CN101962681B - Gene chip for detecting genuine coptis medicinal materials - Google Patents
Gene chip for detecting genuine coptis medicinal materials Download PDFInfo
- Publication number
- CN101962681B CN101962681B CN 201010524492 CN201010524492A CN101962681B CN 101962681 B CN101962681 B CN 101962681B CN 201010524492 CN201010524492 CN 201010524492 CN 201010524492 A CN201010524492 A CN 201010524492A CN 101962681 B CN101962681 B CN 101962681B
- Authority
- CN
- China
- Prior art keywords
- coptis
- probe
- chip
- sample
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to the technical field of molecular biology, in particular to a gene chip for detecting genuine coptis medicinal materials and aiming at solving the technical problem that the types of the genuine coptis medicinal materials can not be rapidly and accurately confirmed in the prior art. In order to solve the technical problem, the invention provides the gene chip for detecting the genuine coptis medicinal materials, which comprises a solid phase carrier, wherein the surface of the solid phase carrier is fixed with the oligonucleotide probes contained in the oligonucleotide probe groups of seven genuine coptis medicinal materials, and the oligonucleotide probes can be subjected to hybridization reaction with samples to be tested respectively. The invention has excellent application prospect in the aspect of detecting and identifying the genuine coptis medicinal materials.
Description
Technical field
The present invention relates to technical field of molecular biology, be specifically related to a kind of gene chip that utilizes oligonucleotide probe to detect genuine coptis medicinal materials.
Background technology
According to new medical system reform scheme, Chinese medicine will be responsible for bid, Direct Distribution by country from now on, to reduce unnecessary middle-chain; On price, country also will rationally determine on the basis of profit level, the unified retail price of formulating.But the existing Chinese medicine field of circulation is mixed the genuine with the fictitious, confusion is grown thickly, and the phenomenons such as Chinese medicine fraud, price virtual height are disclosed secret in the industry already.
At present, the counterfeit drug material is full of market.For example, the Starwort Root in Ningxia is replaced by silene jenisseensis Willd.Except counterfeit drug, Chinese medicinal materials usually has a multiple medicines phenomenon.For example say that golden cypress just has two kinds of sources, its contained Berberine quantity differs several times.And for example the Podophyllum emodi var chinense of appearance similar is mistaken for rough gentian, causes the patient to wrongly take and goes into a coma.This has illustrated the importance of identifying the medicinal material true and false.
At present, the medicine of the large usage quantities such as the coptis in Sichuan exists kind more, the situation that counterfeit drug spreads unchecked, such as the coptis, refined company is arranged, and rock connects, and flavor connects, the kinds such as Yun Lian, and Chang Youyong goatweed Rhizoma Picrorhizae (the Picrorhize Kurrooaoyle et Bentham) phenomenon of pretending to be road, Sichuan Herba Munroniae henryi.In addition, the famous and precious medicines such as Unibract Fritillary Bulb as Sichuan Province more exist identification difficulty, shoddy phenomenon.And the authenticity of genuine kind is difficult, and therefore, exploitation one cover fast, authenticate technology and method are imperative easily.
Chinese Pharmacopoeia 2005 editions, the coptis (Coptidis Rhizoma) connects the dry rhizome of Coptisteeta Wall. for the coptis Coplis chinensis Franch. of Ranunculaceae (Ranunculaceae) plant Coptis (Coptis), Coptis deltoidea C.Y.Cheng et Hsiao Coptis deltoidea C.Y.Cheng et Hsiao or cloud, more than three kinds practise respectively and claim " flavor connects ", " refined company ", " cloud connects ".One Coptis authentic medicinal herbs of thinking comprises in plant taxonomy: high eyebrow coptis Coptis omeiensis, rhizoma coptidis teetoidis Coptis teeta, Coptis deltoidea C.Y.Cheng et Hsiao Coptis deltoidea, coptis Coptis chinensis, five leaf coptis Coptisquinquefolia, coptis japonica Makino Coptis japonica, five split the kinds such as coptis Coptis quinquesecta.
