CN107604054A - Method based on fluorescence SSR capillary electrophoresis technique Rapid identification locust tree polyploids - Google Patents

Abstract

The invention discloses a kind of method based on fluorescence SSR capillary electrophoresis technique Rapid identification locust tree polyploids, this method carries out SSR PCR amplifications using locust tree genomic DNA as masterplate, using the primer as shown in SEQ ID NO.1 2；Pcr amplification product Capillary Electrophoresis；Locust tree SSR finger-prints are built according to electrophoresis result；According to the locust tree SSR finger-prints of structure, if number of alleles is more than or equal to 3, you can it is polyploid to confirm the plant.The inventive method easy, quickly can identify whether locust tree plant is polyploid; a kind of new method practical, easy to operate is provided for ploidy analysis and the identification of locust tree, preserves for the selection of locust tree hybrid strain, genetic resources and is had laid a good foundation with evaluation, New variety protection etc..

Description

Method based on fluorescence SSR capillary electrophoresis technique Rapid identification locust tree polyploids

Technical field

The invention belongs to plant polyploid identification technology field, and in particular to one kind is quick using fluorescence SSR labelling techniques Identification locust tree plant whether be polyploid method.

Background technology

Locust tree (Robinia pseudoacacia L.) is pulse family (Leguminosae) robinia (Robinia) broad-leaved Arbor, it is drought-resistant, barren-resistant, resistance to it is slight it is saline and alkaline, contamination resistance is strong, natural renovation ability is strong, be that afforestation and water and soil are protected Hold vanguard tree seed, have it is very high view and admire, nectar source and feeding value.Locust tree timber is tough and tensile, shock resistance, resistance to rotten, water-fast wet, is Important building, ore pillar, vehicle, shipbuilding material；Locust tree timber calorific value is high, and burning velocity is slow, is high-quality fire wood and excellent life Material energy seeds.Locust tree originates in North America, and worldwide introduction and acclimatization is started from 1601, and Paris botanical garden director Luo Bao will be pierced Chinese scholartree introduces France, turns into first forest tree species that Europe is introduced from North America, is gradually introduced a fine variety later by other countries and regions, such as The Soviet Union, Switzerland, Italy, Germany, Austria, Hungary, Czechoslovakia, Yugoslavia, Romania, the Middle East, Japan, South Korea and China, and South America, Africa and Australia (Kai Laisitaishe, 1993).The locust tree introduction and acclimatization of China starts from clearly (1877-1878) during the time ruled by Emperor Guang Xu, Chinese officials Zhang Lu are born from Japanese introducing, are colonized in Nanjing dragon inner Xue's hut of coiling and view and admire use. Qingdao of Shandong province suburb afforestation, (Chen Yishan, 2005) were introduced by German in 1897.20 years before and after founding of New, China is again Several locust tree introduces a collections have been introduced respectively from Japan, the U.S. and Korea, are planted in China east area of the Liao River, coextensive with eastern and southern Liaoning Province, Tianshui city, Changsha and China The ground such as north (Gu Wanchun etc., 1991).Because locust tree has extensive adaptability to weather conditions, edaphic condition, therefore from 1949 Since, cultivation scope is progressively extended to 23 ° -46 ° of north latitude, 27 provinces (city, autonomous region) of 124 ° -86 ° of east longitude, is widely distributed in Liaoning On the south Tieling, Inner Mongol Huhehaote, packet header, Ningxia, Yinchuan, south is to Foochow, and to the east of Taiwan, Jiangsu, Along Zhejiang Coast, northwest is extremely Shihezi of Xinjiang, Yining, Aksu, Yecheng, Xining, Qinghai, southwest to Ya'an Sichuan province, Kunming, Yunnan (Chinese tree will, 1985), gradually it is evolved into the indigenous tree in China.

