CN107190083A - Differentiate nucleotide sequence, specificity labeled primers and the method for yellow tea tree breed ' yellow leaf is precious ' - Google Patents
Differentiate nucleotide sequence, specificity labeled primers and the method for yellow tea tree breed ' yellow leaf is precious ' Download PDFInfo
- Publication number
- CN107190083A CN107190083A CN201710573523.9A CN201710573523A CN107190083A CN 107190083 A CN107190083 A CN 107190083A CN 201710573523 A CN201710573523 A CN 201710573523A CN 107190083 A CN107190083 A CN 107190083A
- Authority
- CN
- China
- Prior art keywords
- precious
- yellow
- tea tree
- yellow leaf
- dna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to a kind of nucleotide sequence, specificity labeled primers and method for differentiating yellow tea tree breed ' yellow leaf is precious '.The present invention differentiates the nucleotide sequence of ' yellow leaf is precious ' as shown in SEQ ID NO.1, and molecular specificity labeled primers are S34H7F3/S34H7R1.Using specificity labeled primers S34H7F3/S34H7R1, yellow tea tree breed ' yellow leaf is precious ' can quickly, accurately be differentiated by conventional PCR method.The primer combination S34H7F3/S34H7R1 of the present invention is ' yellow leaf is precious ' molecular specificity labeled primers, if testing sample tea tree breed ' yellow leaf is precious ', the specific DNA band of 856bp sizes can then be amplified, if other yellow tea tree breeds, it is then negative reaction, and then realizes quick, the accurate discriminating of ' yellow leaf is precious ' sample.This method is easy to operate, result is accurate, and time-consuming short, can complete within 1st.
Description
Technical field
The present invention relates to a kind of nucleotide sequence for differentiating yellow tea tree breed ' yellow leaf is precious ', specificity labeled primers, with
And a kind of method that quick discriminating is carried out to ' yellow leaf is precious ' using the specific primer.
Background technology
In growth and development process, some tea tree breeds cause its tender leaf obvious due to different degrees of chlorophyll missing
Yellow, or even albefaction, this kind of tea are referred to as yellow tea.Compared with general tea tree, yellow tea has the amino acid of higher level.
Reduced blood pressure there are some researches show theanine has, improve the effects such as memory, enhancing are immunized.Therefore, yellow tea is generally treasure in tea
Product, with very high economic value.However, the problem of market of yellow tea is also faced with many severe：(1) due to genetic background
It is unclear, disunity is named, causes yellow tea species on the market more chaotic；(2) in order to chase maximum benefit, past many
Nian Li, the characteristics of some illegal retailers are difficult to differentiate using tea tree breed, mixes the spurious with the genuine, shoddy phenomenon happens occasionally,
No small economic loss is caused to tea grower and consumer.These present situations are healthy for reasonable utilization, the industrialization of yellow tea kind
Development and protection of resources bring extreme difficulties.Therefore, corresponding quick, accurate mirror is set up for different yellow tea tree breeds
Other method is very necessary.
The phenotypic characteristic of yellow tea is quite similar, and shape facility is easily influenceed and normal by habitat, weather, physiological status etc.
The deviation on subjective differentiate is often resulted in, therefore, is only difficult to quick and precisely identify yellow tea tree breed by trickle phenotypic difference.With
The development of modern science and technology, DNA molecular marker technology make up and overcome traditional form discrimination method some defects and
Problem, has become the important means that plant auxiliary differentiates.In recent years, the common molecular labelling technique of some PCR-baseds is such as
RAPD (Random amplified polymorphic DNA, randomly amplified polymorphic DNA) (Chen Zhidan etc., the south of Fujian Province oolong tea
Tea Germplasm RAPD fingerprint map constructions and analysis of genetic diversity, Molecular Plant Breeding, 2012,10 (6)：731-
739), ISSR (Inter-simple sequence repeat, Inter-simple sequence repeat) and SRAP
(sequence related amplified polymorphism, SRAP) (is marked using SRAP and ISSR
Score and analyse the genetic diversity of Tea plant Germplasms in Guangdong Province, nuclear agricultural science report 2010,24 (5)：948-955)、SSR(Simple
Sequence repeats, simple repeated sequence) (Zhang Mingze, SSR points of the 60 parts of Tea Germplasm genetic diversities in the south of Guizhou Province
Analysis, northwest Botany Gazette, 2016,36 (6)：1117-1124) with SCoT (Start codon targeted
Polymorphism, target initiation codon is polymorphic) (genetic diversity of Chen Xi etc., SCoT labeled analysis Shaanxi Resources of Tea Plant,
Tea science, 2016,36 (2)：131-138) Genetic Diversity of Germplasm in succession for tea tree is studied, still, these points
Sub- labelling technique be directly used in tea tree breed Molecular Identification research seldom, moreover these labelling techniques used for sequence compared with
Short general random primer or the random combine of primer, the DNA fingerprinting of its pcr amplification product are not only complicated, repeated
Difference, and specificity is not high, therefore be not suitable for being directly used in cultivar identification.(one kind builds tea tree DNA fingerprinting to Sun Weijiang etc.