Medicinal material is imgenuine, and effective constituent is qualitatively will be untrustworthy.Therefore, since ancient times, whether Chinese medicinal materials is genuine, represents the whether reliable of effective constituent.In brief, be exactly the true and false problem of medicinal material.How to tell truth from falsehood, cover foundation and a way always arranged, that with the eye profile, comes the gustation road with mouth exactly, adds in addition with hand and touches the wrinkle of appearance and the true and false that thickness is differentiated medicinal material.But, the epoch of this way are outdated.Along with the biological development of dna molecular, on molecular level, identify effective material with DNA, just can be perfectly safe.
In existing Chinese medicinal materials true and false product Molecular Identification means, the DNA bar codes technique has the application and development prospect.DNA barcode (DNA barcoding) is that basis is identified species to the analysis of the dna sequence dna of a segment standard, has become the new direction that living species is identified.This area need to be developed the technical scheme that a cover fast, is simply identified the true and false product of the genuine Chinese medicine raw medicinal herbs of Coptis, medicine materical crude slice and goods at present.
Summary of the invention
It is the technical problem that prior art can't be determined the concrete kind of coptis crude drug, medicine materical crude slice or pulverulence quickly and accurately that the present invention will solve.The present invention provides the gene chip that detects genuine coptis medicinal materials in order to solve this technical problem.
The gene chip of this detection genuine coptis medicinal materials comprises solid phase carrier, the surface of described solid phase carrier is fixed with the oligonucleotide probe that the oligonucleotide probe group that detects coptis plant comprises, and described oligonucleotide probe can carry out hybridization with testing sample respectively; Described oligonucleotide probe group contains at least a sequence oligonucleotide probe that is selected from the table 1:
Table 1 detects No. 1 sequence oligonucleotide probe of genuine coptis medicinal materials
| The species name | Sequence | Tm | GC％ | Length |
| The high eyebrow coptis | CTTTCCAGGGGCCGCCCCATGGTAT(SEQ ID No.1) | 59 | 64 | 25 |
| Rhizoma coptidis teetoidis | ACTTTCCAGGGGCCGCCCCATGGTA(SEQ ID No.2) | 59 | 64 | 25 |
| Coptis deltoidea C.Y.Cheng et Hsiao | ACTACTTAACAGGGGGATTCACCG(SEQ ID No.3) | 52 | 50 | 24 |
| The coptis | ACTTTCCAGGGGCCGCCCCATGGTAT(SEQ ID No.4) | 59 | 62 | 26 |
| The five leaf coptiss | GAACTACGGCAGAGCGGTTTA(SEQ ID No.5) | 50 | 52 | 21 |
| Coptis japonica Makino | TGGAGTTCCGCCGGAAGAAGC(SEQ ID No.6) | 53 | 62 | 21 |
| Five split the coptis | ACTTTCCAGGGACCGCCCCATGGTA(SEQ ID No.7) | 58 | 60 | 25 |
Described coptis plant is: high eyebrow coptis Coptis omeiensis, rhizoma coptidis teetoidis Coptis teeta, Coptis deltoidea C.Y.Cheng et Hsiao Coptis deltoidea, coptis Coptis chinensis, five leaf coptis Coptis quinquefolia, coptis japonica Makino Coptis japonica, five split at least a of coptis Coptis quinquesecta.
