polyploid of the present invention, in conjunction with
The advantages of SSR marker and capillary fluorescence detection, it the deficiency of polyacrylamide gel electrophoresis is overcome, can not only accurately read
The size of product segment, accuracy reach within 1bp, and cost is relatively low, great application value.
3, method of the example of the present invention based on fluorescence SSR capillary electrophoresis technique Rapid identification locust tree polyploid, using spy
Anisotropic SSR primer sets carry out identification locust tree kind polyploid, and specificity is high, and amplification efficiency is good, can quickly, batch identification locust tree
Whether it is polyploid, there are the advantages such as quick, accurate, easy to operate, and qualification result is not influenced vulnerable to time and environment.
4, method of the example of the present invention based on fluorescence SSR capillary electrophoresis technique Rapid identification locust tree polyploid, using drawing
The polyploid recall rate of this pair of primers of object SEQIDNO.1, SEQIDNO.2 is as high as 85.42%, utilizes primer SEQIDNO.1-
4 polyploid recall rate can reach 100%.
5, method of the example of the present invention based on fluorescence SSR capillary electrophoresis technique Rapid identification locust tree polyploid, primer are
Go out from multipair SSR primer screening, polymorphism is high, stability is good, can precise Identification locust tree whether be polyploid, utilize primer
As long as three or more (including three) allele can be amplified, it can identify that the locust tree plant is polyploid.
Detailed description of the invention
Fig. 1 is the part pcr amplification product Capillary Electrophoresis figure of the exemplary fluorescence SSR primer pair 1 of the present invention；
Fig. 2 is the part pcr amplification product Capillary Electrophoresis figure of the exemplary fluorescence SSR primer pair 2 of the present invention.
Specific embodiment
In order to be better understood by technical solution of the present invention, with reference to the accompanying drawings of the specification with specific embodiment to the present invention
It is described further.
1, experimental material:
This experiment is using the 5 tetraploid locust clones introduced from South Korea as material to be tested.Respectively K1
(Tetraploid R.pseudoacacia K1)、K2(Tetraploid R.pseudoacacia K2)、 K3
(Tetraploid R.pseudoacacia K3)、K4(Tetraploid R.pseudoacacia K4)、 K5
(Tetraploid R.pseudoacacia K5)。
It is acquired for materials from Shandong Province, Daqunshan Mountains forest farm, Fei County.
In May, 2016, young leaflet tablet is acquired, silica dehydrator is spare.
2, the extraction of genomic DNA:
Tender Robinia Pseudoacacia Clones blade is taken, using Ying Ruicheng biochemical technology (Shanghai) Co., Ltd. plant tissue genome
DNA extraction kit (paramagnetic particle method) (article No. PTED-6030) extracts to specifications.
3, PCR amplification is carried out using SSR primer:
The locust tree total DNA sample extracted using step 2 carries out SSR-PCR amplification as template, using following two pairs of primers, can be with
Using FAM, HEX, ROX or TAMRA, wherein primer is marked in any two kinds of fluorescence,
Primer pair 1: upstream: 5 ' ACTGTTGGCTATGTCCCCTG ' 3 (such as: SEQIDNO.1)
Downstream: 5 ' GCGAATCTTGACAGCAAACA ' 3 (such as: SEQIDNO.2)；
Primer pair 2: upstream: 5 ' AACCCTAAAAGCCTCGTTATC ' 3 (such as: SEQIDNO.3)
Downstream: 5 ' TGGCATTTTTTGGAAGACACC ' 3 (such as: SEQIDNO.4)；
Above-mentioned fluorescence SSR-PCR uses 10 μ L systems: DNA (20ng μ L-1) 0.5 μ L, sterile deionized water 4.3 μ L, and 2
× Taq PCR Master Mix 5 μ L, positive each 0.1 μ L of anti-primer.
Above-mentioned fluorescent primer PCR amplification program uses: 95 DEG C of initial denaturation 5min；95 DEG C of denaturation 30s, 57 DEG C of annealing 30s
(each circulation reduces by 0.5 DEG C), 72 DEG C of extension 40s, 14 circulations；95 DEG C of denaturation 30s, 50 DEG C of annealing 30s, 72 DEG C of extension 40s,
20 circulations；72 DEG C of extension 10min.