Method, the A of patent application publication CN 104651515) based on 12 ISSR universal primers tea tree breed is entered performing PCR expand
Increase, band is copied by 0,1, DNA fingerprinting information is handled and is converted into by a plurality of Primer Analysis result combination by planar bar code technology
Two-dimension code pattern, then carries out the discriminating of tea tree breed by the comparison of two-dimension code pattern.Some scholars based on same principle,
Enter performing PCR amplification using three pairs of SSR universal primer whitening tea tree breeds, be then based on the 0 of DNA fingerprinting, 1 and copy information
Build tea tree breed Quick Response Code identification information (Rapid identification difference albino tea tree breed molecular labeling combination, method and should
With the A of patent application publication CN 106480224).These researchs provide a kind of think of for the identification of tea tree breed with classification
Road, but this kind of discrimination method has very big defect：(1) it is cumbersome.Such method needs to use multipair primer to treat
Test sample product enter performing PCR amplification, and then carrying out 0,1 to obtained DNA fingerprint figure copies band, will obtain data and is combined, finally leads to
Cultivar identification could be realized by crossing Quick Response Code identification；(2) accuracy is poor.The common moleculars such as ISSR and SSR are marked to PCR reaction conditions
Compare sensitive, therefore, its DNA fingerprinting repeatability is relatively poor, once DNA fingerprinting information changes, it is easy to
Quick Response Code is caused to differentiate failure or judge by accident；Copied in addition, carrying out 0,1 with during, because DNA fingerprinting is more multiple
It is miscellaneous, and electrophoretic band background difference, it is easy to there is the phenomenon of artificial data statistics mistake, in turn result in discriminating failure or
Person differentiates mistake；(3) take longer.Such method be related to the PCR amplifications of a plurality of primer, electrophoresis detection, DNA fingerprinting 0,
1, which copies band, data combination and Quick Response Code, compares analysis, and the whole experiment process time is long.Therefore, existing tea tree product how to be improved
The deficiency of discrimination method is planted, the task of top priority is had become.
Specific molecular marker technology is on the basis of common molecular mark, using the sequencing of specific DNA fragment, according to two
Terminal sequence designs the primer of a length of 18~24 base of a pair of sequences, and specific amplification is carried out under higher annealing temperature.It draws
Thing has very high selectivity, can exclude the competition between random primer binding site, realizes the specificity expansion of DNA sequence dna
Increase.Therefore, this technology is a kind of sufficiently stable molecular marking technique, is had in plant germplasm identification before application well
Scape.This method has the characteristics of quick, easy, cost is low, testing result is accurate, not yet there is specific molecular marker so far
The research report differentiated applied to yellow tea tree breed ' yellow leaf is precious '.
The content of the invention
First purpose of the present invention is to differentiate that yellow tea tree breed is ' yellow there is provided one kind in view of the shortcomings of the prior art
Leaf is precious ' characteristic nucleotide sequence.