Polyploid plant is very common in nature, generally has the spies such as the speed of growth fast, biological yield is high, strong stress resistance Sign.The Beijing Forestry University feed form tetraploid locust K1-K5 that China is introduced from South Korea in 1997, are by artificial induction diploid Locust tree somatic doubling and be bred as.At present both at home and abroad still without other discoveries or the report of cultivation tetraploid locust.Locust tree makees One of three big seeds the most successful are introduced a fine variety for the world, this seminar speculates that locust tree certainly exists the more of many generation natural variations Times body.The method of plant identification polyploid more commonly used at present mainly has plant forms identification method, chromosome counting method (core Type analysis) and Flow cytometry, wherein Morphological Identification method is most directly perceived, most extensive, but the degree of accuracy identified is not high, is only capable of Main method as Preliminary Identification polyploid；The qualification result of chromosome counting method is the most classical, reliable, but to plant Period residing for materials position and cell requires very high, and operating process is cumbersome, workload is big；Flow cytometry (FCM) Although being capable of the determination of ploidy level of chromosome of quick discriminating plant, sample preparation time was no more than 20 minutes, otherwise DNA peaks Value position can shift, and so as to influence measurement result, and determine costly.So it is badly in need of a kind of easy, quick, efficient Identification polyploid plant method.South Korea's brightness (2012) is carrying out heredity point using EST-SSR to citrus polyploid in recent years After analysis, it is believed that the reference that SSR molecular marker can confirm as Different Ploidy plant ploidy；Jia Huixia etc. (2015) found when carrying out SSR fingerprint map constructions to 24 parts of willow germplasm, middle bosom No. 1, gloomy extra large No. 1, gloomy extra large No. 2, Cathay poplar 3 not iso-allele sites are amplified with 5 parts of germplasm of Poplar Zhonglin-46, FCM testing results confirm that this 5 parts of germplasm are three times Body, so drawing a conclusion, SSR marker can reflect the ploidy of plant exactly.However, utilization is there is no both at home and abroad at present through retrieval The method that fluorescence SSR marker technology carries out Rapid identification to locust tree polyploid.

The content of the invention

It is fast based on fluorescence SSR capillary electrophoresis techniques it is an object of the invention to provide one kind based on above-mentioned prior art The method of speed identification locust tree polyploid.

To achieve these goals, there is provided following technical scheme：

A kind of method based on fluorescence SSR capillary electrophoresis technique Rapid identification locust tree polyploids, comprises the following steps：

(1) locust tree Genome DNA extraction is (preferable：Extracted and pierced using plant tissue genome DNA extracting reagent kit (paramagnetic particle method) Chinese scholartree STb gene)；

(2) performing PCR amplification is entered using SSR primers：Using the locust tree STb gene sample of step (1) extraction as template, such as Primer shown in SEQIDNO.1-2 carries out SSR-PCR amplifications；

(3) pcr amplification product Capillary Electrophoresis；

(4) the electrophoresis result structure locust tree SSR finger-prints in step (3)；

(5) according to the locust tree SSR finger-prints built in step (4), if number of alleles is more than or equal to 3, you can really It is polyploid to recognize the plant.

Preferably：Primer in the step (2) also includes the primer as shown in SEQIDNO.3-4.

Preferably：Amplification system in the step (2) uses 10 μ L systems：The locust tree STb gene of step (1) extraction (20ng·μL^-1) 0.5 μ L, the μ L of 4.3 μ L, 2 × Taq PCR Master Mix of sterile deionized water 5, positive anti-primer is (i.e.：Primer SEQIDNO.1-4) each 0.1 μ L.

Preferably：The response procedures of PCR amplifications are in the step (2)：95 DEG C of pre-degeneration 5min；95 DEG C of denaturation 30s, 57 DEG C of annealing 30s (each circulation reduces by 0.5 DEG C), 72 DEG C of extension 40s, 14 circulations；95 DEG C of denaturation 30s, 50 DEG C of annealing 30s, 72 DEG C of extension 40s, 20 circulations；72 DEG C of extension 10min.

