CN113862390A - Primer and method for identifying root and mixed counterfeit product of herba Humuli Scandentis - Google Patents

Primer and method for identifying root and mixed counterfeit product of herba Humuli Scandentis Download PDF

Info

Publication number
CN113862390A
CN113862390A CN202111244598.5A CN202111244598A CN113862390A CN 113862390 A CN113862390 A CN 113862390A CN 202111244598 A CN202111244598 A CN 202111244598A CN 113862390 A CN113862390 A CN 113862390A
Authority
CN
China
Prior art keywords
root
its2
primer
mixed counterfeit
seq
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202111244598.5A
Other languages
Chinese (zh)
Inventor
王江瑞
蔡蓓蕾
王学政
赵建权
欧洪
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Chongqing Pharmaceutical Research Institute Co Ltd
Original Assignee
Chongqing Pharmaceutical Research Institute Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Chongqing Pharmaceutical Research Institute Co Ltd filed Critical Chongqing Pharmaceutical Research Institute Co Ltd
Priority to CN202111244598.5A priority Critical patent/CN113862390A/en
Publication of CN113862390A publication Critical patent/CN113862390A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1003—Extracting or separating nucleic acids from biological samples, e.g. pure separation or isolation methods; Conditions, buffers or apparatuses therefor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/686—Polymerase chain reaction [PCR]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Analytical Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biotechnology (AREA)
  • Genetics & Genomics (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Immunology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biomedical Technology (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Plant Pathology (AREA)
  • Botany (AREA)
  • Mycology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses a primer and a method for identifying a torch root and a mixed counterfeit product thereof, and the primer comprises a primer pair ITS2F and ITS3R, wherein the nucleotide sequence of a forward primer ITS2F is shown as SEQ ID No.1, and the nucleotide sequence of a reverse primer ITS3R is shown as SEQ ID No. 2; respectively extracting genome DNA of the root of the torch flower and a mixed counterfeit product thereof; respectively taking the extracted genomic DNA of the fire-picking flower roots and the mixed counterfeit products thereof as amplification templates, and taking primer pairs ITS2F and ITS3R as primers, and carrying out PCR amplification to respectively obtain the amplification products of the fire-picking flower roots and the mixed counterfeit products thereof; and (3) obtaining internal transcription spacer region ITS2 sequences of the fire bang flower root and the mixed counterfeit product thereof by using CodonCode Aligner V6.0.2 software and a hidden Markov model-based HMMer annotation method of each obtained sequencing peak map so as to respectively draw ITS2 secondary structures of the fire bang flower root and the mixed counterfeit product thereof, and rapidly and accurately identifying the fire bang flower root and the mixed counterfeit product thereof by comparing the ITS2 secondary structures of the fire bang flower root and the mixed counterfeit product thereof.