Further, oligonucleotide probe group in the gene chip of above-mentioned detection genuine coptis medicinal materials also comprises No. 2 sequence oligonucleotide probe that is selected from the corresponding Coptis kind shown in the table 2:
Table 2 detects No. 2 sequence oligonucleotide probe of genuine coptis medicinal materials
| The species name | Sequence | Tm | GC％ | Length |
| The high eyebrow coptis | CTGCGAATTCCGGTTGCTTATG(SEQ ID No.8) | 50 | 50 | 22 |
| Rhizoma coptidis teetoidis | GCTAAGAACTATGGTAGAGCGGT(SEQ ID No.9) | 50 | 48 | 23 |
| Coptis deltoidea C.Y.Cheng et Hsiao | CAGAGAGTTGGGGGTGCCCATCG(SEQ ID No.10) | 57 | 65 | 23 |
| The coptis | CAGAGAGTTGGGAGTGCCCATCG(SEQ ID No.11) | 56 | 61 | 23 |
| The five leaf coptiss | GTGCTGAAGCACTTTATAAAGCAC(SEQ ID No.12) | 49 | 42 | 24 |
| Coptis japonica Makino | TCATATTCACGCTGGGACCGT(SEQ ID No.13) | 49 | 52 | 21 |
| Five split the coptis | ACAAATTGACTTATTATACTCCTG(SEQ ID No.14) | 49 | 29 | 24 |
Namely to select corresponding No. 2 sequence oligonucleotide probe for the kind of the Coptis that detects according to probe groups.
Further, the oligonucleotide probe group of above-mentioned detection Coptis also comprises No. 3 oligonucleotide probe that is selected from the corresponding Coptis kind shown in the table 3:
Table 3 detects No. 3 sequence oligonucleotide probe of genuine coptis medicinal materials
| Plant name | Sequence | Tm | GC％ | Length |
| The high eyebrow coptis | CAGAGAGTTGGGGGTGCCCATCG(SEQ ID No.15) | 57 | 65 | 23 |
| Rhizoma coptidis teetoidis | CAGAGAGTTGGGGGTGCCCATCG(SEQ ID No.16) | 57 | 65 | 23 |
| Coptis deltoidea C.Y.Cheng et Hsiao | ACTTTCCAGGGGCCGCCCCATGG(SEQ ID No.17) | 59 | 70 | 23 |
| The coptis | GCTAAGAACTACGGTAGAGCGGT(SEQ ID No.18) | 52 | 52 | 23 |
| The five leaf coptiss | ATCATGGTATGCATTTCCGTG(SEQ ID No.19) | 49 | 43 | 21 |
| Coptis japonica Makino | CCGTACTACAGTTTGGTGGAGGA(SEQ ID No.20) | 52 | 52 | 23 |
| Five split the coptis | ACTTTCCAGGGACCGCCCCATGG(SEQ ID No.21) | 57 | 65 | 23 |
Namely to select corresponding No. 3 sequence oligonucleotide probe for the kind of the coptis plant that detects according to probe groups.
Above-mentioned the 2nd, No. 3 probe sequence and No. 1 probe to each concrete coptis plant kind united use, can effectively reduce false-positive interference, improves accuracy rate.
Wherein, at least comprise in the oligonucleotide probe group of above-mentioned detection genuine coptis medicinal materials for high eyebrow coptis Coptisomeiensis, rhizoma coptidis teetoidis Coptis teeta, Coptis deltoidea C.Y.Cheng et Hsiao Coptis deltoidea, rhizoma coptidis teetoidis Coptisteeta, coptis Coptis chinensis, five leaf coptis Coptis quinquefolia, coptis japonica Makino Coptis japonica, five split at least a sequence oligonucleotide probe of coptis Coptis quinquesecta.
Further, the surface of the solid phase carrier in the said gene chip also is fixed with positive in probe and negative object of reference.
Wherein, the above-mentioned positive is classified as with reference to the nucleotides sequence of probe:
5’-GCTGCTGTAGCTGCCGAATCTTCTA-3’(SEQ ID No.22)。
Further, the gene chip of above-mentioned detection genuine coptis medicinal materials is fixed with 1～5 probe array shown in the table 4 on the surface of its solid phase carrier:
Table 4 chip dot matrix table
HEX is the fixing positive reference of nucleic acid in the upper table; The sun ginseng is positive with reference to probe, and the nucleotides sequence of sun ginseng is classified 5 '-GCTGCTGTAGCTGCCGAATCTTCTA-3 ' as; Cloudy ginseng is negative object of reference, and is negative with reference to ultrapure water commonly used.