The present invention utilizes round pcr, based on SCoT molecular labelings, by a large amount of screening experiments, obtains ' yellow leaf is precious ' special
Property DNA fragmentation.By gel extraction, TA clones, sequencing, the DNA sequence dna is obtained.Particular sequence is：
ACCATGGCTACCACCGCAGAATAGAGGCCAACTCAAGGCAAATCACCACAATTCTAAAACTTGGCTCTCCTCGGTTG
GTCAAAGAAGTTCAAAAGCTGATGAGAATGGCCGTCGCACTCAACAACTTTATCAACCGTTTCACAGATCGCTGCCG
ACAATTCTTTCACACATTTCGGTAGAACAAAGCTTTTGAATGGACCCCTAAGTGCCAGGTCGCTCTGGACGGCTTGA
AAACTTACCTCCGATCAGTACCACTCTTGGTAACCCCCTCGGCAGGCGATCCGCTCATTTTGTATCTTGCAGTATCT
GACTGGGCGGTCAGTGCTGTACTTTTAACGAAAGAACTCGGGGAGCAACGACCAGTTTACTATGTAAGAAAGGCAAT
GGTTGATACTGAAACACGTTATCTACCACTGGAAAAGCTCATCCTTGCTCTCGTGATGGCTGCAAGAAAACTGATGC
ATTACTTTGAAGGGCATGCCATAGGGGTAATAACAGACTATCCTCTCCGGTCAGCGCTCCATAGCGGGGAAGCATCA
GGGCGAGTTTCGAAATGGGCTTTGGAACTCGGCCAGTATGATATTTGGTTTTTGCCTAGAACTAACATCAAAGGGCA
AGTGCTCGCCGACTTGTAGTCGAATTCACGAGATAACATGCCGACTTTAACTCTGATCAAGTACAACCTAAACCCAA
TTGGCGAATATATATTGGAGACATTTGGCAAATGTACTGTGACGGGTCATCCAACTAGCGTGACAGTAGGGCAGGTG
TAGAAATCATGACCCCCGAAGGGGCAATAATCGAGCAGGCGGTCAAACTGGGCTTTGATGCATCAAATAATGAGGCC
AAATACGAAGCATTGCTAACCGGCCTTCGCAACACACTTCACCTTGGTATGCGGTG GTAGCCATGGT, such as SEQ ID
Shown in NO.1；
It is ' yellow that second object of the present invention is to provide the discriminating based on above-mentioned ' yellow leaf is precious ' specific nucleotide sequences design
Leaf is precious ' specificity labeled primers (S34H7F3/S34H7R1), the primer sequence is as follows：
Sense primer S34H7F3:5 '-ACTTGGCTCTCCTCGGTTG-3 ', as shown in SEQ ID NO.2；
Anti-sense primer S34H7R1:5 '-ACCATGGCTACCACCGCATA-3 ', as shown in SEQ ID NO.3；
Above-mentioned specific primer (S34H7F3/S34H7R1), with very high specificity.Drawn using the primer as PCR
Thing, performing PCR amplification, primer combination (S34H7F3/S34H7R1) are entered to ' yellow leaf is precious ' and its similar tea tree breed genomic DNA
Only reacted with ' yellow leaf precious ' sample DNA, obtain the DNA fragment specific of 856bp sizes, and with other tea tree breed samples
Do not react.For further checking specificity labeled primers S34H7F3/S34H7R1 stability, combined with the primer to coming
Enter performing PCR amplification from the genomic DNA of 10 difference ' yellow leaf is precious ' individuals, as a result owning ' yellow leaf is precious ' sample can amplify
856bp size specific bands, illustrate that the primer has very high stability and application.With the specific primer, pass through
Standard PCR reaction can quick and precisely identify ' yellow leaf is precious ' sample.
Third object of the present invention is to provide one kind using above-mentioned specificity labeled primers to tea tree breed ' yellow leaf is precious '
The method for carrying out quick discriminating.Methods described is：The primer combination (S34H7F3/S34H7R1) designed with the present invention is specificity
Amplimer, using tea tree plant sample DNA to be measured as amplification template, enters performing PCR amplification, is detected through agarose gel electrophoresis, if
There is the specific DNA band that molecular weight is 856bp sizes in electrophoresis result, then tea tree plant sample to be measured is ' yellow leaf is precious ', instead
Be not then.
