CN107190083B - Differentiate that yellow tea tree breed ' yellow leaf is precious ' nucleotide sequence, specificity labeled primers and method - Google Patents

Differentiate that yellow tea tree breed ' yellow leaf is precious ' nucleotide sequence, specificity labeled primers and method Download PDF

Info

Publication number
CN107190083B
CN107190083B CN201710573523.9A CN201710573523A CN107190083B CN 107190083 B CN107190083 B CN 107190083B CN 201710573523 A CN201710573523 A CN 201710573523A CN 107190083 B CN107190083 B CN 107190083B
Authority
CN
China
Prior art keywords
yellow
precious
tea tree
yellow leaf
primer
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Fee Related
Application number
CN201710573523.9A
Other languages
Chinese (zh)
Other versions
CN107190083A (en
Inventor
陈亮
徐艳霞
姚明哲
龚伟伟
沈思言
陈玮
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Tea Research Institute Chinese Academy of Agricultural Sciences
Original Assignee
Tea Research Institute Chinese Academy of Agricultural Sciences
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Tea Research Institute Chinese Academy of Agricultural Sciences filed Critical Tea Research Institute Chinese Academy of Agricultural Sciences
Priority to CN201710573523.9A priority Critical patent/CN107190083B/en
Publication of CN107190083A publication Critical patent/CN107190083A/en
Application granted granted Critical
Publication of CN107190083B publication Critical patent/CN107190083B/en
Expired - Fee Related legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Immunology (AREA)
  • Mycology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Botany (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

Differentiate that yellow tea tree breed ' yellow leaf is precious the present invention relates to a kind of ' nucleotide sequence, specificity labeled primers and method.The present invention differentiates the nucleotide sequence of ' yellow leaf is precious ' as shown in SEQ ID NO.1, molecular specificity labeled primers S34H7F3/S34H7R1.Using specificity labeled primers S34H7F3/S34H7R1, yellow tea tree breed ' yellow leaf treasured can quickly, accurately be differentiated by conventional PCR method '.The primer combination S34H7F3/S34H7R1 of the present invention is ' yellow leaf is precious ' molecular specificity labeled primers, sample to be tested is if tea tree breed ' yellow leaf treasured ', the specific DNA band of 856bp sizes can then be amplified, if other yellow tea tree breeds, it is then negative reaction, and then realizes quick, the accurate discriminating of ' yellow leaf is precious ' sample.This method is easy to operate, result is accurate, and time-consuming short, can be completed within 1st.