Description

Primer and method for identifying root and mixed counterfeit product of herba Humuli Scandentis
Technical Field
The invention belongs to the field of identification of medicinal plants and traditional Chinese medicines, and particularly relates to a primer and a method for identifying a root of a common monkshood daughter root and a mixed counterfeit product thereof.
Background
The root of the Hutch is the peeled root core of Tripterygium hypoglaucum (Levl.) Hutch of Tripterygium of Celastraceae. The root of Ficus will dispel wind and dampness, relax tendons and activate collaterals, clear away heat and toxic materials. Has anti-inflammatory and immunosuppressive effects, and can be used for treating rheumatoid arthritis, lupus erythematosus, primary nephrotic syndrome, diabetic nephropathy, etc., with good clinical therapeutic effect.
The medicinal materials of the hairy vein agrimony root are mainly distributed in the areas from the Yangtze river basin to the southwest at present, the distribution longitude range is wide, the east longitude ranges from 99 degrees to 122 degrees, and the north latitude ranges from 21 degrees to 31 degrees, the medicinal materials are basically from wild at present, the wild storage amount is about 1.5 ten thousand tons, but the time for the medicinal materials of the hairy vein agrimony root to grow into the medicinal standard Chinese medicinal materials is more than 10 years and even longer. According to preliminary estimation and field investigation, the annual demand of the market of the medicinal material of the existing Huohua root is about 1000 tons, and in addition, as population and economic pressure are increased, the producing area is generally used for reclaiming slopes, economic forest construction, forest stand reconstruction and the like, the protogenesis environment of the Huohua root is greatly damaged, the wild population recovery fragmentation and marginalization are very serious, and resources are gradually exhausted. The root of Hutch fireworks and Tripterygium wilfordii belong to Celastraceae plant Tripterygium, the chemical components and pharmacological action of the root of Hutch fireworks and the Tripterygium wilfordii are very similar, and the toxicity of the root of Hutch fireworks is far less than that of the medicinal materials such as Tripterygium wilfordii, some suppliers often mutually use the root of Hutch fireworks and other medicinal materials such as Tripterygium wilfordii, and the medicinal parts are roots, because the appearance is very similar, and many-sided factors such as knowledge limitation of appraisers, the root of Hutch fireworks and the medicinal materials such as Tripterygium wilfordii, Celastrus orbiculatus are difficult to distinguish, thus the market disorder and the accuracy and safety of medication are seriously influenced. In order to ensure the safety of medication, a more accurate, reliable and rapid method for identifying the root of the torch flower and the adulterant thereof is needed.
Since 2010, the DNA bar code is proposed for identifying medicinal plants by using the Chen and Van der and the like for the first time, the technology is greatly applied and developed in the identification direction of the medicinal plants, the DNA bar code technology is simple and efficient, is not limited by the appearance form of a sample and the specialty of a researcher, and can be well and quickly applied to the identification of the truth of the traditional Chinese medicinal materials or the plants. At present, the research on the root of the Ficus carica is mostly carried out on the research of clinical, chemical components and pharmacological and pharmacodynamic effects of the Ficus carica, the identification of the medicinal materials is carried out by using the traditional methods such as properties and the like, and the identification difficulty is higher because the root medicinal materials in the market are basically the same. With the development of molecular biology, more and more molecular biological identification methods are applied to the identification of traditional Chinese medicinal materials, so that the identification of the medicinal material of the Huohuagen and the mixed counterfeit products thereof (tripterygium wilfordii, celastrus orbiculatus, cherokee rose root and celastrus angulatus) is carried out by utilizing the molecular identification technology, an effective means is provided for the identification of the medicinal material of the Huohuagen, and the quality of the medicament at the later stage is effectively guaranteed.
Disclosure of Invention