Wherein, the above-mentioned solid phase carrier is the carrier-pellet of aldehyde radical, and every nucleotide probe in the described array repeats 2～5 times.
The present invention also provides a kind of gene chip kit that detects genuine coptis medicinal materials, this test kit comprises above-mentioned gene chip and is used for from the large subunit (ribulose-1 of total DNA amplification its ribulose 1 .5-bisphosphate Carboxylase/oxygenase of testing sample, 5-bisphosphate carboxylase/oxygenase large subunit, rbcL) Auele Specific Primer pair of gene:
5’-ATGTCACCACAAACAGAGACTAAAGC-3’(SEQ ID No.23)
With 5 '-CTTCTGCTACAAATAAGAATCGATCTC-3 ' (SEQ ID No.24).
The present invention also provides a kind of method that detects genuine coptis medicinal materials.The method may further comprise the steps:
Total DNA of a, extraction coptis sample to be checked;
B, from the total DNA that extracts amplification coptis sample rbcL gene to be checked;
C, the rbcL gene that obtains with increasing and above-mentioned gene chip carry out hybrid experiment, and the positive corresponding coptis kind of the probe name of hybrid experiment result is the kind name of coptis sample to be checked.
Further, among the aforesaid method step b amplification coptis sample rbcL gene to be checked primer to being:
5’-ATGTCACCACAAACAGAGACTAAAGC-3’(SEQ ID No.23)
With 5 '-CTTCTGCTACAAATAAGAATCGATCTC-3 ' (SEQ ID No.24).
The method of total DNA of the extraction sample in the aforesaid method, the large subunit gene (ribulose-1 of amplification coptis sample ribulose 1 .5-bisphosphate Carboxylase/oxygenase to be checked, 5-bisphosphate carboxylase/oxygenase large subunit, rbcL) method and with testing sample and sequence oligonucleotide probe carry out the method for hybrid experiment, preparation and the point sample method of gene chip can be finished according to existing Protocols in Molecular Biology, nucleic acid is fixing positive with reference to using this area various objects of reference commonly used.The DNA of above-mentioned coptis sample to be checked can extract from the various states such as crude drug, medicine materical crude slice or powder.
Beneficial effect of the present invention is; Gene chip of the present invention can be judged nearly 7 kinds of genuine coptis medicinal materials accurately, gene chip of the present invention can obtain the result quickly and easily, substantially stopped false-positive appearance, the user of service only needs simple training just can accurately identify the medicinal material kind, need not the expert and participates in; No matter medicinal material is crude drug, medicine materical crude slice or pulverulence, or true and false product hybrid state, this cover test kit can both detect, and testing process is quick, and expense is cheap.Also can detect crude drug, medicine materical crude slice or the pulverulence of the coptis simultaneously, and be accurate to concrete coptis kind, have good application prospect, for this area provides a kind of new selection.
Description of drawings
Fig. 1 is the photo of blank chip
Fig. 2 is the some coremaking sheet scintigram of not hybridizing, and the capable 1-6 of a is Hex; The negative probe of 7-12; The positive probe of 13-18; The capable 1-9 of b is the high eyebrow coptis; 10-18 is rhizoma coptidis teetoidis; The capable 1-9 of c is Coptis deltoidea C.Y.Cheng et Hsiao; 10-18 is the coptis; The capable 1-9 of d is the five leaf coptiss; 10-18 is coptis japonica Makino; The capable 1-9 of e five splits the coptis; 10-18 is blank; The positive probe of the capable 1-6 of f; The negative probe of 7-12; 13-18 is Hex.