Description

Differentiate that yellow tea tree breed ' yellow leaf is precious ' nucleotide sequence, specificity labeled primers And method
Technical field
Differentiate that yellow tea tree breed ' yellow leaf is precious the present invention relates to a kind of ' nucleotide sequence, specificity labeled primers, with And a kind of quick mirror method for distinguishing is carried out to ' yellow leaf precious ' using the specific primer.
Background technology
In growth and development process, some tea tree breeds cause its tender leaf apparent due to different degrees of chlorophyll missing Yellow or even albefaction, this kind of tea are referred to as yellow tea.Compared with general tea tree, yellow tea has the amino acid of higher level. Some researches show that theanine have reduce blood pressure, improves memory, enhancing be immunized and other effects.Therefore, yellow tea is mostly precious in tea Product have very high economic value.However, the market of yellow tea is also faced with the problem of many sternnesses：(1) due to genetic background It is unclear, disunity is named, causes yellow tea type on the market more chaotic；(2) in order to chase maximum benefit, past more The characteristics of Nian Li, some illegal retailers are not easy to differentiate using tea tree breed, the phenomenon that mixing the spurious with the genuine, adulterating, happen occasionally, No small economic loss is caused to tea grower and consumer.These present situations are healthy for reasonable utilization, the industrialization of yellow tea kind Development and protection of resources bring extreme difficulties.Therefore, corresponding quick, accurate mirror is established for different yellow tea tree breeds Other method is very necessary.
The phenotypic characteristic of yellow tea is quite similar, and shape feature is easily influenced and normal by habitat, weather, physiological status etc. The deviation on subjective differentiate is often resulted in, therefore, is only difficult to quick and precisely identify yellow tea tree breed by subtle phenotypic difference.With The development of modern science and technology, DNA molecular marker technology make up and overcome traditional form discrimination method some defects and Problem has become the important means that plant auxiliary differentiates.In recent years, the common molecular labelling technique of some based on PCR is such as RAPD (Random amplified polymorphic DNA, randomly amplified polymorphic DNA) (Chen Zhidan etc., the south of Fujian Province oolong tea Tea Germplasm RAPD fingerprint map constructions and analysis of genetic diversity, Molecular Plant Breeding, 2012,10 (6)：731- 739), ISSR (Inter-simple sequence repeat, Inter-simple sequence repeat) and SRAP (sequence related amplified polymorphism, related sequence amplified polymorphism) (is marked using SRAP and ISSR It scores and analyses the genetic diversity of Tea plant Germplasms in Guangdong Province, nuclear agricultural science report 2010,24 (5)：948-955)、SSR(Simple Sequence repeats, simple repeated sequence) (Zhang Mingze, SSR points of the 60 parts of Tea Germplasm genetic diversities in the south of Guizhou Province Analysis, northwest Botany Gazette, 2016,36 (6)：1117-1124) and SCoT (Start codon targeted Polymorphism, target initiation codon are polymorphic) (genetic diversity of Chen Xi etc., SCoT labeled analysis Shaanxi Resources of Tea Plant, Tea science, 2016,36 (2)：131-138) studied in succession for the Genetic Diversity of Germplasm of tea tree, still, these points The research that sub- labelling technique is directly used in tea tree breed Molecular Identification is seldom, also these labelling techniques used by for sequence compared with Short general random primer or the random combine of primer, the DNA fingerprinting of pcr amplification product are not only complicated, repeated Difference, and specificity is not high, therefore is not suitable for being directly used in cultivar identification.A kind of (structure tea tree DNA fingerprinting such as Sun Weijiang Method, 104651515 A of patent application publication CN) based on 12 ISSR universal primers to tea tree breed carry out PCR expansions Increase, copy band by 0,1, DNA fingerprinting information by planar bar code technology is handled and is converted by a plurality of Primer Analysis result combination Then two-dimension code pattern carries out the discriminating of tea tree breed by the comparison of two-dimension code pattern.Some scholars