CN104774948A - PCR (Polymerase chain reaction) identification kit and identification method for largehead atractylode in Hebei - Google Patents

PCR (Polymerase chain reaction) identification kit and identification method for largehead atractylode in Hebei Download PDF

Info

Publication number
CN104774948A
CN104774948A CN201510181371.9A CN201510181371A CN104774948A CN 104774948 A CN104774948 A CN 104774948A CN 201510181371 A CN201510181371 A CN 201510181371A CN 104774948 A CN104774948 A CN 104774948A
Authority
CN
China
Prior art keywords
hebei
pcr
bighead atractylodes
atractylodes rhizome
hbz2
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201510181371.9A
Other languages
Chinese (zh)
Other versions
CN104774948B (en
Inventor
李敏
陈强
茅学群
黄龙妹
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Guangdong Gaohang Intellectual Property Operation Co ltd
Pizhou Runhong Industry Co ltd
Original Assignee
Zhejiang University of Technology ZJUT
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Zhejiang University of Technology ZJUT filed Critical Zhejiang University of Technology ZJUT
Priority to CN201510181371.9A priority Critical patent/CN104774948B/en
Publication of CN104774948A publication Critical patent/CN104774948A/en
Application granted granted Critical
Publication of CN104774948B publication Critical patent/CN104774948B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/686Polymerase chain reaction [PCR]

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses a PCR (polymerase chain reaction) identification kit and identification method for largehead atractylode in Hebei. Specific primers in the kit are HBZ1 and HBZ2, wherein the sequence of the HBZ1 is 5'-GGACATGACAGAAGTATG-3', and the sequence of the HBZ2 is 5'-TGCTGAGAGAAGCAAATC-3'. The invention provides a method for rapidly and accurately identifying largehead atractylode in Hebei, which can be widely applied to the variety identification in each link of seed selecting and breeding, planting, harvesting, storage, selling and clinical applications of a traditional Chinese medicine largehead atractylode in Hebei, and has great significance in the aspects of identifying the authenticity of traditional Chinese medicines, cracking down counterfeit drugs, strengthening the quality supervision of Chinese traditional medicines, and promoting the modernized development of traditional Chinese medicines.