In view of the above-mentioned disadvantages, the first objective of the present invention is to provide a primer for identifying the root of a Ficus carica and its adulterants;
the second purpose of the invention is to provide a method for identifying the root of the torch flower and the adulterant thereof by using the primer;
in order to achieve the purpose, the invention adopts the following technical scheme:
a primer for identifying the root and the mixed counterfeit products of the herba Humuli Scandentis comprises a primer pair ITS2F and ITS3R, wherein the nucleotide sequence of a forward primer ITS2F is shown as SEQ ID No.1, and the nucleotide sequence of a reverse primer ITS3R is shown as SEQ ID No. 2.
Further, the specific steps are as follows:
1) respectively extracting genome DNA of the root of the common knotweed and the mixed counterfeit product thereof;
2) respectively taking the genomic DNA of the hairy antenoron herb root and the mixed counterfeit product thereof extracted in the step 1) as amplification templates, and taking primer pairs ITS2F and ITS3R as primers to carry out PCR amplification, and respectively obtaining the amplified products of the hairy antenoron herb root and the mixed counterfeit product thereof;
3) respectively carrying out electrophoresis on each amplification product in the step 2) by using 3% agarose gel to detect the DNA purity of the amplification product, and carrying out bidirectional sequencing on the amplified DNA;
4) respectively carrying out proofreading and splicing on each sequencing peak map obtained in the step 3) by using CodonCode Aligner V6.0.2 software, removing primer regions, and then removing 5.8S and 28S regions at two ends of all measured sequences by using a CodonCode Aligner V6.0.2 based on an HMMer annotation method of a hidden Markov model, thereby respectively obtaining internal transcription spacer region ITS2 sequences of a torch root and a mixed counterfeit product thereof;
5) the ITS2 sequences of the torch flower roots and the mixed counterfeit products thereof and the sequences downloaded in GenBank are respectively compared and analyzed through MEGA6.0 software, the genetic distance between K2P species is calculated to establish NJtree, simultaneously the support rate of each branch is repeatedly checked by using bootstrap, the ITS2 secondary structures of the torch flower roots and the mixed counterfeit products thereof are respectively drawn by using pseudo viewer2.5 and combining the ITS2 sequences, and the torch flower roots and the mixed counterfeit products thereof are quickly and accurately identified by comparing the ITS2 secondary structures of the torch flower roots and the mixed counterfeit products thereof.
Further, ITS2F in the primer pair ITS2F and ITS3R is a forward primer, the nucleotide sequence of which is shown in SEQ ID No.1, ITS3R is a reverse primer, and the nucleotide sequence of which is shown in SEQ ID No. 2.
Further, the false mixture of the root of the common knotweed comprises one or more of tripterygium wilfordii, celastrus angulatus, celastrus orbiculatus and cherokee rose root.
Furthermore, the ITS2 nucleotide sequence of the Ficus glauca root is shown as SEQ ID No.3, the ITS2 nucleotide sequence of Tripterygium wilfordii is shown as SEQ ID No.4, the ITS2 nucleotide sequence of Tripterygium wilfordii is shown as SEQ ID No.5, the ITS2 nucleotide sequence of Celastrus angulatus is shown as SEQ ID No.6, the ITS2 nucleotide sequence of Celastrus angulatus is shown as SEQ ID No.7, and the ITS2 nucleotide sequence of the Cherokee rose root is shown as SEQ ID No. 8.
Further, the method for extracting the genome DNA of the root and the mixed counterfeit product of the herba pyrrosiae in the step 1) comprises the following steps: scrubbing the surfaces of the torch flower roots and the mixed counterfeit products thereof respectively by using 75% ethanol, crushing the surfaces into fine powder respectively, taking 60mg of each torch flower root and the mixed counterfeit products thereof respectively, adding liquid nitrogen respectively, and grinding for 5min for 30 times/s by using a full-automatic rapid ball mill to obtain samples of the torch flower roots and the mixed counterfeit products thereof respectively;
and (3) extracting total DNA of the samples of the torch flower roots and the adulterants thereof respectively by using the optimized plant DNA extraction kit according to the kit instructions to obtain DNA templates of the respectively extracted torch flower roots and the adulterants thereof.
Further, the optimized plant DNA extraction kit comprises the following reagents: chloroform, a buffer solution GP1, frozen isopropanol, an adsorption column CB3, a buffer solution GD and a rinsing solution PW.