are based on same principle, PCR amplification is carried out using three pairs of SSR universal primer whitening tea tree breeds, the 0 of DNA fingerprinting, 1 is then based on and copies information Build tea tree breed Quick Response Code identification information (Rapid identification difference albino tea tree breed molecular labeling combination, method and should With 106480224 A of patent application publication CN).These researchs provide a kind of think of for the identification of tea tree breed with classification Road, however this kind of discrimination method there is it is very big the defects of：(1) it is cumbersome.Such method needs to treat using multipair primer Sample carries out PCR amplification, and then carrying out 0,1 to obtained DNA fingerprint figure copies band, will obtain data and is combined, finally leads to Cultivar identification could be realized by crossing Quick Response Code identification；(2) accuracy is poor.The common moleculars such as ISSR and SSR are marked to PCR reaction conditions Compare sensitive, therefore, DNA fingerprinting repeatability is relatively poor, once DNA fingerprinting information changes, it is easy to Quick Response Code is caused to differentiate failure or judge by accident；It is copied with during in addition, carrying out 0,1, since DNA fingerprinting is more multiple Miscellaneous and electrophoretic band background difference, it is easy to there is the phenomenon that artificial data statistics mistake, in turn result in discriminating failure or Person differentiates mistake；(3) it takes longer.Such method be related to the PCR amplification of a plurality of primer, electrophoresis detection, DNA fingerprinting 0, 1, which copies band, data combination and Quick Response Code, compares analysis, and the whole experiment process time is long.Therefore, existing tea tree product how to be improved The deficiency of kind discrimination method, has become the task of top priority.
Specific molecular marker technology is on the basis of common molecular label, using the sequencing of specific DNA fragment, according to two Terminal sequence designs the primer of a length of 18~24 base of a pair of sequences, and specific amplification is carried out under higher annealing temperature.It draws Object has very high specificity, can exclude the competition between random primer binding site, realizes that the specificity of DNA sequence dna expands Increase.Therefore, this technology is a kind of sufficiently stable molecular marking technique, before having application well in plant germplasm identification Scape.This method has the characteristics that quick, easy, at low cost, testing result is accurate, and there has been no specific molecular markers so far Research report applied to yellow tea tree breed ' yellow leaf treasured ' discriminating.
Invention content
First purpose of the present invention is in view of the deficiencies of the prior art, it is ' yellow to provide a kind of discriminating yellow tea tree breed Leaf is precious ' characteristic nucleotide sequence.
The present invention, based on SCoT molecular labelings, by a large amount of screening experiments, it is special to obtain ' yellow leaf is precious ' using round pcr Property DNA fragmentation.By gel extraction, TA clones, sequencing, the DNA sequence dna is obtained.Particular sequence is：
ACCATGGCTACCACCGCAGAATAGAGGCCAACTCAAGGCAAATCACCACAATTCTAAAACTTGGCTCTCCTCGGTTG GTCAAAGAAGTTCAAAAGCTGATGAGAATGGCCGTCGCACTCAACAACTTTATCAACCGTTTCACAGATCGCTGCCG ACAATTCTTTCACACATTTCGGTAGAACAAAGCTTTTGAATGGACCCCTAAGTGCCAGGTCGCTCTGGACGGCTTGA AAACTTACCTCCGATCAGTACCACTCTTGGTAACCCCCTCGGCAGGCGATCCGCTCATTTTGTATCTTGCAGTATCT GACTGGGCGGTCAGTGCTGTACTTTTAACGAAAGAACTCGGGGAGCAACGACCAGTTTACTATGTAAGAAAGGCAAT GGTTGATACTGAAACACGTTATCTACCACTGGAAAAGCTCATCCTTGCTCTCGTGATGGCTGCAAGAAAACTGATGC ATTACTTTGAAGGGCATGCCATAGGGGTAATAACAGACTATCCTCTCCGGTCAGCGCTCCATAGCGGGGAAGCATCA GGGCGAGTTTCGAAATGGGCTTTGGAACTCGGCCAGTATGATATTTGGTTTTTGCCTAGAACTAACATCAAAGGGCA AGTGCTCGCCGACTTGTAGTCGAATTCACGAGATAACATGCCGACTTTAACTCTGATCAAGTACAACCTAAACCCAA TTGGCGAATATATATTGGAGACATTTGGCAAATGTACTGTGACGGGTCATCCAACTAGCGTGACAGTAGGGCAGGTG TAGAAATCATGACCCCCGAAGGGGCAATAATCGAGCAGGCGGTCAAACTGGGCTTTGATGCATCAAATAATGAGGCC AAATACGAAGCATTGCTAACCGGCCTTCGCAACACACTTCACCTTGGTATGCGGTG GTAGCCATGGT, such as SEQ ID Shown in NO.1；
It is ' yellow that second object of the present invention is to provide the discriminating based on above-mentioned ' yellow leaf is precious ' specific nucleotide sequences design Leaf is precious ' specificity labeled primers (S34H7F3/S34H7R1), the primer sequence is as follows：