Description

Hebei bighead atractylodes rhizome PCR identification kit and authentication method
(1) technical field
The present invention relates to a kind of DNA molecular authentication method, particularly Chinese medicine Hebei bighead atractylodes rhizome PCR identification kit, Auele Specific Primer, template and authentication method.
(2) background technology
The multiple medicinal functions such as the bighead atractylodes rhizome is the dry rhizome for feverfew bighead atractylodes rhizome Atractylodes macrocephala Koidz., has invigorating the spleen and benefiting QI, eliminating dampness Li Shui, hidroschesis, antiabortive, apply comparatively extensive clinically.Bighead atractylodes rhizome kind is more, and principal item comprises the Hebei bighead atractylodes rhizome, the Zhejiang bighead atractylodes rhizome, the flat art in Hunan, emblem, Anhui art, originates from Hebei, Zhejiang, Hunan and Anhui respectively.Wherein the Hebei bighead atractylodes rhizome has another name called " the little bighead atractylodes rhizome ", and output is the highest, and medicinal ingredients and some difference of other kinds.Because bighead atractylodes rhizome planting base in Hebei constantly expands in recent years, germ plasm resource is chaotic and phenomenon of adulterating is comparatively serious, bighead atractylodes rhizome kind is made to the expanding species and traditional Chinese medicine quality supervision identifying accurately and be conducive to the bighead atractylodes rhizome.
Now outward appearance qualification is mainly comprised to the authentication method of the Different sources bighead atractylodes rhizome, the technology such as chemical reagent, spectrum, nucleus magnetic resonance are utilized to carry out physico-chemical property qualification, but because the sibship of the Different sources bighead atractylodes rhizome is nearer, cause form more similar with physico-chemical property, utilize the more difficult qualification of traditional Chinese medicine authentication method.Along with the development of biology techniques, applied molecular biology means, utilize the otherness of Chinese medicine gene order to carry out Molecular Identification to Chinese medicine, have the advantage such as many such as short accurate, easy, reproducible, consuming time.
Property good plurality of advantages, the result of qualification is by the impact in the sample place of production, growing environment and source.PCR detection method provided by the invention is exactly the DNA molecular authentication method of a kind of Hebei bighead atractylodes rhizome, can the precise Identification Hebei bighead atractylodes rhizome.Current bibliographical information traditional identification and assessment of Chinese medicines means are to the method that precise Identification made by the Hebei bighead atractylodes rhizome, there is not been reported to utilize PCR detection method to carry out qualification to the Hebei bighead atractylodes rhizome.
(3) summary of the invention
The object of the invention be to provide a kind of can the PCR identification kit of the precise Identification Chinese medicine Hebei bighead atractylodes rhizome and detection method, comprise the detecting step of PCR detection method key reagents PCR primer, template and PCR detection method.
The technical solution used in the present invention is:
The invention provides a kind of Hebei bighead atractylodes rhizome PCR identification kit, the Auele Specific Primer in described test kit is HBZ1 (SEQ ID NO.2) and HBZ2 (SEQ ID NO.3):
HBZ1:5’-GGACATGACAGAAGTATG-3’,
HBZ2:5’-TGCTGAGAGAAGCAAATC-3’。
Further, consisting of of described Hebei bighead atractylodes rhizome PCR identification kit:
The invention still further relates to a kind of method utilizing described Hebei bighead atractylodes rhizome PCR identification kit to identify the Hebei bighead atractylodes rhizome, described method is:
(1) extraction of template DNA and quality evalution: adopt traditional extraction method to extract the template of trial-product DNA as PCR; With the quality of electrophoretic method detection template DNA (the same step of detection method (3)), band is clear without disperse, is the template DNA meeting PCR reaction;
(2) PCR qualification: utilize Auele Specific Primer HBZ2 and HBZ3 in the bighead atractylodes rhizome PCR identification kit of Hebei, carry out pcr amplification:
PCR reaction soln:
PCR reaction soln is put into the PCR instrument that automatically increases and carry out pcr amplification reaction, response procedures is set to: 94 DEG C of denaturation 3min, 94 DEG C of sex change 45s, 60-65 DEG C of renaturation 45s, and 72 DEG C extend 1min, 35 circulations, last 72 DEG C of extension 7min;
(3) PCR primer carries out electrophoresis detection: take out pcr amplification product (reaction solution namely after amplified reaction) 5 μ L and mix with sample loading buffer 1 μ L, amplification is detected with 1.2% agarose gel electrophoresis (containing 0.5% ethidium bromide), what occur amplified band at 778bp place is the Hebei bighead atractylodes rhizome, and what do not occur amplified band at 778bp place is not the Hebei bighead atractylodes rhizome.