4, machine testing on Capillary Electrophoresis
PCR product allele number is detected with capillary electrophoresis ABI3730XL.Take each 0.3 μ L of PCR product, molecule
It measures internal standard (manufacturer ABI) 0.5 μ L and 9.5 μ L of deionized formamide (manufacturer ABI) mixing and PCR plate, 95 DEG C of denaturation is added
5min is centrifuged, machine testing on 1 × Buffer buffer after 4 DEG C of coolings.Genetic Analyser manufacturer is ABI company, model
3730xlDNAanalyzer, parameter used are as follows: operating voltage 15.0kV, sample introduction voltage 1.6kV, injection duration 15s,
30.0 μ A of electric current of voltage regulation.
5, data preparation point SSR fingerprint map construction and polyploid identification: is carried out using Genemarker2.2.0 software
Analysis, according to the peak value of each pair of SSR primer, combination forms each clonal SSR finger-print, as long as having one in finger-print
There are three or more (including 3) allele in a site, so that it may identify that the locust tree plant is polyploid from molecular level.
The finger-print of above-mentioned two pairs of SSR primers combination building is shown in Table 1.
The finger-print of 1: two pair of fluorescence SSR primer combination building of table
The result shows that: it can easily be verified from molecular level merely with SSR primer pair 1 provided by the invention and primer pair 2
Clone K1-K5 is strictly polyploid, and the corresponding site SSR of two pairs of primers partial fingerprints banding pattern in different Robinia Pseudoacacia Clones is shown in
Fig. 1-Fig. 2.The test result of these primers is reproducible, and polymorphism is high, can quickly, accurately and efficiently complete locust tree kind or
The identification of person's clone polyploid.
In addition, this laboratory (is largely from seed reality constructing 343 locust tree kinds or clone using primer pair 1
The excellent strain selected in raw seedling) finger-print when, wherein 293 clones in the site have three to six allele for discovery,
It is as high as 85.42% merely with the polyploid recall rate of this pair of primers, absolutely proves the high efficiency and applicability of the invention, from
Molecular level demonstrates nature and is implicitly present in many locust tree polyploids that natural variation occurs.
Above description is only the preferred embodiment of the application and the explanation to institute's application technology principle.Those skilled in the art
Member is it should be appreciated that invention scope involved in the application, however it is not limited to technology made of the specific combination of above-mentioned technical characteristic
Scheme, while should also cover in the case where not departing from the inventive concept, it is carried out by above-mentioned technical characteristic or its equivalent feature
Any combination and the other technical solutions formed.Such as features described above has similar function with (but being not limited to) disclosed herein
Can technical characteristic replaced mutually and the technical solution that is formed.
SEQUENCE LISTING
<110>Shandong Forest Science Academy
The state-owned Daqunshan Mountains forest farm in Fei County
<120>method based on fluorescence SSR capillary electrophoresis technique Rapid identification locust tree polyploid
<130> 2017
<160> 4
<170> PatentIn version 3.5
<210> 1
<211> 20
<212> DNA
<213>artificial sequence
<400> 1
actgttggct atgtcccctg 20
<210> 2
<211> 20
<212> DNA
<213>artificial sequence
<400> 2
gcgaatcttg acagcaaaca 20
<210> 3
<211> 21
<212> DNA
<213>artificial sequence
<400> 3
aaccctaaaa gcctcgttat c 21
<210> 4
<211> 21
<212> DNA
<213>artificial sequence
<400> 4
tggcattttt tggaagacac c 21
Claims (9)
1. a kind of method based on fluorescence SSR capillary electrophoresis technique Rapid identification locust tree polyploid, characterized in that including following
Step:
(1) locust tree Genome DNA extraction；
(2) carry out PCR amplification using SSR primer: the locust tree total DNA sample extracted using step (1) is template, such as SEQ ID
Primer shown in NO.1-2 carries out SSR-PCR amplification；
(3) pcr amplification product Capillary Electrophoresis；
(4) locust tree SSR finger-print is constructed according to the electrophoresis result in step (3)；
(5) plant can be confirmed if number of alleles is more than or equal to 3 according to the locust tree SSR finger-print constructed in step (4)
Strain is polyploid.