Sense primer S34H7F3:5 '-ACTTGGCTCTCCTCGGTTG-3 ', as shown in SEQ ID NO.2；
Downstream primer S34H7R1:5 '-ACCATGGCTACCACCGCATA-3 ', as shown in SEQ ID NO.3；
Above-mentioned specific primer (S34H7F3/S34H7R1) has very high specificity.Draw using the primer as PCR Object carries out PCR amplification, primer combination (S34H7F3/S34H7R1) to ' yellow leaf is precious ' and its similar tea tree breed genomic DNA Only react with ' yellow leaf precious ' sample DNA, obtain the DNA fragment specific of 856bp sizes, and with other tea tree breed samples It does not react.Further to verify the stability of specificity labeled primers S34H7F3/S34H7R1, with primer combination to coming PCR amplification is carried out from the genomic DNA of 10 difference ' yellow leafs treasured ' individuals, as a result owning ' yellow leaf is precious ' samples can amplify 856bp size specific bands illustrate that the primer has very high stability and application.With the specific primer, pass through Standard PCR reaction can quick and precisely identify ' yellow leaf is precious ' sample.
Third object of the present invention is to provide a kind of precious to tea tree breed ' yellow leaf using above-mentioned specificity labeled primers ' Carry out quick mirror method for distinguishing.The method is：It is specificity with the primer combination (S34H7F3/S34H7R1) that the present invention designs Amplimer using tea tree plant sample DNA to be measured as amplification template, carries out PCR amplification, is detected through agarose gel electrophoresis, if There is the specific DNA band that molecular weight is 856bp sizes in electrophoresis result, then tea tree plant sample to be measured is ' yellow leaf is precious ', instead Be not then.
Specifically, the method is as follows：
(1) sample total DNA is extracted：The fresh blade 100mg of clip tea tree plant sample to be measured is put into mortar, adds in liquid immediately Nitrogen is ground to powder, then, (Shanghai life work bioengineering is purchased from using UNIQ-10 pillar plant genome DNA extraction agents box Co., Ltd) sample total DNA is extracted, gained DNA carries out electrophoresis detection, and examined with ultraviolet specrophotometer with 1% agarose gel Concentration is surveyed, is diluted to 50ng/ μ l.
(2) PCR amplification：Using the sample to be tested DNA of step (1) extraction as template, with the molecular specificity labeled primers (S34H7F3/S34H7R1) as amplimer, PCR amplification is carried out.
PCR reaction systems (20 μ l of total volume)：Sense primer S34H7F3 (10 μM) 1 μ l, downstream primer S34H7R1 (10 μ M) 1 μ l,10 μ l of PCR SuperMix (ordering in Beijing Quanshijin Biotechnology Co., Ltd), template DNA (50ng/ μ l) 1 μ l, ddH2O 7μl。
PCR reaction setting programs：94 DEG C of pre-degeneration 5min；32 cycle (94 DEG C denaturation 50s, 61 DEG C annealing 50s, 72 DEG C Extend 1.5min)；72 DEG C of extension 10min.
(3) electrophoresis detection：10 μ l of step (2) PCR product are taken, electrophoresis detection is carried out with 1.5 ﹪ Ago-Gels, using solidifying Glue imaging system is taken pictures detection.If the DNA bands that molecular weight is 856bp sizes occurs in electrophoretogram channel, sample to be tested is ' yellow Leaf is precious ', it is on the contrary then be not.
Main advantageous effect of the invention is shown as：S34H7F3/S34H7R1 is ' yellow leaf is precious ' specificity labeled primers, if Other tea tree breeds, be negative reaction, can realize tea tree breed ' yellow leaf treasured ' quick, accurate discriminating.This method is easy, accurate Really, it is and time-consuming short, it can be completed within 1st.
Description of the drawings
Fig. 1 is according to conventional PCR method, and ' yellow leaf is precious ' and its similar yellow tea tree breed are carried out with SCoT labels PCR amplification, by a large amount of screening experiments, the electrophoretogram (item of arrow meaning with ' yellow leaf is precious ' characteristic DNA bands of acquisition Band is ' yellow leaf precious ' distinctive band, molecular weight 914bp), wherein M is DNA molecular amount standard Trans2K DNA Marker (being purchased from Beijing Quanshijin Biotechnology Co., Ltd)；Channel 1-17 is respectively：Gold bud, Su Yuhuang, Anji white tea, middle yellow 1 Number, yellow No. 2 middle, yellow No. 3 middle, yellow leaf is precious, middle tea 211, Yu Jinxiang, Cold boiled chicken hat, scape is No. 1 white, scape is No. 2 white, balcony white tea, Yue Xiang White tea, Anji yellow tea, golden chrysanthemum, floral leaf.