Compared with prior art, beneficial effect of the present invention is mainly reflected in: (1) the present invention according to gel electrophoresis at 778bp place with or without the foundation of amplified band as the qualification Hebei bighead atractylodes rhizome, single or mixing bighead atractylodes rhizome DNA sample can be detected, detect accurate, highly sensitive, simple to operate, consuming time short, reproducible; (2) primer HBZ1 and HBZ2 and PCR reaction soln formula in the bighead atractylodes rhizome PCR identification kit of Hebei is utilized can to manufacture Hebei bighead atractylodes rhizome identification kit; (3) the invention provides a kind of fast, the method for the precise Identification Hebei bighead atractylodes rhizome, Hebei bighead atractylodes rhizome Chinese medicine seed selection breeding can be widely used in, plant, storage of gathering, sale, each link of clinical application cultivar identification, in the discriminating Chinese medicine true and false, hit adulterant, strengthen traditional Chinese medicine quality supervision, promote that modernization of Chinese medicine development aspect is significant.
(4) accompanying drawing explanation
Fig. 1 is the electrophorograms of 14 kinds of trial-products after the qualification of PCR detection method, swimming lane 1 ~ 14 is respectively the Hebei bighead atractylodes rhizome, the Zhejiang bighead atractylodes rhizome, the flat art in Hunan, emblem, Anhui art, rhizoma atractylodis, atractylodes japonica, Flos Chrysanthemi, mother chrysanthemum, taraxacum, Sunflower Receptacle, sealwort, Thunberg Fritillary Bulb, RADIX OPHIOPOGONIS from Hangzhou of China, Motherwort Herb, and swimming lane M is marker.
Fig. 2 is the electrophorogram of the Hebei bighead atractylodes rhizome after the qualification of PCR detection method of different concns, and swimming lane M is Marker, and swimming lane 1 is 0.08ng/ μ L, and swimming lane 2 is 0.8/ μ L, and swimming lane 3 is 8ng/ μ L.
Fig. 3 is the electrophorogram of biased sample after the qualification of PCR detection method, and swimming lane 1 is the DNA mixing solutions of the Hebei bighead atractylodes rhizome, the Zhejiang bighead atractylodes rhizome, the flat art in Hunan and emblem, Anhui art, and swimming lane 2 is the DNA mixing solutions of the Zhejiang bighead atractylodes rhizome, the flat art in Hunan and emblem, Anhui art, and swimming lane M is marker.
(5) embodiment
Below in conjunction with specific embodiment, the present invention is described further, but protection scope of the present invention is not limited in this:
Embodiment 1
1, the acquisition of Hebei bighead atractylodes rhizome PCR detection method key reagents PCR primer
Appliable plant genomic dna rapid extraction test kit extracts genomic dna respectively from the Zhejiang bighead atractylodes rhizome, the Hebei bighead atractylodes rhizome, the flat art in Hunan and emblem, Anhui art.RAPD TRAP is used to carry out RAPD analysis to four kinds of bighead atractylodes rhizomes, screening acquisition Hebei bighead atractylodes rhizome specific amplification band, this specific amplification band only appears in the bighead atractylodes rhizome kind of Hebei, do not have in other bighead atractylodes rhizome kinds, namely the DNA molecular in this band is Hebei bighead atractylodes rhizome specific DNA molecule marker.Hebei bighead atractylodes rhizome specific DNA molecule marker is reclaimed, clones, checked order from sepharose, and sequencing result is shown in shown in SEQ ID NO.1, called after HBZ835.
According to HBZ835 sequence, design a pair Auele Specific Primer HBZ1 and HBZ2, primer sequence is:
HBZ1:5’-GGACATGACAGAAGTATG-3’,
HBZ2:5’-TGCTGAGAGAAGCAAATC-3’。
The site that upstream and downstream primer is chosen to correspond respectively on HBZ835 sequence site 56-73's and 816-833.
SEQ ID NO.1 is:
5'-GACAAAGCTCAACTTTCTTCTGACATCGGAGGCAACAGTAGCAATTAGGTATGGTGGACATGACAGAAGTATGTCCGCTGTACCTTATGTCAGACTACTGCTTTCCAACGGAAGTCAGGTCTTCAACGGAGATGTCTTGAGTGGCTATTAAACACTCCATCTCCTCATACAGATCTTCAGTAGTATTTGTAGAGTGCAACGGAGGTCTTTCGCAATGACTTCCGTAGGCTCATGGAGTTCCACGTAATCTTTGATTCCGTAGACGATTTGTACCTGTACTGAAGTTGATCAGTGCTCAGCATATGAGTTATTTCCGTTCTACGGAAACCTAAGATTCATTGCACTTCCGAAGTCCAATGGAAATTATTCCGTGGACTGACACACACCGAGAGACTAAGTTACTCTTGTCTTATGGACCAAAAACTCCATAGGACAACTTAGCCTATACGCACACAGAGGCATACGGAACACAAGTTCCGTATCCTTAACACACAATAACTACGGAAAACAGATTCCATAGTGAAAACTTGTTTAAGTACATTTGCCAACGGAACACAGGTTCCGTAGGCCAATCACATGTCTTACAGAACAGGAATTTCGTAAGGCATTTCTCACAGCTTACGCACACAGCAAAACAAAGTTAGTGAATTCATCAAATCTTAACAACGGAGATCCCAACACATGAAATAAGCTGATGTTGGGCTTCCTTCCAGTAAATACTTCATAAGCTGTTTTGCGATGTCTTTTGACAATGATTGACCTATTCTGAGTGAAACAGACAGTATTTATTGCTTCAGCCCAAAACTGAGTAGGAAGATTTGCTTCTCTCAGCATT-3'
2, the PCR detection method of the Hebei bighead atractylodes rhizome
(1) traditional extraction method is adopted to extract the template of trial-product DNA as PCR; With the quality of electrophoretic method (same to step (3)) detection template DNA, band is clear without disperse, is the template DNA meeting PCR reaction;
(2) according to external synthesizer synthetic primer HBZ1 and HBZ2 of sequence of HBZ1 and HBZ2.With HBZ1 and HBZ2 for primer carries out pcr amplification.
According to following recipe configuration PCR reaction soln:
PCR reaction soln is put into the PCR instrument that automatically increases and carry out pcr amplification reaction, response procedures is set to:
94 DEG C of denaturation 3min, 94 DEG C of sex change 45s, 60 ~ 65 DEG C of renaturation 45s, 72 DEG C extend 1min, 35 circulations, and last 72 DEG C extend 7min.
(3) PCR primer carries out electrophoresis detection: the reaction solution 5 μ L taken out after pcr amplification mixes with sample loading buffer 1 μ L, amplification is detected with 1.2% agarose gel electrophoresis (containing 0.5% ethidium bromide), occur that at 778bp place the sample of amplified band is the Hebei bighead atractylodes rhizome, do not occur that at 778bp place the sample of band is not the Hebei bighead atractylodes rhizome.