Specifically, methods described is as follows：
(1) sample total DNA is extracted：The fresh blade 100mg of clip tea tree plant sample to be measured is put into mortar, and liquid is added immediately
Nitrogen is ground to powder, then, and (Shanghai life work bioengineering is purchased from using UNIQ-10 pillar plant genome DNA extraction agents box
Co., Ltd) sample total DNA is extracted, gained DNA carries out electrophoresis detection with 1% agarose gel, and is examined with ultraviolet specrophotometer
Concentration is surveyed, 50ng/ μ l are diluted to.
(2) PCR is expanded：Testing sample DNA using step (1) extraction is template, with the molecular specificity labeled primers
(S34H7F3/S34H7R1) as amplimer, performing PCR amplification is entered.
PCR reaction systems (μ l of cumulative volume 20)：Sense primer S34H7F3 (10 μM) 1 μ l, anti-sense primer S34H7R1 (10 μ
M) 1 μ l,The μ l of PCR SuperMix (ordering in Beijing Quanshijin Biotechnology Co., Ltd) 10, template DNA
(50ng/ μ l) 1 μ l, ddH2O 7μl。
PCR reacts setting program：94 DEG C of pre-degeneration 5min；32 circulations (94 DEG C of denaturation 50s, 61 DEG C of anneal 50s, 72 DEG C
Extend 1.5min)；72 DEG C of extension 10min.
(3) electrophoresis detection：The μ l of step (2) PCR primer 10 are taken, electrophoresis detection is carried out with 1.5 ﹪ Ago-Gels, using solidifying
Glue imaging system is taken pictures detection.If the DNA bands that molecular weight is 856bp sizes occurs in electrophoretogram passage, testing sample is ' yellow
Leaf is precious ', it is on the contrary then be not.
Main beneficial effect of the invention is shown as：S34H7F3/S34H7R1 is ' yellow leaf is precious ' specificity labeled primers, if
Other tea tree breeds, are negative reaction, can realize quick, the accurate discriminating of tea tree breed ' yellow leaf is precious '.This method is easy, accurate
Really, it is and time-consuming short, it can complete within 1st.
Brief description of the drawings
Fig. 1 is, according to conventional PCR method, ' yellow leaf is precious ' and its similar yellow tea tree breed to be carried out with SCoT marks
PCR is expanded, by a large amount of screening experiments, electrophoretogram (the signified bar of arrow with ' yellow leaf is precious ' characteristic DNA bands of acquisition
Band is ' yellow leaf is precious ' distinctive band, and molecular weight is 914bp), wherein M is DNA molecular amount standard Trans2K DNA Marker
(being purchased from Beijing Quanshijin Biotechnology Co., Ltd)；Passage 1-17 is respectively：Gold bud, Su Yuhuang, Anji white tea, middle yellow 1
Number, middle yellow No. 2, middle yellow No. 3, precious yellow leaf, middle tea 211, Yu Jinxiang, Cold boiled chicken hat, white No. 1 of scape, white No. 2 of scape, balcony white tea, Yue Xiang
White tea, Anji yellow tea, golden chrysanthemum, floral leaf.
Fig. 2 is the characteristic nucleotide sequence of ' yellow leaf precious ' of the present invention and to ' yellow leaf is precious ' specific primer
The S34H7F3 and S34H7R1 location drawing, left side is 5 ' ends, and right side is 3 ' ends, and wherein black portions are specific primer
The sequence fragment size and location of S34H7F3/S34H7R1 amplifications；
Fig. 3 is the molecular specificity labeled primers S34H7F3/S34H7R1 designed with the present invention to 17 yellow tea trees
Kind DNA enters the electrophoretogram of performing PCR amplification, and wherein M is that DNA molecular amount standard Trans2K DNA Marker (are purchased from Beijing complete
Shi Jin Bioisystech Co., Ltd)；Passage 1-17 is respectively：Gold bud, Su Yuhuang, Anji white tea, middle yellow No. 1, middle yellow No. 2,
Middle yellow No. 3, precious yellow leaf, middle tea 211, Yu Jinxiang, Cold boiled chicken hat, white No. 1 of scape, white No. 2 of scape, balcony white tea, more township's white tea, Anji it is yellow
Tea, golden chrysanthemum, floral leaf.Electrophoretogram shows that only ' yellow leaf is precious ' sample amplification goes out the specific DNA bar that molecular weight is 856bp sizes
Band.