Fig. 2 is the characteristic nucleotide sequence of ' yellow leaf precious ' of the present invention and to ' yellow leaf is precious ' specific primer The location drawing of S34H7F3 and S34H7R1, left side 5 ' are held, and right side 3 ' is held, and wherein black portions are specific primer The sequence fragment size and location of S34H7F3/S34H7R1 amplifications；
Fig. 3 is the molecular specificity labeled primers S34H7F3/S34H7R1 designed with the present invention to 17 yellow tea trees Kind DNA carries out the electrophoretogram of PCR amplification, and wherein M (it is complete to be purchased from Beijing for DNA molecular amount standard Trans2K DNA Marker Shi Jin Bioisystech Co., Ltd)；Channel 1-17 is respectively：Gold bud, Su Yuhuang, Anji white tea, it is yellow No. 1 middle, yellow No. 2 middle, Middle yellow No. 3, yellow leaf is precious, middle tea 211, Yu Jinxiang, Cold boiled chicken hat, scape is No. 1 white, scape is No. 2 white, balcony white tea, more township's white tea, Anji are yellow Tea, golden chrysanthemum, floral leaf.Electrophoretogram shows that only ' yellow leaf is precious ' sample amplification goes out the specific DNA item that molecular weight is 856bp sizes Band.
Fig. 4 is the molecular specificity labeled primers S34H7F3/S34H7R1 designed with the present invention to 10 parts of difference ' yellow leafs The DNA of treasured ' individual carries out the electrophoretogram of PCR amplification.Wherein, M (is purchased from for DNA molecular amount standard Trans2K DNA Marker Beijing Quanshijin Biotechnology Co., Ltd)；Channel 1-10：10 difference ' yellow leafs treasured ' samples are corresponded to, number is respectively HYB1-HYB10。
Specific embodiment
The present invention more can fast and accurately differentiate that yellow tea tree breed ' yellow leaf is precious on a molecular scale ' related sample Product.By following embodiment, the present invention will be further described, but protection scope of the present invention is not limited to that：
Embodiment 1：The preparation of ' yellow leaf is precious ' characteristic nucleotide sequence
1. sample total DNA is extracted
The fresh blade 100mg of clip tea tree plant sample to be measured is put into mortar, immediately addition liquid nitrogen grinding to powder, so Afterwards, sample is extracted using UNIQ-10 pillar plant genome DNA extraction agents box (being purchased from Shanghai Sheng Gong bioengineering Co., Ltd) Product total DNA, gained DNA carry out electrophoresis detection with 1% agarose gel, and with UV spectrophotometer measuring concentration, are diluted to 50ng/μl。
2.SCoT-PCR amplification, electrophoresis detection
PCR amplification is carried out to yellow tea tree sample DNA to be measured with SCoT molecular labelings, primer gives birth to work biology work by Shanghai Journey Co., Ltd synthesizes, reaction system (20 μ l of total volume)：PCR SuperMix (are purchased from the full formula gold in Beijing Bioisystech Co., Ltd) 10 μ l, 1 μ l of primer (10 μM), template DNA (50ng/ μ l) 1 μ l, ddH2O 8μl。
PCR amplification sets program：94 DEG C of pre-degeneration 5min；32 cycle (94 DEG C denaturation 50s, 55 DEG C annealing 50s, 72 DEG C Extend 1.5min)；72 DEG C of extension 10min.
By a large amount of screening experiments, there is the DNA fingerprinting (see Fig. 1) of ' yellow leaf is precious ' signature band, arrow The band (molecular weight 914bp, channel 7) of label is ' yellow leaf is precious ' the specific DNA band filtered out.As Fig. 1 (in figure, leads to Road M is DNA molecular amount standard Trans2K DNA Marker；Channel 1~17 is different yellow tea tree breeds, and specific number is shown in attached Figure explanation) shown in, only ' yellow leaf precious ' (channel 7) has band appearance in molecular weight 914bp positions, and other yellow tea tree breeds There is no band appearance in molecular weight 914bp positions.Therefore, characteristic nucleotide sequence of this band for ' yellow leaf is precious '.
3. sequencing
Gel extraction is carried out to ' yellow leaf is precious ' DNA fragment specific (arrow meaning segment in Fig. 1) that above-mentioned screening obtains, PCR product purification kit (Beijing health is by century) purifying is used to cut DNA fragmentation.Then purified DNA fragmentation is connected It arrivesOn-Blunt simple cloning vector (being purchased from Beijing Quanshijin Biotechnology Co., Ltd), turn Change into competent escherichia coli cell, after testing after, by the clone containing aim sequence send biotech firm be sequenced (the auspicious sound in Shanghai Bio tech ltd), obtain nucleotide composition and the arrangement as shown in SEQ ID NO.1.