Embodiment 2:
1, the study on accuracy of Hebei bighead atractylodes rhizome PCR detection method
From the Zhejiang bighead atractylodes rhizome, the Hebei bighead atractylodes rhizome, the flat art in Hunan, emblem, Anhui art, rhizoma atractylodis, atractylodes japonica, Flos Chrysanthemi, mother chrysanthemum, sealwort, taraxacum, Sunflower Receptacle, Thunberg Fritillary Bulb, RADIX OPHIOPOGONIS from Hangzhou of China, extract genomic dna this 14 kind of plant of Motherwort Herb.With the genomic dna of above-mentioned 14 kinds of kinds for template, Auele Specific Primer " HBZ1/HBZ2 " is utilized to carry out pcr amplification, PCR reaction solution, amplification program, detection method are with embodiment 1, just change DNA profiling, to verify accuracy and the reliability of Hebei bighead atractylodes rhizome PCR detection method, the results are shown in Figure shown in 1, swimming lane 1 ~ 14 be respectively the Hebei bighead atractylodes rhizome, the Zhejiang bighead atractylodes rhizome, the flat art in Hunan, emblem, Anhui art, rhizoma atractylodis, atractylodes japonica, Flos Chrysanthemi, mother chrysanthemum, taraxacum, Sunflower Receptacle, sealwort, Thunberg Fritillary Bulb, RADIX OPHIOPOGONIS from Hangzhou of China, Motherwort Herb, swimming lane M is marker.
Fig. 1 shows, the Hebei bighead atractylodes rhizome has specific amplified band at 778bp place, and other kinds do not have.Hebei of the present invention bighead atractylodes rhizome PCR detection method the experiment proved that the qualification that may be used for the Hebei bighead atractylodes rhizome, and method accuracy is high, simple, efficiency is high, reproducible.
2, the sensitivity study of Hebei bighead atractylodes rhizome PCR detection method
Original Hebei bighead atractylodes rhizome template DNA concentration (80ng/ μ L) is diluted through three gradients, the Hebei bighead atractylodes rhizome Genomic DNA solution of configuration three parts of different concns: a concentration is 10%, i.e. 8ng/ μ L of original Hebei bighead atractylodes rhizome template DNA concentration; A concentration is 1%, i.e. 0.8ng/ μ L of original Hebei bighead atractylodes rhizome template DNA concentration; A concentration is 1 ‰, i.e. 0.08ng/ μ L of original Hebei bighead atractylodes rhizome template DNA concentration.
Respectively using the Hebei bighead atractylodes rhizome genomic dna of these three kinds of different concns as template (1.2 μ L), with " HBZ1/HBZ2 " for primer carries out pcr amplification, PCR reaction solution, amplification program, detection method are with embodiment 1, to verify the sensitivity of Hebei bighead atractylodes rhizome PCR detection method, the results are shown in Figure shown in 3, swimming lane M is Marker, and swimming lane 1 is 0.08ng/ μ L, swimming lane 2 is 0.8ng/ μ L, and swimming lane 3 is 8ng/ μ L.
It is 1 ‰ of primary template normal concentration that Hebei bighead atractylodes rhizome templet gene group DNA concentration is worked as in result display, namely when content is only 0.08ng, the specific band of the Hebei bighead atractylodes rhizome is still there is at 778bp place, through repeatedly repeated authentication, result keeps stable, prove that Hebei provided by the invention bighead atractylodes rhizome PCR detection method sensitivity is very high, the atomic weak Hebei bighead atractylodes rhizome of content also can be identified out.
3, Hebei bighead atractylodes rhizome PCR detection method is to the identification result of biased sample
Configure two parts of different genomic dna mixing solutionss: group 1 is the DNA mixing solutions of the Zhejiang bighead atractylodes rhizome, the Hebei bighead atractylodes rhizome, the flat art in Hunan and emblem, Anhui art, and four equivalent add, and concentration is respectively 1/4th of original concentration (80ng/ μ L); Group 2 is the genomic dna mixing solutions of the Zhejiang bighead atractylodes rhizome, the flat art in Hunan and emblem, Anhui art, and three's equivalent adds, and concentration is respectively 1/3rd of original concentration (80ng/ μ L).
Using these two portions different DNA mixed solutions as template, with " HBZ1/HBZ2 " for primer carries out pcr amplification, PCR reaction solution, amplification program, detection method with embodiment 1, to study Hebei bighead atractylodes rhizome PCR detection method to the identification result of biased sample.Experimental result is shown in Fig. 3, and swimming lane M is Marker, and swimming lane 1 is group 1, and swimming lane 2 is group 2.
Fig. 3 shows, group 1 adds the biased sample of the Hebei bighead atractylodes rhizome after PCR detects, and result is presented at 778bp place and occurs bright amplified band.Group 2 does not add the biased sample of the Hebei bighead atractylodes rhizome after PCR detects, and result is presented at 778bp place and does not occur band, and the Hebei bighead atractylodes rhizome is well identified out in the mixing material of four kinds of bighead atractylodes rhizomes.Through repeatedly repeated authentication, result keeps stable, and this demonstrates Hebei of the present invention bighead atractylodes rhizome PCR detection method and has high accuracy, can identify the Hebei bighead atractylodes rhizome in mixing medicinal material sample.Experiment proves that this method not only can detect single Hebei bighead atractylodes rhizome sample, and can also detect the Hebei bighead atractylodes rhizome in the mixture, range of application is wider.