Preferably：Step (3) concretely comprise the following steps：Take each 0.3 μ L of PCR primer, the μ L of molecular weight internal standard 0.5 and go from The sub- μ L of formamide 9.5 mixing adds PCR plate, 95 DEG C of denaturation 5min, is centrifuged after 4 DEG C of coolings, machine examination on 1 × Buffer buffer solutions Survey allele number.

Preferably：The number of alleles visual inspection is surveyed, and parameter used is as follows：Operating voltage 15.0kV, sample introduction voltage 1.6kV, injection duration 15s, the μ A of electric current of voltage regulation 30.0.

Preferably：The number of alleles visual inspection is surveyed and uses HPCE ABI3730XL.

Preferably：Step (4) concretely comprise the following steps：Data preparation point is carried out using Genemarker2.2.0 softwares Analysis, according to the peak value of each pair SSR primers, combination forms each clonal SSR finger-prints.

Compared with prior art, the invention has the advantages that：

1st, the method based on fluorescence SSR capillary electrophoresis technique Rapid identification locust tree polyploids of example of the present invention, utilize The method of two pairs of fluorescence SSR primers combination structure finger-print, is not only that one kind is quick from molecular level, efficiently identifies locust tree Kind or clone whether be polyploid method, additionally it is possible to for carrying out locust tree Genetic diversity evaluation, while be locust tree The theoretical foundation that science is provided with genetic breeding Selection parent is introduced a fine variety, is the side such as locust tree Germplasm resources management and intellectual property protection Establish solid foundation in face.

2nd, the method based on fluorescence SSR capillary electrophoresis technique Rapid identification locust tree polyploids of example of the present invention, with reference to The advantages of SSR marker is with capillary fluoroscopic examination, overcomes the deficiency of polyacrylamide gel electrophoresis, can not only accurately read The size of product fragment, accuracy reach within 1bp, and cost is relatively low, great application value.

3rd, method of the example of the present invention based on fluorescence SSR capillary electrophoresis technique Rapid identification locust tree polyploids, using spy The SSR primer sets of the opposite sex carry out identifying locust tree kind polyploid, and specificity is high, and amplification efficiency is good, can quickly, batch identification locust tree Whether it is polyploid, there is the advantage such as quick, accurate, easy to operate, and qualification result is not easy to be influenceed by time and environment.

4th, method of the example of the present invention based on fluorescence SSR capillary electrophoresis technique Rapid identification locust tree polyploids, using drawing The polyploid recall rate of this pair of primers of thing SEQIDNO.1, SEQIDNO.2 is just up to 85.42%, utilizes primer SEQIDNO.1- 4 polyploid recall rate can reach 100%.

5th, method of the example of the present invention based on fluorescence SSR capillary electrophoresis technique Rapid identification locust tree polyploids, primer are Go out from multipair SSR primer screenings, polymorphism is high, stability is good, can precise Identification locust tree whether be polyploid, utilize primer As long as more than three (including three) allele can be amplified, you can it is polyploid to identify the locust tree plant.

Brief description of the drawings

Fig. 1 is the part pcr amplification product Capillary Electrophoresis figure of the fluorescence SSR primer pairs 1 of example of the present invention；

Fig. 2 is the part pcr amplification product Capillary Electrophoresis figure of the fluorescence SSR primer pairs 2 of example of the present invention.

Embodiment

In order to be better understood by technical scheme, with reference to Figure of description and specific embodiment to the present invention It is described further.

1st, experiment material：

This experiment is using the 5 tetraploid locust clones introduced from South Korea as material to be tested.Respectively K1 (Tetraploid R.pseudoacacia K1)、K2(Tetraploid R.pseudoacacia K2)、 K3 (Tetraploid R.pseudoacacia K3)、K4(Tetraploid R.pseudoacacia K4)、 K5 (Tetraploid R.pseudoacacia K5)。

It is acquired for materials from Shandong Province Fei County Daqunshan Mountains forest farm.

In May, 2016, young leaflet tablet is gathered, silica dehydrator is standby.