Further, the PCR amplification reaction program in the step 2) is as follows: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30s, and annealing at 56 ℃ for 30 s; extension at 72 ℃ for 2min for 40 cycles; extension at 72 ℃ for 10 min.
By adopting the scheme, the invention has the following advantages:
1. compared with the existing properties and the prior microscopic technology for identifying the medicinal material of the root of the Ficus maackii and the mixed counterfeit product thereof, the method has the advantages that the ITS2 bar code of the root of the Ficus maackii is combined with the two-dimensional structure, so that the method can be more accurately, efficiently and quickly used for identifying the species such as the root of the Ficus maackii, the thunder god vine, the northeast Tripterygium wilfordii, the celastrus angulatus, the cherokee rose root and the like, an effective means is provided for identifying the authenticity of the medicinal material of the root of the Ficus maackii and the mixed counterfeit product thereof, a reliable means is provided for a medicine supervision department at the same time, and an effective guarantee is provided for the quality control research of the later stage of the corresponding medicine;
2. in the invention, the root medicinal materials are rich in polysaccharide and mucus components and have certain interference on later-stage PCR, the extraction method of the plant DNA kit is optimized, the precipitation reagent is changed into chloroform, and the buffer solution GP2 is changed into frozen isopropanol (-20 ℃), so that the components such as polysaccharide in a sample can be effectively precipitated, and the DNA sample with higher purity is obtained and used for PCR amplification;
3. experimental results show that the number of ITS2 bar codes of the pitaya root and ITS2 bar codes of tripterygium wilfordii, celastrus angulatus, celastrus orbiculatus and cherokee rose root are respectively 5, 7, 27, 26 and 88, the interspecies genetic distance is 0.012-0.690, the difference is obvious, and the medicinal material of the pitaya root and the mixed counterfeit product thereof can be effectively, quickly and accurately identified by combining with an NJtree phylogenetic tree.
Additional advantages, objects, and features of the invention will be set forth in part in the description which follows and in part will become apparent to those having ordinary skill in the art upon examination of the following or may be learned from practice of the invention. The objectives and other advantages of the invention will be realized and attained by the structure particularly pointed out in the written description and claims hereof.
Drawings
FIG. 1 shows the ITS2 sequence alignment of the root of Ficus will be compared with the root of Tripterygium wilfordii, Celastrus angulatus, Celastrus orbiculatus and Cherokee rose of the present invention.
FIG. 2 shows the ITS2 sequence NJtree of the root of Ficus effusus of the present invention, Tripterygium wilfordii, Celastrus angulatus, Celastrus orbiculatus and Cherokee rose root.
FIG. 3 is a secondary structure diagram of ITS2 sequence of the root of Ficus glauca of the present invention, Tripterygium wilfordii, Celastrus angulatus, Celastrus orbiculatus and Cherokee rose root.
Detailed Description
The present invention will now be described in detail with reference to the drawings and examples, which are not intended to limit the invention in any way, except as specifically stated, reagents, methods and apparatus are conventional in the art.
Example 1: design of the Synthesis of primer pairs
Forward and reverse primers ITS2F/ITS3R were designed by Chengdu Kangxi Biotechnology Limited.
Forward primer ITS 2F: 5'> ATGCGATACTTGGTGTGAAT < 3'.
Reverse primer ITS 3R: 5'> GACGCTTCTCCAGACTACAAT < 3'.
Example 2: method for identifying medicinal material of herba Humuli Scandentis and its mixed counterfeit product
1. Instruments and reagents
Root of common Flowery knotweed, Tripterygium wilfordii, Celastrus angulatus, Celastrus orbiculatus, root of cherokee rose, dNTP; 2 XTaq PCR MasterMix (Tiangen Biochemical technology Co., Ltd.); plant DNA extraction kit (ThermoFisher); agarose (SIGMNALDRICH); chloroform (analytically pure, Chengdu Kelong chemical reagent factory), and frozen isopropanol (-20 deg.C).
2. Experimental methods
2.1 sources of Material
The root of Ficus effusus, Tripterygium wilfordii, Celastrus angulatus, Celastrus orbiculatus and Cherokee rose is from Sichuan, Yunnan and Fujian, the material-taking parts of 27 samples including 6 species are roots, the details are shown in Table 1;