Claims (3)

1. a Hebei bighead atractylodes rhizome PCR identification kit, the Auele Specific Primer that it is characterized in that in described test kit is that the sequence of HBZ1 and HBZ2, HBZ1 and HBZ2 is as follows:
HBZ1:5’-GGACATGACAGAAGTATG-3’;
HBZ2:5’-TGCTGAGAGAAGCAAATC-3’。
2. Hebei bighead atractylodes rhizome PCR identification kit as claimed in claim 1, is characterized in that consisting of of described Hebei bighead atractylodes rhizome PCR identification kit:
3. utilize the method that described in claim 1, Hebei bighead atractylodes rhizome PCR identification kit is identified the Hebei bighead atractylodes rhizome, it is characterized in that described method is:
(1) extraction of template DNA and quality evalution: extract the template of trial-product DNA as PCR; With the quality of electrophoretic method detection template DNA, band is clear without disperse, is the template DNA meeting PCR reaction;
(2) PCR qualification: utilize Auele Specific Primer HBZ1 and HBZ2 in the bighead atractylodes rhizome PCR identification kit of Hebei, carry out pcr amplification:
PCR reaction soln is put into the PCR instrument that automatically increases and carry out pcr amplification reaction, response procedures is set to: 94 DEG C of denaturation 3min, 94 DEG C of sex change 45s, 60 ~ 65 DEG C of renaturation 45s, and 72 DEG C extend 1min, 35 circulations, last 72 DEG C of extension 7min;
(3) PCR primer carries out electrophoresis detection: take out pcr amplification product 5 μ L and mix with sample loading buffer 1 μ L, detect amplification with 1.2% agarose gel electrophoresis, and what occur amplified band at 778bp place is the Hebei bighead atractylodes rhizome.
CN201510181371.9A 2015-04-16 2015-04-16 PCR (Polymerase chain reaction) identification kit and identification method for largehead atractylode in Hebei Active CN104774948B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201510181371.9A CN104774948B (en) 2015-04-16 2015-04-16 PCR (Polymerase chain reaction) identification kit and identification method for largehead atractylode in Hebei

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201510181371.9A CN104774948B (en) 2015-04-16 2015-04-16 PCR (Polymerase chain reaction) identification kit and identification method for largehead atractylode in Hebei

Publications (2)

Publication Number Publication Date
CN104774948A true CN104774948A (en) 2015-07-15
CN104774948B CN104774948B (en) 2017-04-12

Family

ID=53616712

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201510181371.9A Active CN104774948B (en) 2015-04-16 2015-04-16 PCR (Polymerase chain reaction) identification kit and identification method for largehead atractylode in Hebei

Country Status (1)

Country Link
CN (1) CN104774948B (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108588260A (en) * 2018-05-15 2018-09-28 浙江工业大学 Osmanthus Radix Curcumae PCR identification kits and identification method
CN108624708A (en) * 2018-05-15 2018-10-09 浙江工业大学 Green silk Radix Curcumae PCR identification kits and identification method
CN114032328A (en) * 2021-11-26 2022-02-11 浙江工业大学 Huaijuan PCR identification kit and application thereof

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101230389A (en) * 2007-12-05 2008-07-30 浙江大学 Chinese medicine atractylodes polymerase chain reaction identification primers and identification method
CN104073553A (en) * 2014-04-18 2014-10-01 浙江工业大学 Hubei radix ophiopogonis PCR (Polymerase Chain Reaction) identification kit and identification method

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101230389A (en) * 2007-12-05 2008-07-30 浙江大学 Chinese medicine atractylodes polymerase chain reaction identification primers and identification method
CN104073553A (en) * 2014-04-18 2014-10-01 浙江工业大学 Hubei radix ophiopogonis PCR (Polymerase Chain Reaction) identification kit and identification method

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
朱振洪 等: "四种不同产地白术的DNA随机扩增多态性研究", 《浙江中医药大学学报》 *
王宗宽 等: "白术不同居群亲缘关系RAPD分析", 《安徽林业科技》 *

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108588260A (en) * 2018-05-15 2018-09-28 浙江工业大学 Osmanthus Radix Curcumae PCR identification kits and identification method
CN108624708A (en) * 2018-05-15 2018-10-09 浙江工业大学 Green silk Radix Curcumae PCR identification kits and identification method
CN108588260B (en) * 2018-05-15 2019-11-29 浙江工业大学 Osmanthus Radix Curcumae PCR identification kit and identification method
CN108624708B (en) * 2018-05-15 2019-11-29 浙江工业大学 Green silk Radix Curcumae PCR identification kit and identification method
CN114032328A (en) * 2021-11-26 2022-02-11 浙江工业大学 Huaijuan PCR identification kit and application thereof
CN114032328B (en) * 2021-11-26 2023-08-08 浙江工业大学 Huaihu PCR identification kit and application

Also Published As

Publication number Publication date
CN104774948B (en) 2017-04-12

Similar Documents

Publication Publication Date Title
CN104073553B (en) Hubei PCR tuber of dwarf lilyturf identification kit and authentication method
WO2019237906A1 (en) Fluorescence pcr detection kit for identifying dendrobium officinale kimura et migo and use
Huang et al. Identification of Crocus sativus and its adulterants from Chinese markets by using DNA barcoding technique
CN105483282A (en) PCR specificity identifying primers and paris polyphylla identifying method adopting same
CN107557434A (en) Thin shell mountain pecan Peach cultivars Van Deman characteristic sequence, labeled primer and authentication method
CN106636342A (en) EST-SSR marker primer group developed on basis of sequence of transcriptome of ligusticum wallichii, and acquisition method and application of EST-SSR marker primer group
CN104004818A (en) Method for identifying Chinese angelica and its adulterants by utilizing ITS sequence
CN106011228A (en) EST-SSR core primer group for identifying variety of Chinese wolfberry and identification method and application thereof
CN104774948A (en) PCR (Polymerase chain reaction) identification kit and identification method for largehead atractylode in Hebei
CN102899409B (en) PCR identification kit for Thunberg fritillary bulb and identification method
Li et al. Three new Russula species in sect. Ingratae (Russulales, Basidiomycota) from southern China
CN107630102B (en) PCR identification kit and identification method for radix paeoniae alba
Wang et al. Identification and poisoning diagnosis of Aconitum materials using a genus-specific nucleotide signature
CN105063203A (en) Primers and probe for real-time fluorescent PCR detection of P. ginseng and detection method thereof
CN103834735B (en) Nucleotide sequence and molecular probe for identifying dendrobium officinale and applications of molecular probe
CN105274245B (en) A kind of method and its special primer pair for identifying David's-harp
CN101962681B (en) Gene chip for detecting genuine coptis medicinal materials
CN104531838B (en) Rhizoma atractylodis macrocephalae PCR identification kit and identification method thereof
CN107604054B (en) Method based on fluorescence SSR capillary electrophoresis technique Rapid identification locust tree polyploid
CN109055603A (en) A method of building paris plant finger-print is marked using CDDP
CN108588260B (en) Osmanthus Radix Curcumae PCR identification kit and identification method
CN104862396B (en) River tuber of dwarf lilyturf PCR identification kits and authentication method
CN110097976B (en) Biological component analysis method of traditional Chinese medicine compound preparation
CN104830971A (en) American ginseng molecule ID and identification method
CN109022610A (en) A kind of molecular specificity labeled primers and its discrimination method of roxburgh anoectochilus terminal bud

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
EXSB Decision made by sipo to initiate substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant
TR01 Transfer of patent right

Effective date of registration: 20201010

Address after: 221300 north side of Qingnian East Road, Yunhe Town, Pizhou City, Xuzhou City, Jiangsu Province

Patentee after: Pizhou Runhong Industry Co.,Ltd.

Address before: 510000 unit 2414-2416, building, No. five, No. 371, Tianhe District, Guangdong, China

Patentee before: GUANGDONG GAOHANG INTELLECTUAL PROPERTY OPERATION Co.,Ltd.

Effective date of registration: 20201010

Address after: 510000 unit 2414-2416, building, No. five, No. 371, Tianhe District, Guangdong, China

Patentee after: GUANGDONG GAOHANG INTELLECTUAL PROPERTY OPERATION Co.,Ltd.

Address before: 310014 Hangzhou city in the lower reaches of the city of Zhejiang Wang Road, No. 18

Patentee before: ZHEJIANG University OF TECHNOLOGY

TR01 Transfer of patent right