Fig. 4 is the molecular specificity labeled primers S34H7F3/S34H7R1 designed with the present invention to 10 parts of difference ' yellow leafs
It is precious ' DNA of individual enters the electrophoretogram of performing PCR amplification.Wherein, M is that DNA molecular amount standard Trans2K DNA Marker (are purchased from
Beijing Quanshijin Biotechnology Co., Ltd)；Passage 1-10：10 differences ' yellow leaf is precious ' sample is corresponded to, numbering is respectively
HYB1-HYB10。
Embodiment
The present invention more can fast and accurately differentiate the related sample of yellow tea tree breed ' yellow leaf is precious ' on a molecular scale
Product.By following examples, the present invention will be further described, but protection scope of the present invention is not limited to that：
Embodiment 1：The preparation of ' yellow leaf is precious ' characteristic nucleotide sequence
1. sample total DNA is extracted
The fresh blade 100mg of clip tea tree plant sample to be measured is put into mortar, liquid nitrogen grinding is added immediately to powder, so
Afterwards, sample is extracted using UNIQ-10 pillar plant genome DNA extraction agents box (being purchased from Shanghai Sheng Gong bioengineering Co., Ltd)
Product STb gene, gained DNA carries out electrophoresis detection with 1% agarose gel, and uses UV spectrophotometer measuring concentration, is diluted to
50ng/μl。
2.SCoT-PCR are expanded, electrophoresis detection
Enter performing PCR amplification to yellow tea tree sample DNA to be measured with SCoT molecular labelings, primer gives birth to the biological work of work by Shanghai
Journey Co., Ltd synthesizes, reaction system (μ l of cumulative volume 20)：PCR SuperMix (are purchased from the full formula gold in Beijing
Bioisystech Co., Ltd) 10 μ l, the μ l of primer (10 μM) 1, template DNA (50ng/ μ l) 1 μ l, ddH2O 8μl。
PCR expands setting program：94 DEG C of pre-degeneration 5min；32 circulations (94 DEG C of denaturation 50s, 55 DEG C of anneal 50s, 72 DEG C
Extend 1.5min)；72 DEG C of extension 10min.
By a large amount of screening experiments, there is the DNA fingerprinting (see Fig. 1) of ' yellow leaf is precious ' signature band, arrow
The band (molecular weight is 914bp, passage 7) of mark, is ' yellow leaf is precious ' the specific DNA band filtered out.As Fig. 1 (in figure, leads to
Road M is DNA molecular amount standard Trans2K DNA Marker；Passage 1~17 is different yellow tea tree breeds, and specific numbering is shown in attached
Figure explanation) shown in, only ' yellow leaf precious ' (passage 7) has band appearance in molecular weight 914bp positions, and other yellow tea tree breeds
There is no band appearance in molecular weight 914bp positions.Therefore, this band is the characteristic nucleotide sequence of ' yellow leaf is precious '.
3. sequencing
' yellow leaf the is precious ' DNA fragment specific (arrow meaning fragment in Fig. 1) obtained to above-mentioned screening carries out gel extraction,
PCR primer purification kit (Beijing health is by century) purifying is used to cut DNA fragmentation.Then purified DNA fragmentation is connected
ArriveOn-Blunt simple cloning vector (being purchased from Beijing Quanshijin Biotechnology Co., Ltd), turn
Change into competent escherichia coli cell, after testing after, by the clone containing aim sequence send biotech firm be sequenced (the auspicious sound in Shanghai
Bio tech ltd), obtain the nucleotides composition as shown in SEQ ID NO.1 and arrange.
Embodiment 2：Prepared by ' yellow leaf is precious ' specificity labeled primers, PCR amplifications, electrophoresis detection
On the basis of sequencing obtains ' yellow leaf is precious ' specific DNA sequences, design obtains specificity labeled primers
S34H7F3/S34H7R1 (being respectively shown in SEQ ID NO.2, SEQ ID NO.3).Primer sequence is by the auspicious sound biotechnology in Shanghai
Co., Ltd synthesizes.Then, different yellow tea tree breed DNA are entered using designed primer combination S34H7F3/S34H7R1
Performing PCR is expanded.