TABLE 1 Experimental materials
Figure BDA0003320492960000051
Figure BDA0003320492960000061
Note: "+" indicates that all samples were downloaded in GenBank; the mutation site is the mutation site between each sample and the root of the Ficus calyx Tripterygium hypoglaucum (Levl.) Hutch.
2.2 extraction of sample DNA
Optimizing a plant DNA extraction kit: the reagent in the original plant DNA extraction kit comprises: buffer solution GP1, buffer solution GP2, adsorption column CB3, buffer solution GD and rinsing liquid PW, as root medicinal materials are rich in polysaccharide and mucus components and have certain interference on later-stage PCR reaction, the original plant DNA kit is optimized, the original precipitation reagent is changed into chloroform, the original buffer solution GP2 is changed into frozen isopropanol (-20 ℃), the optimized plant DNA kit can effectively precipitate the components such as polysaccharide in the root medicinal material sample, and the DNA sample with higher purity is obtained and is used for PCR amplification;
before the experiment, the experimental equipment and the like are sterilized under high pressure, 75% ethanol is adopted to scrub the surface of the sample, each sample is crushed into fine parts, 60mg of each sample such as a flower root and the like is taken, liquid nitrogen is added, and then the mixture is ground for 5min (30 times/s) by a full-automatic rapid ball mill. And (3) extracting the total DNA of the sample by using the reagent in the optimized plant DNA extraction kit according to the instruction of the original plant DNA extraction kit, namely extracting the DNA templates of the samples respectively.
2.3PCR amplification reaction
Taking each sample DNA extracted in the step 2.2 as an amplification template, carrying out PCR amplification reaction on ITS2F/ITS3R by adopting a designed and synthesized primer pair, obtaining amplification products of each sample after the reaction is finished, respectively taking 5 mu L of reaction products, detecting the purity of the amplified DNA by agarose gel (the agarose concentration is 3%, the nucleic acid dye contains 4%, and the electrophoresis lasts for 1.0h), observing that the band is single by using a gel electrophoresis imaging system, indicating that the PCR amplification is good, and then sending the amplified DNA to Chengdu Ke catalpi biotechnology limited company for bidirectional sequencing;
the PCR reaction system is as follows: 25 μ L, 1.0 μ L each including 2.5 μmol/L of forward and reverse primers, 12.5 μ L of 2 × Easy Taq PCR SuperMix (TransGen Biotech Co., China), 3 μ L of template DNA, ddH2O is 8.5 mu L;
the PCR amplification procedure was: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30s, and annealing at 56 ℃ for 30 s; extension at 72 ℃ for 2min for 40 cycles; extension at 72 ℃ for 10 min.
2.4 sequence data processing to obtain internal transcribed spacer ITS2 sequences
The sequence peak profiles of the respective samples measured were collated and spliced using CodonCode Aligner V6.0.2 software (CodonCode Co., USA) to remove the primer region. HMMer annotation method based on hidden Markov model the internal transcribed spacer ITS2 sequences for each sample were obtained by removing the 5.8S and 28S regions from both ends of all the sequences determined and the sequences downloaded in GenBank using CodonCode Aligner V6.0.2.
2.5 ITS2 Secondary Structure of Each sample
The ITS2 sequence of each sample and the sequence downloaded from GenBank are analyzed and aligned by MEGA6.0 software (Molecular evolution Genetics Analysis), the genetic distance between K2P species is calculated, NJtree is established, and simultaneously, the support rate of each branch is repeatedly tested by using bootstrap (self-development support rate 1000 times). And (3) mapping the ITS2 secondary structure of each sample by using pseudoviewer2.5 and combining the ITS2 sequence, and finally submitting the determined sequence to a database by using sequin software to obtain GenBank login number.
3. Results of the experiment
TABLE 2 genetic distance between the species of the Ficus L.root and its adulterants
Figure BDA0003320492960000081
As can be seen from the phylogenetic tree in FIG. 2, 27 samples of 6 species such as the Ficus carica root, Tripterygium wilfordii, etc. are gathered into one type, and are sequentially gathered into one type with each species in GenBank, showing unilineage, and being clearly distinguishable from other congeneric plants;