Embodiment 2：Prepared by ' yellow leaf is precious ' specificity labeled primers, PCR amplification, electrophoresis detection
On the basis of sequencing obtains ' yellow leaf is precious ' specific DNA sequences, design obtains specificity labeled primers S34H7F3/S34H7R1 (being respectively shown in SEQ ID NO.2, SEQ ID NO.3).Primer sequence is by the auspicious sound biotechnology in Shanghai Co., Ltd synthesizes.Then, using designed primer combination S34H7F3/S34H7R1 to different yellow tea tree breed DNA into Row PCR amplification.
PCR reaction systems (20 μ l of total volume)：Sense primer S34H7F3 (10 μM) 1 μ l, downstream primer S34H7R1 (10 μ M) 1 μ l,10 μ l of PCR SuperMix (ordering in Beijing Quanshijin Biotechnology Co., Ltd), template DNA (50ng/ μ l) 1 μ l, ddH2O 7μl。
PCR response procedures：94 DEG C of pre-degeneration 5min；(94 DEG C of denaturation 50s, 61 DEG C of annealing 50s, 72 DEG C extend 32 cycles 1.5min)；72 DEG C of extension 10min.
Electrophoresis detection is carried out to PCR product using 1.5 ﹪ Ago-Gels, (in figure, channel M is electrophoretogram as shown in Figure 3 DNA molecular amount standard Trans2K DNA Marker；Channel 1~17 is different yellow tea tree breeds, and specific number is shown in that attached drawing is said It is bright).From figure 3, it can be seen that only ' yellow leaf is precious ' (channel 7) can amplify the specific DNA band that molecular weight is 856bp sizes (the specific DNA band particular sequence information is shown in Fig. 2 density bullets part), and other yellow tea tree breeds are not expanded and are taken the post as What band, this shows that the specific primer of the present invention has high specificity, therefore can be used for the fast of ' yellow leaf is precious ' sample Speed differentiates.
Embodiment 3：Specificity labeled primers S34H7F3/S34H7R1 is further verified
In order to further verify the stability and application range of the primer combination S34H7F3/S34H7R1 of this patent exploitation, PCR amplification detection, electrophoretogram are carried out to the sample DNA of 10 parts of difference ' yellow leafs treasured ' individuals using primer S34H7F3/S34H7R1 (in figure, M is DNA molecular amount standard Trans2K DNA Marker as shown in Figure 4；Channel 1-10：Correspond to ' yellow leaf is precious ' sample Product, number HYB1-HYB10).Fig. 4 shows that all ' yellow leaf is precious ' samples can amplify the specific DNA band of 856bp sizes, Therefore, specificity labeled primers S34H7F3/S34H7R1 of the invention has very high stability, can be used for yellow tea tree product Plant the quick discriminating of ' yellow leaf is precious '.
SEQUENCE LISTING
<110>Tea Inst., Chinese Academy of Agricultural Sciences
<120>Differentiate yellow tea tree breed ' yellow leaf it is precious ' nucleotide sequence, specificity labeled primers and method
<130> 1
<160> 3
<170> PatentIn version 3.3
<210> 1
<211> 914
<212> DNA
<213>It is artificial synthesized
<400> 1
accatggcta ccaccgcaga atagaggcca actcaaggca aatcaccaca attctaaaac 60
ttggctctcc tcggttggtc aaagaagttc aaaagctgat gagaatggcc gtcgcactca 120
acaactttat caaccgtttc acagatcgct gccgacaatt ctttcacaca tttcggtaga 180
acaaagcttt tgaatggacc cctaagtgcc aggtcgctct ggacggcttg aaaacttacc 240
tccgatcagt accactcttg gtaaccccct cggcaggcga tccgctcatt ttgtatcttg 300
cagtatctga ctgggcggtc agtgctgtac ttttaacgaa agaactcggg gagcaacgac 360
cagtttacta tgtaagaaag gcaatggttg atactgaaac acgttatcta ccactggaaa 420
agctcatcct tgctctcgtg atggctgcaa gaaaactgat gcattacttt gaagggcatg 480
ccataggggt aataacagac tatcctctcc ggtcagcgct ccatagcggg gaagcatcag 540
ggcgagtttc gaaatgggct ttggaactcg gccagtatga tatttggttt ttgcctagaa 600
ctaacatcaa agggcaagtg ctcgccgact tgtagtcgaa ttcacgagat aacatgccga 660
ctttaactct gatcaagtac aacctaaacc caattggcga atatatattg gagacatttg 720
gcaaatgtac tgtgacgggt catccaacta gcgtgacagt agggcaggtg tagaaatcat 780
gacccccgaa ggggcaataa tcgagcaggc ggtcaaactg ggctttgatg catcaaataa 840
tgaggccaaa tacgaagcat tgctaaccgg ccttcgcaac acacttcacc ttggtatgcg 900
gtggtagcca tggt 914
<210> 2
<211> 19
<212> DNA
<213>It is artificial synthesized
<400> 2
acttggctct cctcggttg 19
<210> 3
<211> 20
<212> DNA
<213>It is artificial synthesized
<400> 3
accatggcta ccaccgcata 20