PCR reaction systems (μ l of cumulative volume 20)：Sense primer S34H7F3 (10 μM) 1 μ l, anti-sense primer S34H7R1 (10 μ
M) 1 μ l,The μ l of PCR SuperMix (ordering in Beijing Quanshijin Biotechnology Co., Ltd) 10, template
DNA (50ng/ μ l) 1 μ l, ddH2O 7μl。
PCR response procedures：94 DEG C of pre-degeneration 5min；32 circulations (94 DEG C of denaturation 50s, 61 DEG C of annealing 50s, 72 DEG C of extensions
1.5min)；72 DEG C of extension 10min.
Electrophoresis detection is carried out to PCR primer using 1.5 ﹪ Ago-Gels, (in figure, passage M is electrophoretogram as shown in Figure 3
DNA molecular amount standard Trans2K DNA Marker；Passage 1~17 is different yellow tea tree breeds, and specific numbering is shown in that accompanying drawing is said
It is bright).From figure 3, it can be seen that only ' yellow leaf is precious ' (passage 7) can amplify the specific DNA band that molecular weight is 856bp sizes
(the specific DNA band particular sequence information is shown in Fig. 2 density bullets part), and other yellow tea tree breeds are not expanded and taken the post as
What band, this shows that the specific primer of the present invention has high selectivity, therefore can be used for the fast of ' yellow leaf is precious ' sample
Speed differentiates.
Embodiment 3：Specificity labeled primers S34H7F3/S34H7R1 is further verified
In order to further verify that the primer of this patent exploitation combines S34H7F3/S34H7R1 stability and application,
Performing PCR augmentation detection, electrophoretogram are entered to the sample DNA of 10 parts of differences ' yellow leaf is precious ' individual using primer S34H7F3/S34H7R1
(in figure, M is DNA molecular amount standard Trans2K DNA Marker as shown in Figure 4；Passage 1-10：Correspond to ' yellow leaf is precious ' sample
Product, numbering HYB1-HYB10).Fig. 4 shows that all ' yellow leaf is precious ' samples can amplify the specific DNA band of 856bp sizes,
Therefore, specificity labeled primers S34H7F3/S34H7R1 of the invention has very high stability, can be used for yellow tea tree product
Plant the quick discriminating of ' yellow leaf is precious '.
SEQUENCE LISTING
<110>Tea Inst., Chinese Academy of Agricultural Sciences
<120>Differentiate nucleotide sequence, specificity labeled primers and the method for yellow tea tree breed ' yellow leaf precious '
<130> 1
<160> 3
<170> PatentIn version 3.3
<210> 1
<211> 914
<212> DNA
<213>It is artificial synthesized
<400> 1
accatggcta ccaccgcaga atagaggcca actcaaggca aatcaccaca attctaaaac 60
ttggctctcc tcggttggtc aaagaagttc aaaagctgat gagaatggcc gtcgcactca 120
acaactttat caaccgtttc acagatcgct gccgacaatt ctttcacaca tttcggtaga 180
acaaagcttt tgaatggacc cctaagtgcc aggtcgctct ggacggcttg aaaacttacc 240
tccgatcagt accactcttg gtaaccccct cggcaggcga tccgctcatt ttgtatcttg 300
cagtatctga ctgggcggtc agtgctgtac ttttaacgaa agaactcggg gagcaacgac 360
cagtttacta tgtaagaaag gcaatggttg atactgaaac acgttatcta ccactggaaa 420
agctcatcct tgctctcgtg atggctgcaa gaaaactgat gcattacttt gaagggcatg 480
ccataggggt aataacagac tatcctctcc ggtcagcgct ccatagcggg gaagcatcag 540
ggcgagtttc gaaatgggct ttggaactcg gccagtatga tatttggttt ttgcctagaa 600
ctaacatcaa agggcaagtg ctcgccgact tgtagtcgaa ttcacgagat aacatgccga 660
ctttaactct gatcaagtac aacctaaacc caattggcga atatatattg gagacatttg 720
gcaaatgtac tgtgacgggt catccaacta gcgtgacagt agggcaggtg tagaaatcat 780
gacccccgaa ggggcaataa tcgagcaggc ggtcaaactg ggctttgatg catcaaataa 840
tgaggccaaa tacgaagcat tgctaaccgg ccttcgcaac acacttcacc ttggtatgcg 900
gtggtagcca tggt 914
<210> 2
<211> 19
<212> DNA
<213>It is artificial synthesized
<400> 2
acttggctct cctcggttg 19
<210> 3
<211> 20
<212> DNA
<213>It is artificial synthesized
<400> 3
accatggcta ccaccgcata 20
Claims (5)
1. one kind differentiates the nucleotide sequence of yellow tea tree breed ' yellow leaf is precious ', it is characterised in that the nucleotide sequence, such as SEQ
Shown in ID NO.1.