table 1, table 2, and fig. 1 show that the ITS2 barcode of Ficus rehmannica root and the ITS2 barcode variation sites of Tripterygium wilfordii hook, Celastrus angulatus, Celastrus orbiculatus and Cherokee rose root are respectively 5, 7, 27, 26 and 88, the interspecies genetic distance is 0.012-0.690, the difference is obvious, and the Ficus rehmannica root and Tripterygium wilfordii hook, Celastrus orbiculatus hook and Cherokee rose root can be better distinguished;
as can be seen from FIG. 3, the ITS2 secondary structure of all samples consists of a central major loop and four helices, which are regions I, II, III and IV in a clockwise sequence, each helix having loops of different sizes and stems of different lengths. The secondary structure diagram of the torch flower root is approximately the same as that of the tripterygium wilfordii and the tripterygium wilfordii, only 5 and 7 mutation sites are provided; compared with celastrus angulatus, celastrus orbiculatus and cherokee rose root, the secondary structure of the corymbose sparks root is obviously different, and the angle of each spiral structure and the central main ring is also obviously different, so the ITS2 secondary structure can obviously, quickly and accurately identify the corymbose sparks root and a mixed counterfeit product thereof;
therefore, the ITS2 sequence amplified by the primer pair ITS2F/ITS3R can quickly and accurately identify the Humanhua root and the mixed counterfeit products (Tripterygium wilfordii, Celastrus orbiculatus, Cherokee rose root and Celastrus angulatus), thereby providing an effective means for identifying the medicinal materials of the Humanhua root and providing an effective guarantee for the quality of the later-stage medicines.
Finally, the description is as follows: although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art will understand that various changes, modifications and substitutions can be made without departing from the spirit and scope of the invention as defined by the appended claims. Any modification, equivalent replacement, or improvement made without departing from the spirit and principle of the present invention shall fall within the protection scope of the present invention.
Sequence listing
<110> pharmaceutical Limited of research institute of Chongqing City
<120> primer and method for identifying root and mixed counterfeit product of herba Humuli Scandentis
<160> 8
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA
<213> ITS2F Artificial Sequence (ITS 2F Artificial Sequence)
<400> 1
atgcgatact tggtgtgaat 20
<210> 2
<211> 21
<212> DNA
<213> ITS3R Artificial Sequence (ITS3R Artificial Sequence)
<400> 2
gacgcttctc cagactacaa t 21
<210> 3
<211> 223
<212> DNA
<213> HBHG0301 Artificial Sequence (HBHG0301 Artificial Sequence)
<400> 3
cgcaacgtcg ccaacaatcc cctcaccccc tacataggga atagttaggg gtggcggata 60
ttggcctccc gtgtgctcct gctcgcggtt ggcccaaaaa acaacccctt ggcgatggta 120
gccacggcac gcggtggttg gaagcactag ctccttaaaa accgctgtgg gcaagcctcg 180
tcgacgggga gcaaaagacc ctgacgcaag cgtcctcaca aag 223
<210> 4
<211> 223
<212> DNA
<213> LGT0306 Artificial Sequence (LGT0306 Artificial Sequence)
<400> 4
cgcaacgtcg ccaacaatcc cctcaccccc tgcataggga atagttaggg gtggcggata 60
ttggcctccc gtgtgctccc gctcgcggtt ggcccaaaaa acaacccctt ggcgatggta 120
gccacggcac gcggtggttg gaagcactag ctccttaaaa accgctgtgg gcaagcctcg 180
tcgacgggga gcaaaagacc ctgacgcaag cgtcctcaca aag 223
<210> 5
<211> 223
<212> DNA
<213> DBLGT0310 Artificial Sequence (DBLGT0310 Artificial Sequence)
<400> 5
cgcaacgtcg ccaacaatcc cctcaccccc tgcataggga atagtttggg gtggcggata 60
ttggcctccc gtgtgctccc gctcgcggtt ggcccaaaaa acagcccctt ggcgatggca 120
gccacggcac gcggtggttg gaagcattag ctcctaaaaa accgctgtgg gcaagcctcg 180
tcgacgggga gcaaaagacc ctgacgcaag cgtcctcaca aag 223
<210> 6
<211> 223
<212> DNA
<213> KPT0314 Artificial Sequence (KPT0314 Artificial Sequence)
<400> 6
cacaacgtcg ccaacaaccc cctcaccccc cgcaagggga acggcgaggg gtggcggata 60
ttggcctccc gtgcgcaccc gctcgcggtt ggcccaaaag acagccccct ggcgatggca 120
gccacggcac gcggtggttg gaagcactgg ctcctctaaa gccgctgtgg tcgagcctcg 180
tcgacgggga gcgaaagacc ctgacgcaag cgtcccaaca tag 223
<210> 7
<211> 223
<212> DNA
<213> NST0319 Artificial Sequence (NST0319 Artificial Sequence)
<400> 7
cgcaacgtcg ccaacaatcc cctcaccccc ctgcgaaggg aacggtgagg gttggcggat 60
attggcctcc cgtgtgcacc cgctcgcggt tggcccaaag aacagcccct tggcgatggc 120
agccacggca cgcggtggtt ggaagcactg gctcctcgaa ccgctgtggg cgagcctcgt 180
cgatggggag caatagaccc ctgatgcaat cgtcccaaca aag 223
<210> 8
<211> 212
<212> DNA
<213> JYG0324 Artificial Sequence (JYG0324 Artificial Sequence)
<400> 8
cacgtcgttg ccccccccaa ccccctcggg agttggatgg gacggatgat ggcctcccgt 60
gtgctcagtc acgcggttgg cataaatacc aagtcctcgg cgaccaacgc cacgacaatc 120
ggtggttgtc aaacctcggt ttcctgtcgt gcgcgcgtgt tgatcgagtg ctttcttaaa 180
caatgcgtgt cgatccgtcg atgctttcaa cg 212