Claims (5)

1. a kind of differentiate that yellow tea tree breed ' yellow leaf is precious ' nucleotide sequence, expanded based on functional gene correlation SCoT molecular labelings Increase, clone, acquisition be sequenced, it is characterised in that the nucleotide sequence, as shown in SEQ ID NO.1.
2. drawn based on a kind of molecular specificity marker of nucleotide sequence design for differentiating ' yellow leaf is precious ' as described in claim 1 Object, it is characterised in that the specific primer sequence is as follows：
Sense primer S34H7F3:5 '-ACTTGGCTCTCCTCGGTTG-3 ', as shown in SEQ ID NO.2；
Downstream primer S34H7R1:5 '-ACCATGGCTACCACCGCATA-3 ', as shown in SEQ ID NO.3.
A kind of 3. method for differentiating ' yellow leaf is precious ', it is characterised in that using the primer S34H7F3/S34H7R1 described in claim 2 As specificity amplification primer, using tea tree breed genomic DNA to be measured as template, carry out standard PCR amplification, to amplified production into Row electrophoresis detection, if the specific DNA band of 856bp sizes occurs in electrophoresis result, tea tree plant sample to be measured is ' yellow leaf It is precious '；It is on the contrary then be not.
4. method as claimed in claim 3, it is characterised in that the PCR amplification system, total volume are 20 μ l：10 μM of upstreams Primer S34H7F3 1 μ l, 10 μM of 1 μ l of downstream primer S34H7R1,10 μ l, 50ng/ μ of PCR SuperMix L template DNAs 1 μ l, ddH2O 7μl。
5. method as claimed in claim 3, it is characterised in that the PCR amplification program is：PCR response procedures：94 DEG C pre- It is denaturalized 5min；32 cycles；72 DEG C of extension 10min；Wherein each cycle includes 94 DEG C of denaturation 50s, 61 DEG C of 50s that anneal, 72 DEG C Extend 1.5min.
CN201710573523.9A 2017-07-14 2017-07-14 Differentiate that yellow tea tree breed ' yellow leaf is precious ' nucleotide sequence, specificity labeled primers and method Expired - Fee Related CN107190083B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201710573523.9A CN107190083B (en) 2017-07-14 2017-07-14 Differentiate that yellow tea tree breed ' yellow leaf is precious ' nucleotide sequence, specificity labeled primers and method