2. drawn based on a kind of molecular specificity marker for the nucleotide sequence design for differentiating ' yellow leaf is precious ' as claimed in claim 1
Thing, it is characterised in that the specific primer sequence is as follows：
Sense primer S34H7F3:5 '-ACTTGGCTCTCCTCGGTTG-3 ', as shown in SEQ ID NO.2；
Anti-sense primer S34H7R1:5 '-ACCATGGCTACCACCGCATA-3 ', as shown in SEQ ID NO.3.
3. the method that one kind differentiates ' yellow leaf is precious ', it is characterised in that using the primer S34H7F3/S34H7R1 described in claim 2
As specificity amplification primer, using tea tree breed genomic DNA to be measured as template, standard PCR amplification is carried out, amplified production is entered
Row electrophoresis detection, if the specific DNA band of 856bp sizes occurs in electrophoresis result, tea tree plant sample to be measured is ' yellow leaf
It is precious '；It is on the contrary then be not.
4. method as claimed in claim 3, it is characterised in that described PCR amplification system (cumulative volume is 20 μ l)：Draw upstream
Thing S34H7F3 (10 μM) 1 μ l, anti-sense primer S34H7R1 (10 μM) 1 μ l,The μ l of PCR SuperMix 10, mould
Plate DNA (50ng/ μ l) 1 μ l, ddH2O 7μl。
5. method as claimed in claim 3, it is characterised in that described PCR amplification programs are：PCR response procedures：94 DEG C pre-
It is denatured 5min；32 circulations (94 DEG C of denaturation 50s, 61 DEG C of annealing 50s, 72 DEG C of extension 1.5min)；72 DEG C of extension 10min.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710573523.9A CN107190083B (en) | 2017-07-14 | 2017-07-14 | Differentiate that yellow tea tree breed ' yellow leaf is precious ' nucleotide sequence, specificity labeled primers and method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710573523.9A CN107190083B (en) | 2017-07-14 | 2017-07-14 | Differentiate that yellow tea tree breed ' yellow leaf is precious ' nucleotide sequence, specificity labeled primers and method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107190083A true CN107190083A (en) | 2017-09-22 |
| CN107190083B CN107190083B (en) | 2018-07-06 |
Family
ID=59882124
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710573523.9A Expired - Fee Related CN107190083B (en) | 2017-07-14 | 2017-07-14 | Differentiate that yellow tea tree breed ' yellow leaf is precious ' nucleotide sequence, specificity labeled primers and method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107190083B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108220471A (en) * | 2018-01-25 | 2018-06-29 | 中国农业科学院茶叶研究所 | Differentiate the molecular specificity labeled primers and its discrimination method of national improved tea variety Fuyun No.6 |
| CN110669866A (en) * | 2019-11-14 | 2020-01-10 | 安徽农业大学 | InDel marker for identifying purple tea tree varieties and combination and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20140120598A (en) * | 2013-04-03 | 2014-10-14 | 이영환 | Method for manufacturing drink using fermented tea |
| CN106480224A (en) * | 2016-12-28 | 2017-03-08 | 中国农业科学院茶叶研究所 | The molecular marker combination of Rapid identification difference albino tea tree breed, method and application |
-
2017
- 2017-07-14 CN CN201710573523.9A patent/CN107190083B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20140120598A (en) * | 2013-04-03 | 2014-10-14 | 이영환 | Method for manufacturing drink using fermented tea |
| CN106480224A (en) * | 2016-12-28 | 2017-03-08 | 中国农业科学院茶叶研究所 | The molecular marker combination of Rapid identification difference albino tea tree breed, method and application |
Non-Patent Citations (1)
| Title |
|---|
| 黄茶育种协作组: "特异优质茶树新品种"中黄1号"选育碱", 《中国茶叶》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108220471A (en) * | 2018-01-25 | 2018-06-29 | 中国农业科学院茶叶研究所 | Differentiate the molecular specificity labeled primers and its discrimination method of national improved tea variety Fuyun No.6 |