Claims (8)

1. A primer for identifying the root and the adulterant of the root of the common knotweed is characterized by comprising a primer pair ITS2F and ITS3R, wherein the nucleotide sequence of a forward primer ITS2F is shown as SEQ ID No.1, and the nucleotide sequence of a reverse primer ITS3R is shown as SEQ ID No. 2.
2. The method for identifying the root and the adulterant of the herba pyrrosiae by the primer pair according to claim 1 is characterized by comprising the following specific steps of:
1) respectively extracting genome DNA of the root of the common knotweed and the mixed counterfeit product thereof;
2) respectively taking the genomic DNA of the hairy antenoron herb root and the mixed counterfeit product thereof extracted in the step 1) as amplification templates, and taking primer pairs ITS2F and ITS3R as primers to carry out PCR amplification, and respectively obtaining the amplified products of the hairy antenoron herb root and the mixed counterfeit product thereof;
3) respectively carrying out electrophoresis on each amplification product in the step 2) by using 3% agarose gel to detect the DNA purity of the amplification product, and carrying out bidirectional sequencing on the amplified DNA;
4) respectively carrying out proofreading and splicing on each sequencing peak map obtained in the step 3) by using CodonCode Aligner V6.0.2 software, removing primer regions, and then removing 5.8S and 28S regions at two ends of all measured sequences by using a CodonCode Aligner V6.0.2 based on an HMMer annotation method of a hidden Markov model, thereby respectively obtaining internal transcription spacer region ITS2 sequences of a torch root and a mixed counterfeit product thereof;
5) the ITS2 sequences of the torch flower roots and the mixed counterfeit products thereof and the sequences downloaded in GenBank are respectively compared and analyzed through MEGA6.0 software, the genetic distance between K2P species is calculated to establish NJtree, simultaneously the support rate of each branch is repeatedly checked by using bootstrap, the ITS2 secondary structures of the torch flower roots and the mixed counterfeit products thereof are respectively drawn by using pseudo viewer2.5 and combining the ITS2 sequences, and the torch flower roots and the mixed counterfeit products thereof are quickly and accurately identified by comparing the ITS2 secondary structures of the torch flower roots and the mixed counterfeit products thereof.
3. The method for identifying the root and the adulterant of the firecrackers by the primer pair of claim 2, wherein the ITS2F in the primer pair ITS2F and ITS3R is a forward primer, the nucleotide sequence of which is shown as SEQ ID No.1, and ITS3R is a reverse primer, the nucleotide sequence of which is shown as SEQ ID No. 2.
4. The method for identifying the root and the adulterant of the root of common Flowery herb according to the primer pair of claim 2, wherein the adulterant of the root of common Flowery herb comprises one or more of tripterygium wilfordii, celastrus angulatus, celastrus orbiculatus and cherokee rose root.
5. The method for identifying the root and the adulterant of the herba Humuli Scandentis according to the primer pair of claim 4, wherein the nucleotide sequence of ITS2 of the herba Humuli Scandentis is shown as SEQ ID No.3, the nucleotide sequence of ITS2 of Tripterygium wilfordii is shown as SEQ ID No.4, the nucleotide sequence of ITS2 of Tripterygium wilfordii is shown as SEQ ID No.5, the nucleotide sequence of ITS2 of Celastrus angulatus is shown as SEQ ID No.6, the nucleotide sequence of ITS2 of Celastrus orbiculatus is shown as SEQ ID No.7, and the nucleotide sequence of ITS2 of the Cherokee rose root is shown as SEQ ID No. 8.
6. The method for identifying the root and the mixed counterfeit product of the herba pyrrosiae as the primer pair according to claim 2, wherein the method for extracting the genome DNA of the root and the mixed counterfeit product of the herba pyrrosiae in the step 1) comprises the following steps: scrubbing the surfaces of the torch flower roots and the mixed counterfeit products thereof respectively by using 75% ethanol, crushing the surfaces into fine powder respectively, taking 60mg of each torch flower root and the mixed counterfeit products thereof respectively, adding liquid nitrogen respectively, and grinding for 5min for 30 times/s by using a full-automatic rapid ball mill to obtain samples of the torch flower roots and the mixed counterfeit products thereof respectively;
and (3) extracting total DNA of the samples of the torch flower roots and the adulterants thereof respectively by using the optimized plant DNA extraction kit according to the kit instructions to obtain DNA templates of the respectively extracted torch flower roots and the adulterants thereof.
7. The method for identifying the root and the adulterant of the herba pyrrosiae by the primer pair as claimed in claim 6, wherein the optimized plant DNA extraction kit comprises the following reagents: chloroform, a buffer solution GP1, frozen isopropanol, an adsorption column CB3, a buffer solution GD and a rinsing solution PW.
8. The method for identifying the root and the adulterant of the herba pyrrosiae by the primer pair according to claim 2, wherein the PCR amplification reaction program in the step 2) is as follows: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30s, and annealing at 56 ℃ for 30 s; extension at 72 ℃ for 2min for 40 cycles; extension at 72 ℃ for 10 min.
CN202111244598.5A 2021-10-26 2021-10-26 Primer and method for identifying root and mixed counterfeit product of herba Humuli Scandentis Pending CN113862390A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202111244598.5A CN113862390A (en) 2021-10-26 2021-10-26 Primer and method for identifying root and mixed counterfeit product of herba Humuli Scandentis