2nd, the extraction of genomic DNA：

Tender Robinia Pseudoacacia Clones blade is taken, using Ying Ruicheng biochemical technologies (Shanghai) Co., Ltd. plant tissue genome DNA extraction kit (paramagnetic particle method) (article No. PTED-6030) is extracted to specifications.

3rd, performing PCR amplification is entered using SSR primers：

The locust tree STb gene sample extracted using step 2 carries out SSR-PCR amplifications as template, using following two pairs of primers, can be with Primer is marked using wherein any two kinds of fluorescence of FAM, HEX, ROX or TAMRA,

Primer pair 1：Upstream：5 ' ACTGTTGGCTATGTCCCCTG ' 3 are (such as： SEQIDNO.1)

Downstream：5 ' GCGAATCTTGACAGCAAACA ' 3 are (such as： SEQIDNO.2)；

Primer pair 2：Upstream：5 ' AACCCTAAAAGCCTCGTTATC ' 3 are (such as： SEQIDNO.3)

Downstream：5 ' TGGCATTTTTTGGAAGACACC ' 3 are (such as： SEQIDNO.4)；

Above-mentioned fluorescence SSR-PCR uses 10 μ L systems：DNA (20ng μ L-1) 0.5 μ L, sterile deionized water 4.3 μ L, 2 × Taq PCR Master Mix 5 μ L, positive each 0.1 μ L of anti-primer.

Above-mentioned fluorescent primer PCR amplification programs use：95 DEG C of pre-degeneration 5min；95 DEG C of denaturation 30s, 57 DEG C of annealing 30s (each circulation reduces by 0.5 DEG C), 72 DEG C of extension 40s, 14 circulations；95 DEG C of denaturation 30s, 50 DEG C of annealing 30s, 72 DEG C of extension 40s, 20 circulations；72 DEG C of extension 10min.

4th, machine testing on Capillary Electrophoresis

PCR primer allele number is detected with HPCE ABI3730XL.Take each 0.3 μ L of PCR products, molecule Measure internal standard (manufacturer ABI) the 0.5 μ L and μ L of deionized formamide (manufacturer ABI) 9.5 mixing and add PCR plate, 95 DEG C of denaturation 5min, centrifuged after 4 DEG C of coolings, machine testing on 1 × Buffer buffer solutions.Genetic Analyser manufacturer is ABI companies, model 3730xlDNAanalyzer, parameter used are as follows：Operating voltage 15.0kV, sample introduction voltage 1.6kV, injection duration 15s, The μ A of electric current of voltage regulation 30.0.

5th, SSR fingerprint map constructions and polyploid identification：Data preparation point is carried out using Genemarker2.2.0 softwares Analysis, according to the peak value of each pair SSR primers, combination forms each clonal SSR finger-prints, as long as having one in finger-print There are more than three (including 3) allele in individual site, it is possible to identifies that the locust tree plant is polyploid from molecular level. The finger-print of above-mentioned two pairs of SSR primers combination structure is shown in Table 1.

Table 1：The finger-print of two pairs of fluorescence SSR primers combination structures

As a result show：Easily it can be verified merely with SSR primer pairs 1 provided by the invention and primer pair 2 from molecular level Clone K1-K5 is strictly polyploid, and SSR sites partial fingerprints banding pattern in different Robinia Pseudoacacia Clones is shown in corresponding to two pairs of primers Fig. 1-Fig. 2.The result of the test of these primers is reproducible, and polymorphism is high, can quickly, accurately and efficiently complete locust tree kind or Person's clone polyploid is identified.

In addition, this laboratory (is largely real from seed building 343 locust tree kinds or clone using primer pair 1 The excellent strain selected in raw seedling) finger-print when, it is found that wherein 293 clones have three to six allele in the site, 85.42% is just up to merely with the polyploid recall rate of this pair of primers, absolutely proves the high efficiency and applicability of the invention, from Molecular level demonstrates the locust tree polyploid that nature is implicitly present in many generation natural variations.