2. the method as described in claim 1 based on fluorescence SSR capillary electrophoresis technique Rapid identification locust tree polyploid, special
Sign is that the primer in the step (2) further includes the primer as shown in SEQ ID NO.3-4.
3. the method as described in claim 1 based on fluorescence SSR capillary electrophoresis technique Rapid identification locust tree polyploid, special
Sign is: the amplification system in the step (2) uses 10 μ L systems: DNA 20ng μ L-10.5 μ L, 4.3 μ L of sterile deionized water,
2 × Taq PCR Master Mix 5 μ L, positive each 0.1 μ L of anti-primer.
4. the method as described in claim 1 based on fluorescence SSR capillary electrophoresis technique Rapid identification locust tree polyploid, special
Sign is: the response procedures of PCR amplification in the step (2) are as follows: 95 DEG C of initial denaturation 5min；95 DEG C of denaturation 30s, 57 DEG C of annealing 30s,
72 DEG C of extension 40s, 14 circulations；95 DEG C of denaturation 30s, 50 DEG C of annealing 30s, 72 DEG C of extension 40s, 20 recycle；72 DEG C of extensions
10min。
5. the method as described in claim 1 based on fluorescence SSR capillary electrophoresis technique Rapid identification locust tree polyploid, special
Sign is: the specific steps of the step (3) are as follows: takes each 0.3 μ L of PCR product, 0.5 μ L of molecular weight internal standard and deionized formamide
PCR plate is added in 9.5 μ L mixing, and 95 DEG C of denaturation 5min are centrifuged, machine testing allele on 1 × Buffer buffer after 4 DEG C of coolings
Number.
6. the method as claimed in claim 5 based on fluorescence SSR capillary electrophoresis technique Rapid identification locust tree polyploid, special
Sign is: the number of alleles visual inspection is surveyed, and parameter used is as follows: operating voltage 15.0kV, sample introduction voltage 1.6kV, injection continue
Time 15s, 30.0 μ A of electric current of voltage regulation.
7. the method as claimed in claim 5 based on fluorescence SSR capillary electrophoresis technique Rapid identification locust tree polyploid, special
Sign is: the number of alleles visual inspection, which is surveyed, uses capillary electrophoresis ABI3730XL.
8. the method as described in claim 1 based on fluorescence SSR capillary electrophoresis technique Rapid identification locust tree polyploid, special
Sign is: the specific steps of the step (4) are as follows: data preparation analysis is carried out using Genemarker2.2.0 software, according to each pair of
The peak value of SSR primer, combination form the SSR finger-print of each locust tree.
9. the method as described in claim 1 based on fluorescence SSR capillary electrophoresis technique Rapid identification locust tree polyploid, special
Sign is: extracting locust tree total DNA using paramagnetic particle method in the step (1).
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710858810.4A CN107604054B (en) | 2017-09-21 | 2017-09-21 | Method based on fluorescence SSR capillary electrophoresis technique Rapid identification locust tree polyploid |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710858810.4A CN107604054B (en) | 2017-09-21 | 2017-09-21 | Method based on fluorescence SSR capillary electrophoresis technique Rapid identification locust tree polyploid |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107604054A CN107604054A (en) | 2018-01-19 |
| CN107604054B true CN107604054B (en) | 2019-05-10 |
Family
ID=61061556
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710858810.4A Active CN107604054B (en) | 2017-09-21 | 2017-09-21 | Method based on fluorescence SSR capillary electrophoresis technique Rapid identification locust tree polyploid |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107604054B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107760796A (en) * | 2017-10-31 | 2018-03-06 | 山东省林业科学研究院 | A kind of SSR molecular marker primer of Rapid identification locust tree polyploid |
| CN116200521B (en) * | 2022-12-05 | 2023-08-18 | 东北林业大学 | SSR (simple sequence repeat) marker primer group for identifying Korean pine clone and construction method and application of SSR marker primer group and fingerprint |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104357577A (en) * | 2014-11-28 | 2015-02-18 | 中国农业科学院作物科学研究所 | Method for rapidly identifying chromosome ploidy of avena plant and application thereof |