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201710573523.9A CN107190083B (en) 2017-07-14 2017-07-14 Differentiate that yellow tea tree breed ' yellow leaf is precious ' nucleotide sequence, specificity labeled primers and method

Publications (2)

Publication Number Publication Date
CN107190083A CN107190083A (en) 2017-09-22
CN107190083B true CN107190083B (en) 2018-07-06

Family

ID=59882124

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201710573523.9A Expired - Fee Related CN107190083B (en) 2017-07-14 2017-07-14 Differentiate that yellow tea tree breed ' yellow leaf is precious ' nucleotide sequence, specificity labeled primers and method

Country Status (1)

Country Link
CN (1) CN107190083B (en)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108220471B (en) * 2018-01-25 2020-02-18 中国农业科学院茶叶研究所 Molecular specific marker primer for identifying national-grade tea tree improved variety Fuyun No. 6 and identification method thereof
CN110669866B (en) * 2019-11-14 2022-12-27 安徽农业大学 InDel marker for identifying purple tea tree varieties and combination and application thereof

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106480224A (en) * 2016-12-28 2017-03-08 中国农业科学院茶叶研究所 The molecular marker combination of Rapid identification difference albino tea tree breed, method and application

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101504415B1 (en) * 2013-04-03 2015-03-19 이영환 Method for manufacturing drink using fermented tea

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106480224A (en) * 2016-12-28 2017-03-08 中国农业科学院茶叶研究所 The molecular marker combination of Rapid identification difference albino tea tree breed, method and application

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
特异优质茶树新品种"中黄1号"选育碱;黄茶育种协作组;《中国茶叶》;20140930;第8-17页 *

Also Published As

Publication number Publication date
CN107190083A (en) 2017-09-22

Similar Documents

Publication Publication Date Title
CN108034754B (en) Method for identifying new variety of purple tea trees by SSR fingerprint
CN108660136A (en) Characteristic sequence, labeled primer and the identification method of thin shell mountain pecan Peach cultivars Davis
CN107586867A (en) Thin shell mountain pecan Peach cultivars Pawnee characteristic sequence, labeled primer and authentication method
CN107190083B (en) Differentiate that yellow tea tree breed &#39; yellow leaf is precious &#39; nucleotide sequence, specificity labeled primers and method
CN104673790B (en) The molecular specificity labeled primers and authentication method of the long woods of oil tea breeding No. 18
CN105087813A (en) Ginkgo biloba variety molecular detection primer combination and ginkgo biloba variety detection method
CN107586866A (en) Thin shell mountain pecan Peach cultivars Moore characteristic sequence, labeled primer and authentication method
CN107574257B (en) Core SSR primer and kit for identifying pea variety and purity
CN107604054B (en) Method based on fluorescence SSR capillary electrophoresis technique Rapid identification locust tree polyploid
CN105861711B (en) Opium poppy species specificity genetic marker detection architecture
CN105112527A (en) Molecular identification method for Biluochun tea
CN104611329B (en) Flowering Cherry Cultivars &#34; Song Yue &#34; and the molecular specificity labeled primers of &#34; root tuber of aromatic turmeric &#34;
CN105420354B (en) Conventional rice variety Huaihe River rice No. 5 and Huaihe River rice No. 18 identification methods based on InDel label
CN108998551A (en) Tea tree quadruple fluorescence SSR molecular marker detection method
CN107190082B (en) For differentiating the molecular specificity labeled primers and its discrimination method of national improved tea variety &#39; meeting frost &#39;
CN108977570B (en) Method for identifying 28 good carrot varieties and special primer set thereof
CN108410967B (en) A kind of method of Rapid identification river camellia tradition famous-object
CN104593367B (en) The specificity labeled primers of red rich, the former brave tail in city of Flowering Cherry Cultivars and the open country younger sister back of the body
CN102586459B (en) Method for identifying varieties of Chinese cabbage by using composite expressed sequence tag-simple sequence repeat (EST-SSR) marker
CN106399566B (en) A set of combination of SSR primer and its application for being suitable for cultivating mung bean variety identification
CN104560977B (en) The molecular specificity labeled primers and detection method of Flowering Cherry Cultivars &#34; the open country younger sister back of the body &#34;
CN108330164A (en) Characteristic sequence, primer and the identification method of thin shell mountain pecan Peach cultivars Moore
CN110564886A (en) Golden camellia SSR (simple sequence repeat) marker primer and application thereof in hybrid identification
CN108220471B (en) Molecular specific marker primer for identifying national-grade tea tree improved variety Fuyun No. 6 and identification method thereof
CN104593368B (en) The molecular specificity labeled primers that the red branch of Flowering Cherry Cultivars eightfold hangs down and rain condition branch hangs down

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant
CF01 Termination of patent right due to non-payment of annual fee

Granted publication date: 20180706

Termination date: 20200714

CF01 Termination of patent right due to non-payment of annual fee