Above description is only the preferred embodiment of the application and the explanation to institute's application technology principle.People in the art Member should be appreciated that invention scope involved in the application, however it is not limited to the technology that the particular combination of above-mentioned technical characteristic forms Scheme, while should also cover in the case where not departing from the inventive concept, carried out by above-mentioned technical characteristic or its equivalent feature The other technical schemes for being combined and being formed.Such as features described above has similar work(with (but not limited to) disclosed herein The technical scheme that the technical characteristic of energy is replaced mutually and formed.

SEQUENCE LISTING

<110>Shandong Forest Science Academy

The state-owned Daqunshan Mountains forest farm in Fei County

<120>Method based on fluorescence SSR capillary electrophoresis technique Rapid identification locust tree polyploids

<130> 2017

<160> 4

<170> PatentIn version 3.5

<210> 1

<211> 20

<212> DNA

<213>Artificial sequence

<400> 1

actgttggct atgtcccctg 20

<210> 2

<211> 20

<212> DNA

<213>Artificial sequence

<400> 2

gcgaatcttg acagcaaaca 20

<210> 3

<211> 21

<212> DNA

<213>Artificial sequence

<400> 3

aaccctaaaa gcctcgttat c 21

<210> 4

<211> 21

<212> DNA

<213>Artificial sequence

<400> 4

tggcattttt tggaagacac c 21

Claims (9)

1. a kind of method based on fluorescence SSR capillary electrophoresis technique Rapid identification locust tree polyploids, it is characterized in that, including it is following Step：

(1) locust tree Genome DNA extraction；

(2) performing PCR amplification is entered using SSR primers：Using the locust tree STb gene sample of step (1) extraction as template, such as SEQIDNO.1- Primer shown in 2 carries out SSR-PCR amplifications；

(3) pcr amplification product Capillary Electrophoresis；

(4) the electrophoresis result structure locust tree SSR finger-prints in step (3)；

(5) according to the locust tree SSR finger-prints built in step (4), if number of alleles is more than or equal to 3, you can confirming should Plant is polyploid.

2. construction method as claimed in claim 1, it is characterized in that, the primer in the step (2) is also included such as Primer shown in SEQIDNO.3-4.

3. construction method as claimed in claim 1, it is characterized in that：Amplification system in the step (2) uses 10 μ L systems： DNA(20ngμL^-1) 0.5 μ L, 4.3 μ L, 2 × Taq PCR Master Mix of sterile deionized water 5 μ L, positive each 0.1 μ of anti-primer L。

4. construction method as claimed in claim 1, it is characterized in that：The response procedures of PCR amplifications are in the step (2)：95 DEG C pre-degeneration 5min；95 DEG C of denaturation 30s, 57 DEG C of annealing 30s, 72 DEG C of extension 40s, 14 circulate；95 DEG C of denaturation 30s, 50 DEG C are moved back Fiery 30s, 72 DEG C of extension 40s, 20 circulations；72 DEG C of extension 10min.

5. construction method as claimed in claim 1, it is characterized in that：Step (3) concretely comprise the following steps：Take PCR primer each 0.3 μ L, the μ L of molecular weight internal standard 0.5 and the μ L of deionized formamide 9.5 mixing add PCR plate, 95 DEG C of denaturation 5min, after 4 DEG C of coolings Centrifuge, machine testing allele number on 1 × Buffer buffer solutions.

6. construction method as claimed in claim 5, it is characterized in that：The number of alleles visual inspection is surveyed, and parameter used is as follows：Work Make voltage 15.0kV, sample introduction voltage 1.6kV, injection duration 15s, the μ A of electric current of voltage regulation 30.0.

7. construction method as claimed in claim 5, it is characterized in that：The number of alleles visual inspection survey HPCE ABI3730XL。

8. construction method as claimed in claim 1, it is characterized in that：Step (4) concretely comprise the following steps：Using Genemarker2.2.0 softwares carry out data preparation analysis, and according to the peak value of each pair SSR primers, combination forms each clone SSR finger-prints.

9. construction method as claimed in claim 1, it is characterized in that：It is total using paramagnetic particle method extraction locust tree in the step (1) DNA。