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202111244598.5A CN113862390A (en) 2021-10-26 2021-10-26 Primer and method for identifying root and mixed counterfeit product of herba Humuli Scandentis

Publications (1)

Publication Number Publication Date
CN113862390A true CN113862390A (en) 2021-12-31

Family

ID=78997464

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202111244598.5A Pending CN113862390A (en) 2021-10-26 2021-10-26 Primer and method for identifying root and mixed counterfeit product of herba Humuli Scandentis

Country Status (1)

Country Link
CN (1) CN113862390A (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114377052A (en) * 2022-01-14 2022-04-22 重庆市药研院制药有限公司 Preparation for regulating immune imbalance of diabetic nephropathy and preparation method thereof
CN115414405A (en) * 2022-09-30 2022-12-02 江苏省中医院 Traditional Chinese medicine composition, preparation thereof and application of traditional Chinese medicine composition in medicine for treating diabetic nephropathy

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110592261A (en) * 2019-10-11 2019-12-20 广州康和药业有限公司 Method for identifying DNA bar code of flaccid anemone/flaccid anemone plant
CN111349711A (en) * 2019-10-09 2020-06-30 广东医科大学 Method for rapidly identifying Kochiae and mixed counterfeit products thereof based on ITS2 sequence

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111349711A (en) * 2019-10-09 2020-06-30 广东医科大学 Method for rapidly identifying Kochiae and mixed counterfeit products thereof based on ITS2 sequence
CN110592261A (en) * 2019-10-11 2019-12-20 广州康和药业有限公司 Method for identifying DNA bar code of flaccid anemone/flaccid anemone plant

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
国家药典委员会: "中华人民共和国药典 2015年版 第四部", 中国农业大学出版社, pages: 134 - 385 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114377052A (en) * 2022-01-14 2022-04-22 重庆市药研院制药有限公司 Preparation for regulating immune imbalance of diabetic nephropathy and preparation method thereof
CN115414405A (en) * 2022-09-30 2022-12-02 江苏省中医院 Traditional Chinese medicine composition, preparation thereof and application of traditional Chinese medicine composition in medicine for treating diabetic nephropathy
CN115414405B (en) * 2022-09-30 2023-10-31 江苏省中医院 Traditional Chinese medicine composition, preparation thereof and application of traditional Chinese medicine composition in medicines for treating diabetic nephropathy

Similar Documents

Publication Publication Date Title
CN105696088B (en) A kind of double digestion simplifies genome two generations sequencing library construction method and matched reagent box
CN113862390A (en) Primer and method for identifying root and mixed counterfeit product of herba Humuli Scandentis
CN106754886B (en) The method for obtaining black fruit fructus lycii SSR primer is sequenced based on transcription
CN105063185B (en) The close linkage mark of wheat spike length main effect QTL and its application
CN103667275A (en) Oil-tea SSR molecular marker
CN108486266B (en) Molecular marker of corn chloroplast genome and application of molecular marker in variety identification
CN107893068A (en) A kind of method for building people TCRbetaCDR3 areas library
CN104630211B (en) A kind of construction method of Small RNA cDNA libraries
CN108754006B (en) Molecular marker closely linked with muskmelon vine stem length character gene SI/SI
KR20240046529A (en) Method for species identification of eukaryotes based on whole genome analysis and uses thereof
Løken et al. The Helvella corium species aggregate in Nordic countries–phylogeny and species delimitation
CN109536632B (en) Rhododendron dauricum SSR primer pair developed based on transcriptome sequencing, screening method and application
CN106498048A (en) A kind of QTL related to soybean nodulation number, SNP marker and application
Hong et al. The development of plant genome sequencing technology and its conservation and application in endangered gymnosperms
CN107365839A (en) A kind of primer and its application for animal in deer family identification
CN107828858A (en) A kind of method that exploitation beggar-ticks plant SSR primers are sequenced based on transcript profile
CN107365840A (en) Animal in deer family Rapid identification kit and its application based on DNA bar code
CN112080557A (en) DNA barcode-based method for identifying producing area of cordyceps sinensis
CN114410816B (en) Screening method and application of reference genes suitable for cassava disease resistance research
CN111235303B (en) Method for identifying cord-grass and spartina alterniflora
CN114752702A (en) Molecular marker BnCa-2C2 closely linked with rape calcium content trait QTL and application thereof
CN115843318A (en) Plant species identification method based on whole genome analysis and genome editing and application
CN108048596A (en) Bluish dogbane responses of drought stress gene EST-SSR primers and kit
CN109022610B (en) Molecular specificity marker primer of anoectochilus formosanus and identification method thereof
CN106755554A (en) Pine wood nematode SSR label primer is used for the purposes of pine wood nematode detection and the PCR detection method of pine wood nematode

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
CB02 Change of applicant information

Address after: 400000 Zhongke Future City, Xinshi Street, Changshou District, Chongqing

Applicant after: Chongqing Pharmaceutical Research Institute Pharmaceutical Co.,Ltd.

Address before: 400800 No. 303, Qingxi bridge, Donglin, Wansheng District, Chongqing, 10

Applicant before: Chongqing Pharmaceutical Research Institute Pharmaceutical Co.,Ltd.

CB02 Change of applicant information
CB02 Change of applicant information

Address after: No. 10 Bitong Road, Xinshi Street, Changshou District, Chongqing 401220

Applicant after: Chongqing Pharmaceutical Research Institute Pharmaceutical Co.,Ltd.

Address before: 400000 Zhongke Future City, Xinshi Street, Changshou District, Chongqing

Applicant before: Chongqing Pharmaceutical Research Institute Pharmaceutical Co.,Ltd.

CB02 Change of applicant information
WD01 Invention patent application deemed withdrawn after publication

Application publication date: 20211231

WD01 Invention patent application deemed withdrawn after publication