| CN106868119A (en) * | 2017-02-14 | 2017-06-20 | 山东农业大学 | A kind of SSR label primer group for differentiating locust tree Relationships among Germplasm Resources and its application |
-
2017
- 2017-09-21 CN CN201710858810.4A patent/CN107604054B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104357577A (en) * | 2014-11-28 | 2015-02-18 | 中国农业科学院作物科学研究所 | Method for rapidly identifying chromosome ploidy of avena plant and application thereof |
| CN106868119A (en) * | 2017-02-14 | 2017-06-20 | 山东农业大学 | A kind of SSR label primer group for differentiating locust tree Relationships among Germplasm Resources and its application |
Non-Patent Citations (3)
| Title |
|---|
| Development and Evaluation of a Novel Set of EST-SSR Markers Based on Transcriptome Sequences of Black Locust (Robinia pseudoacacia L.);Qi Guo等;《Genes》;20170707;第8卷(第177期);第1-13页 |
| 刺槐不同来源无性系种质的表型变异与遗传多样性分析;毛秀红;《中国博士学位论文全文数据库》;20171215(第12期);第D049-46页 |
| 沙田柚多倍体遗传差异的SSR分析;向素琼等;《果树学报》;20091231;第26卷(第3期);第382-385页 |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107604054A (en) | 2018-01-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107502665B (en) | Identify the method for locust tree kind based on Capillary Electrophoresis fluorescence SSR finger-print | |
| CN103233065B (en) | Molecular specific marker primers for No. 4 and No.32 of an improved variety Changlin of Camellia oleifera and an identification method | |
| CN107604054B (en) | Method based on fluorescence SSR capillary electrophoresis technique Rapid identification locust tree polyploid | |
| CN102732973A (en) | Construction method for DNA fingerprint database of high flux cotton variety | |
| CN105154529A (en) | Molecular specific marker primer and identification method for fine varieties of camellia oleifera | |
| CN103205424B (en) | Molecule specificity marker primer and identification method of improved variety of camellia oleifera Changlin Number 55 | |
| CN106434944A (en) | Application of SNP molecular marker closely linked to aphid resistance gene of prunus persica | |
| CN103834735B (en) | Nucleotide sequence and molecular probe for identifying dendrobium officinale and applications of molecular probe | |
| CN104450888B (en) | Hemp DNA fluorescent composite amplification systems | |
| CN113862390A (en) | Primer and method for identifying root and mixed counterfeit product of herba Humuli Scandentis | |
| CN107760796A (en) | A kind of SSR molecular marker primer of Rapid identification locust tree polyploid | |
| CN106086168B (en) | Identify EST-SSR primer sets, preparation method and its application in species identification of dendrobium candidum and Falconer Dendrobium | |
| CN104673790A (en) | Molecular-specificity labeling primer for oil-tea good-variety longlin 18 and identification method | |
| CN105063187A (en) | Method and primer composition for rapid detection of resistance of botrytis cinerea to SDH1 fungicides | |
| CN104774948A (en) | PCR (Polymerase chain reaction) identification kit and identification method for largehead atractylode in Hebei | |
| CN109699489A (en) | It polymerize the willow breeding method of salt tolerant, fast-growing character | |
| CN104087664B (en) | Citrus fruit fly is carried out to the molecule marking method of sibship and cluster analysis | |
| CN107190083A (en) | Differentiate nucleotide sequence, specificity labeled primers and the method for yellow tea tree breed ' yellow leaf is precious ' | |
| CN110923304B (en) | Molecular marker, primer pair and method for identifying sex of ginkgo biloba | |
| CN105219848A (en) | For differentiating primer and the application thereof of tapiscia sinensis sex | |
| CN102146477B (en) | Real-time fluorescence PCR (polymerase chain reaction) detection method based on ITS (internal transcribed spacer) gene for Opogona sacchari | |
| CN104946732A (en) | Broccoli flower trait identification method and application thereof | |
| CN104611329A (en) | Molecular specific marker primers for sakura varieties including Superba and Grandifora | |
| CN104593367B (en) | The specificity labeled primers of red rich, the former brave tail in city of Flowering Cherry Cultivars and the open country younger sister back of the body | |
| CN102296124A (en) | Method for quickly differentiating Chinese date varieties by using random amplified polymorphic DNA (RAPD) |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |