(2) background technology
The multiple medicinal functions such as the bighead atractylodes rhizome is the dry rhizome for feverfew bighead atractylodes rhizome Atractylodes macrocephala Koidz., has invigorating the spleen and benefiting QI, eliminating dampness Li Shui, hidroschesis, antiabortive, apply comparatively extensive clinically.Bighead atractylodes rhizome kind is more, and principal item comprises the Hebei bighead atractylodes rhizome, the Zhejiang bighead atractylodes rhizome, the flat art in Hunan, emblem, Anhui art, originates from Hebei, Zhejiang, Hunan and Anhui respectively.Wherein the Hebei bighead atractylodes rhizome has another name called " the little bighead atractylodes rhizome ", and output is the highest, and medicinal ingredients and some difference of other kinds.Because bighead atractylodes rhizome planting base in Hebei constantly expands in recent years, germ plasm resource is chaotic and phenomenon of adulterating is comparatively serious, bighead atractylodes rhizome kind is made to the expanding species and traditional Chinese medicine quality supervision identifying accurately and be conducive to the bighead atractylodes rhizome.
Now outward appearance qualification is mainly comprised to the authentication method of the Different sources bighead atractylodes rhizome, the technology such as chemical reagent, spectrum, nucleus magnetic resonance are utilized to carry out physico-chemical property qualification, but because the sibship of the Different sources bighead atractylodes rhizome is nearer, cause form more similar with physico-chemical property, utilize the more difficult qualification of traditional Chinese medicine authentication method.Along with the development of biology techniques, applied molecular biology means, utilize the otherness of Chinese medicine gene order to carry out Molecular Identification to Chinese medicine, have the advantage such as many such as short accurate, easy, reproducible, consuming time.
Property good plurality of advantages, the result of qualification is by the impact in the sample place of production, growing environment and source.PCR detection method provided by the invention is exactly the DNA molecular authentication method of a kind of Hebei bighead atractylodes rhizome, can the precise Identification Hebei bighead atractylodes rhizome.Current bibliographical information traditional identification and assessment of Chinese medicines means are to the method that precise Identification made by the Hebei bighead atractylodes rhizome, there is not been reported to utilize PCR detection method to carry out qualification to the Hebei bighead atractylodes rhizome.
(3) summary of the invention
The object of the invention be to provide a kind of can the PCR identification kit of the precise Identification Chinese medicine Hebei bighead atractylodes rhizome and detection method, comprise the detecting step of PCR detection method key reagents PCR primer, template and PCR detection method.
The technical solution used in the present invention is:
The invention provides a kind of Hebei bighead atractylodes rhizome PCR identification kit, the Auele Specific Primer in described test kit is HBZ1 (SEQ ID NO.2) and HBZ2 (SEQ ID NO.3):
HBZ1:5’-GGACATGACAGAAGTATG-3’,
HBZ2:5’-TGCTGAGAGAAGCAAATC-3’。
Further, consisting of of described Hebei bighead atractylodes rhizome PCR identification kit:
The invention still further relates to a kind of method utilizing described Hebei bighead atractylodes rhizome PCR identification kit to identify the Hebei bighead atractylodes rhizome, described method is:
(1) extraction of template DNA and quality evalution: adopt traditional extraction method to extract the template of trial-product DNA as PCR; With the quality of electrophoretic method detection template DNA (the same step of detection method (3)), band is clear without disperse, is the template DNA meeting PCR reaction;
(2) PCR qualification: utilize Auele Specific Primer HBZ2 and HBZ3 in the bighead atractylodes rhizome PCR identification kit of Hebei, carry out pcr amplification:
PCR reaction soln:
PCR reaction soln is put into the PCR instrument that automatically increases and carry out pcr amplification reaction, response procedures is set to: 94 DEG C of denaturation 3min, 94 DEG C of sex change 45s, 60-65 DEG C of renaturation 45s, and 72 DEG C extend 1min, 35 circulations, last 72 DEG C of extension 7min;
(3) PCR primer carries out electrophoresis detection: take out pcr amplification product (reaction solution namely after amplified reaction) 5 μ L and mix with sample loading buffer 1 μ L, amplification is detected with 1.2% agarose gel electrophoresis (containing 0.5% ethidium bromide), what occur amplified band at 778bp place is the Hebei bighead atractylodes rhizome, and what do not occur amplified band at 778bp place is not the Hebei bighead atractylodes rhizome.
Compared with prior art, beneficial effect of the present invention is mainly reflected in: (1) the present invention according to gel electrophoresis at 778bp place with or without the foundation of amplified band as the qualification Hebei bighead atractylodes rhizome, single or mixing bighead atractylodes rhizome DNA sample can be detected, detect accurate, highly sensitive, simple to operate, consuming time short, reproducible; (2) primer HBZ1 and HBZ2 and PCR reaction soln formula in the bighead atractylodes rhizome PCR identification kit of Hebei is utilized can to manufacture Hebei bighead atractylodes rhizome identification kit; (3) the invention provides a kind of fast, the method for the precise Identification Hebei bighead atractylodes rhizome, Hebei bighead atractylodes rhizome Chinese medicine seed selection breeding can be widely used in, plant, storage of gathering, sale, each link of clinical application cultivar identification, in the discriminating Chinese medicine true and false, hit adulterant, strengthen traditional Chinese medicine quality supervision, promote that modernization of Chinese medicine development aspect is significant.
(4) accompanying drawing explanation
Fig. 1 is the electrophorograms of 14 kinds of trial-products after the qualification of PCR detection method, swimming lane 1 ~ 14 is respectively the Hebei bighead atractylodes rhizome, the Zhejiang bighead atractylodes rhizome, the flat art in Hunan, emblem, Anhui art, rhizoma atractylodis, atractylodes japonica, Flos Chrysanthemi, mother chrysanthemum, taraxacum, Sunflower Receptacle, sealwort, Thunberg Fritillary Bulb, RADIX OPHIOPOGONIS from Hangzhou of China, Motherwort Herb, and swimming lane M is marker.
Fig. 2 is the electrophorogram of the Hebei bighead atractylodes rhizome after the qualification of PCR detection method of different concns, and swimming lane M is Marker, and swimming lane 1 is 0.08ng/ μ L, and swimming lane 2 is 0.8/ μ L, and swimming lane 3 is 8ng/ μ L.
Fig. 3 is the electrophorogram of biased sample after the qualification of PCR detection method, and swimming lane 1 is the DNA mixing solutions of the Hebei bighead atractylodes rhizome, the Zhejiang bighead atractylodes rhizome, the flat art in Hunan and emblem, Anhui art, and swimming lane 2 is the DNA mixing solutions of the Zhejiang bighead atractylodes rhizome, the flat art in Hunan and emblem, Anhui art, and swimming lane M is marker.
(5) embodiment
Below in conjunction with specific embodiment, the present invention is described further, but protection scope of the present invention is not limited in this:
Embodiment 1
1, the acquisition of Hebei bighead atractylodes rhizome PCR detection method key reagents PCR primer
Appliable plant genomic dna rapid extraction test kit extracts genomic dna respectively from the Zhejiang bighead atractylodes rhizome, the Hebei bighead atractylodes rhizome, the flat art in Hunan and emblem, Anhui art.RAPD TRAP is used to carry out RAPD analysis to four kinds of bighead atractylodes rhizomes, screening acquisition Hebei bighead atractylodes rhizome specific amplification band, this specific amplification band only appears in the bighead atractylodes rhizome kind of Hebei, do not have in other bighead atractylodes rhizome kinds, namely the DNA molecular in this band is Hebei bighead atractylodes rhizome specific DNA molecule marker.Hebei bighead atractylodes rhizome specific DNA molecule marker is reclaimed, clones, checked order from sepharose, and sequencing result is shown in shown in SEQ ID NO.1, called after HBZ835.
According to HBZ835 sequence, design a pair Auele Specific Primer HBZ1 and HBZ2, primer sequence is:
HBZ1:5’-GGACATGACAGAAGTATG-3’,
HBZ2:5’-TGCTGAGAGAAGCAAATC-3’。
The site that upstream and downstream primer is chosen to correspond respectively on HBZ835 sequence site 56-73's and 816-833.
SEQ ID NO.1 is:
5'-GACAAAGCTCAACTTTCTTCTGACATCGGAGGCAACAGTAGCAATTAGGTATGGTGGACATGACAGAAGTATGTCCGCTGTACCTTATGTCAGACTACTGCTTTCCAACGGAAGTCAGGTCTTCAACGGAGATGTCTTGAGTGGCTATTAAACACTCCATCTCCTCATACAGATCTTCAGTAGTATTTGTAGAGTGCAACGGAGGTCTTTCGCAATGACTTCCGTAGGCTCATGGAGTTCCACGTAATCTTTGATTCCGTAGACGATTTGTACCTGTACTGAAGTTGATCAGTGCTCAGCATATGAGTTATTTCCGTTCTACGGAAACCTAAGATTCATTGCACTTCCGAAGTCCAATGGAAATTATTCCGTGGACTGACACACACCGAGAGACTAAGTTACTCTTGTCTTATGGACCAAAAACTCCATAGGACAACTTAGCCTATACGCACACAGAGGCATACGGAACACAAGTTCCGTATCCTTAACACACAATAACTACGGAAAACAGATTCCATAGTGAAAACTTGTTTAAGTACATTTGCCAACGGAACACAGGTTCCGTAGGCCAATCACATGTCTTACAGAACAGGAATTTCGTAAGGCATTTCTCACAGCTTACGCACACAGCAAAACAAAGTTAGTGAATTCATCAAATCTTAACAACGGAGATCCCAACACATGAAATAAGCTGATGTTGGGCTTCCTTCCAGTAAATACTTCATAAGCTGTTTTGCGATGTCTTTTGACAATGATTGACCTATTCTGAGTGAAACAGACAGTATTTATTGCTTCAGCCCAAAACTGAGTAGGAAGATTTGCTTCTCTCAGCATT-3'
2, the PCR detection method of the Hebei bighead atractylodes rhizome
(1) traditional extraction method is adopted to extract the template of trial-product DNA as PCR; With the quality of electrophoretic method (same to step (3)) detection template DNA, band is clear without disperse, is the template DNA meeting PCR reaction;
(2) according to external synthesizer synthetic primer HBZ1 and HBZ2 of sequence of HBZ1 and HBZ2.With HBZ1 and HBZ2 for primer carries out pcr amplification.
According to following recipe configuration PCR reaction soln:
PCR reaction soln is put into the PCR instrument that automatically increases and carry out pcr amplification reaction, response procedures is set to:
94 DEG C of denaturation 3min, 94 DEG C of sex change 45s, 60 ~ 65 DEG C of renaturation 45s, 72 DEG C extend 1min, 35 circulations, and last 72 DEG C extend 7min.
(3) PCR primer carries out electrophoresis detection: the reaction solution 5 μ L taken out after pcr amplification mixes with sample loading buffer 1 μ L, amplification is detected with 1.2% agarose gel electrophoresis (containing 0.5% ethidium bromide), occur that at 778bp place the sample of amplified band is the Hebei bighead atractylodes rhizome, do not occur that at 778bp place the sample of band is not the Hebei bighead atractylodes rhizome.
Embodiment 2:
1, the study on accuracy of Hebei bighead atractylodes rhizome PCR detection method
From the Zhejiang bighead atractylodes rhizome, the Hebei bighead atractylodes rhizome, the flat art in Hunan, emblem, Anhui art, rhizoma atractylodis, atractylodes japonica, Flos Chrysanthemi, mother chrysanthemum, sealwort, taraxacum, Sunflower Receptacle, Thunberg Fritillary Bulb, RADIX OPHIOPOGONIS from Hangzhou of China, extract genomic dna this 14 kind of plant of Motherwort Herb.With the genomic dna of above-mentioned 14 kinds of kinds for template, Auele Specific Primer " HBZ1/HBZ2 " is utilized to carry out pcr amplification, PCR reaction solution, amplification program, detection method are with embodiment 1, just change DNA profiling, to verify accuracy and the reliability of Hebei bighead atractylodes rhizome PCR detection method, the results are shown in Figure shown in 1, swimming lane 1 ~ 14 be respectively the Hebei bighead atractylodes rhizome, the Zhejiang bighead atractylodes rhizome, the flat art in Hunan, emblem, Anhui art, rhizoma atractylodis, atractylodes japonica, Flos Chrysanthemi, mother chrysanthemum, taraxacum, Sunflower Receptacle, sealwort, Thunberg Fritillary Bulb, RADIX OPHIOPOGONIS from Hangzhou of China, Motherwort Herb, swimming lane M is marker.
Fig. 1 shows, the Hebei bighead atractylodes rhizome has specific amplified band at 778bp place, and other kinds do not have.Hebei of the present invention bighead atractylodes rhizome PCR detection method the experiment proved that the qualification that may be used for the Hebei bighead atractylodes rhizome, and method accuracy is high, simple, efficiency is high, reproducible.
2, the sensitivity study of Hebei bighead atractylodes rhizome PCR detection method
Original Hebei bighead atractylodes rhizome template DNA concentration (80ng/ μ L) is diluted through three gradients, the Hebei bighead atractylodes rhizome Genomic DNA solution of configuration three parts of different concns: a concentration is 10%, i.e. 8ng/ μ L of original Hebei bighead atractylodes rhizome template DNA concentration; A concentration is 1%, i.e. 0.8ng/ μ L of original Hebei bighead atractylodes rhizome template DNA concentration; A concentration is 1 ‰, i.e. 0.08ng/ μ L of original Hebei bighead atractylodes rhizome template DNA concentration.
Respectively using the Hebei bighead atractylodes rhizome genomic dna of these three kinds of different concns as template (1.2 μ L), with " HBZ1/HBZ2 " for primer carries out pcr amplification, PCR reaction solution, amplification program, detection method are with embodiment 1, to verify the sensitivity of Hebei bighead atractylodes rhizome PCR detection method, the results are shown in Figure shown in 3, swimming lane M is Marker, and swimming lane 1 is 0.08ng/ μ L, swimming lane 2 is 0.8ng/ μ L, and swimming lane 3 is 8ng/ μ L.
It is 1 ‰ of primary template normal concentration that Hebei bighead atractylodes rhizome templet gene group DNA concentration is worked as in result display, namely when content is only 0.08ng, the specific band of the Hebei bighead atractylodes rhizome is still there is at 778bp place, through repeatedly repeated authentication, result keeps stable, prove that Hebei provided by the invention bighead atractylodes rhizome PCR detection method sensitivity is very high, the atomic weak Hebei bighead atractylodes rhizome of content also can be identified out.
3, Hebei bighead atractylodes rhizome PCR detection method is to the identification result of biased sample
Configure two parts of different genomic dna mixing solutionss: group 1 is the DNA mixing solutions of the Zhejiang bighead atractylodes rhizome, the Hebei bighead atractylodes rhizome, the flat art in Hunan and emblem, Anhui art, and four equivalent add, and concentration is respectively 1/4th of original concentration (80ng/ μ L); Group 2 is the genomic dna mixing solutions of the Zhejiang bighead atractylodes rhizome, the flat art in Hunan and emblem, Anhui art, and three's equivalent adds, and concentration is respectively 1/3rd of original concentration (80ng/ μ L).
Using these two portions different DNA mixed solutions as template, with " HBZ1/HBZ2 " for primer carries out pcr amplification, PCR reaction solution, amplification program, detection method with embodiment 1, to study Hebei bighead atractylodes rhizome PCR detection method to the identification result of biased sample.Experimental result is shown in Fig. 3, and swimming lane M is Marker, and swimming lane 1 is group 1, and swimming lane 2 is group 2.
Fig. 3 shows, group 1 adds the biased sample of the Hebei bighead atractylodes rhizome after PCR detects, and result is presented at 778bp place and occurs bright amplified band.Group 2 does not add the biased sample of the Hebei bighead atractylodes rhizome after PCR detects, and result is presented at 778bp place and does not occur band, and the Hebei bighead atractylodes rhizome is well identified out in the mixing material of four kinds of bighead atractylodes rhizomes.Through repeatedly repeated authentication, result keeps stable, and this demonstrates Hebei of the present invention bighead atractylodes rhizome PCR detection method and has high accuracy, can identify the Hebei bighead atractylodes rhizome in mixing medicinal material sample.Experiment proves that this method not only can detect single Hebei bighead atractylodes rhizome sample, and can also detect the Hebei bighead atractylodes rhizome in the mixture, range of application is wider.