| CN108220471B (en) * | 2018-01-25 | 2020-02-18 | 中国农业科学院茶叶研究所 | Molecular specific marker primer for identifying national-grade tea tree improved variety Fuyun No. 6 and identification method thereof |
| CN110669866A (en) * | 2019-11-14 | 2020-01-10 | 安徽农业大学 | InDel marker for identifying purple tea tree varieties and combination and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107190083B (en) | 2018-07-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103233065B (en) | Molecular specific marker primers for No. 4 and No.32 of an improved variety Changlin of Camellia oleifera and an identification method | |
| CN108034754B (en) | Method for identifying new variety of purple tea trees by SSR fingerprint | |
| CN107586867A (en) | Thin shell mountain pecan Peach cultivars Pawnee characteristic sequence, labeled primer and authentication method | |
| CN107557434A (en) | Thin shell mountain pecan Peach cultivars Van Deman characteristic sequence, labeled primer and authentication method | |
| CN105154529A (en) | Molecular specific marker primer and identification method for fine varieties of camellia oleifera | |
| CN104946640A (en) | Specificity labeling primer for tea-oil tree improved variety Chang Lin 18 and detection method | |
| CN107190083B (en) | Differentiate that yellow tea tree breed ' yellow leaf is precious ' nucleotide sequence, specificity labeled primers and method | |
| CN103205424B (en) | Molecule specificity marker primer and identification method of improved variety of camellia oleifera Changlin Number 55 | |
| CN104673790B (en) | The molecular specificity labeled primers and authentication method of the long woods of oil tea breeding No. 18 | |
| CN105087813A (en) | Ginkgo biloba variety molecular detection primer combination and ginkgo biloba variety detection method | |
| CN107586866A (en) | Thin shell mountain pecan Peach cultivars Moore characteristic sequence, labeled primer and authentication method | |
| CN107574257B (en) | Core SSR primer and kit for identifying pea variety and purity | |
| CN105861711B (en) | Opium poppy species specificity genetic marker detection architecture | |
| CN104946641A (en) | Specificity labeling primer for camellia oleifera improved varieties changlin number three and twenty one and detection method | |
| CN105420354B (en) | Conventional rice variety Huaihe River rice No. 5 and Huaihe River rice No. 18 identification methods based on InDel label | |
| CN104611329B (en) | Flowering Cherry Cultivars " Song Yue " and the molecular specificity labeled primers of " root tuber of aromatic turmeric " | |
| CN107385052A (en) | For identifying STR primers and its application of Eucalyptus clone | |
| CN107190082B (en) | For differentiating the molecular specificity labeled primers and its discrimination method of national improved tea variety ' meeting frost ' | |
| CN107354222A (en) | For identifying STR primers, PCR kit and the method for Eucalyptus clone | |
| CN102586459B (en) | Method for identifying varieties of Chinese cabbage by using composite expressed sequence tag-simple sequence repeat (EST-SSR) marker | |
| CN104975010A (en) | High-specificity molecular specific labeled primers of oil-tea camellia fine breed Changlin No. 21 and detection method thereof | |
| CN106399566B (en) | A set of combination of SSR primer and its application for being suitable for cultivating mung bean variety identification | |
| CN104593367B (en) | The specificity labeled primers of red rich, the former brave tail in city of Flowering Cherry Cultivars and the open country younger sister back of the body | |
| CN108330164A (en) | Characteristic sequence, primer and the identification method of thin shell mountain pecan Peach cultivars Moore | |
| CN104560977B (en) | The molecular specificity labeled primers and detection method of Flowering Cherry Cultivars " the open country younger sister back of the body " |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20180706 Termination date: 20200714 |