Fig. 3 is testing sample rbcL purpose band electrophoresis detection figure, and M is D2000marker; No. 1, No. 2, No. 3 is high eyebrow coptis MH021, MH025, MH029; 4,5, No. 6 is rhizoma coptidis teetoidis MH043, MH044, MH046; 7, No. 8 is Coptis deltoidea C.Y.Cheng et Hsiao MH052, HF053; 9, No. 10 is coptis MH067, MH068; No. 11 is five leaf coptis MH076; No. 12 is coptis japonica Makino MH085; Be for No. 13 five to split coptis MH097.
The high eyebrow coptis of Fig. 4 sample MH021 results of hybridization
Fig. 5 rhizoma coptidis teetoidis sample MH046 results of hybridization
Fig. 6 Coptis deltoidea C.Y.Cheng et Hsiao sample MH052 results of hybridization
Fig. 7 coptis sample MH067 results of hybridization
Fig. 8 five leaf coptis sample MH076 results of hybridization
Fig. 9 coptis japonica Makino sample HF085 results of hybridization
Figure 10 five splits coptis sample HF097 results of hybridization
In Figure 10, the left side is the theoretical results of hybridization mode chart of the various coptiss at Fig. 4, and the right is actual sample results of hybridization.
Embodiment
Below in conjunction with accompanying drawing, the present invention is described in detail by embodiment.
Determining of embodiment one coptis kind to be detected and determining of probe template gene
Coptis kind according to genuine coptis medicinal materials, the present invention determined China's Chinese Medicinal Materials Markets significant 7 kinds of coptis kinds are arranged, wherein the high eyebrow coptis, rhizoma coptidis teetoidis, Coptis deltoidea C.Y.Cheng et Hsiao are the Rhizoma Coptidis representative species of appointment in the Chinese Pharmacopoeia 2005 editions, and the five leaf coptiss and five to split the coptis also be the common species in medicinal material market, and coptis japonica Makino is as the reference species.These kinds are as described in Table 5.
Table 5 the present invention for 7 kinds of coptis plants
Plant chloroplast rbcL gene is one of candidate gene of angiosperm DNA barcode, other candidate gene comprises trnH and ITS sequence, because the amplification efficiency of rbcL is high, favorable reproducibility, and a large amount of data are arranged in the GeneBank database, the gene commonly used that botanical system is grown research, so the present invention is take the rbcL gene order as the stencil design probe.Although the species identification efficiency of ITS sequence is higher than rbcL, it is abundant that the ITS data volume can not show a candle to rbcL in the GeneBank database, therefore do not select the ITS sequence.The trnH sequence data amount of coptis plant is not abundant, and is difficult for amplification.Therefore ITS and trnH are not suitable as DNA of plants the barcode size or text field in practice of the present invention.
KEW (
Royal Botanic Gardens) DNA of plants barcode (DNAbarcoding) candidate gene announced has: matK, rpoC, rpoB, accD, YCF5, ndhJ etc.In pre-stage test of the present invention, because the sequence variations of matK is large, universal primer is difficult to obtain, and amplification efficiency is not high, does not therefore select; Other candidate gene is the applicable special monoid of plant only, and data volume is not abundant, and the application in coptis plant has also run into difficulty, therefore can't select.Therefore the present invention chooses rbcL carries out a step as candidate's probe template research at last.
Determining and analysis of the rbcL sequence of embodiment two coptiss to be detected
1 coptis DNA extraction
The species sample DNA can extract from its Various Tissues organ, and the factors such as the freshness of its sample, store method and shelf time all may affect extracting method and DNA quality.No matter medicinal material is crude drug, medicine materical crude slice or pulverulence, or true and false product hybrid state, plant genomic DNA can be extracted.
According to the characteristics of coptis sample, selected the CTAB method to extract DNA.Concrete extraction step is as follows:
(1) 500 μ l buffer (10mM Tris, 100mM CTAB (full name hexadecyl trimethyl ammonium bromide; Cetrimonium bromide, cetyltriethylammonium bromide), 10mM EDTA, 0.5-1%SDS (full name sodium laurylsulfonate) adds coptis sample;
(2) add 10 μ l N,O-Diacetylmuramidases (20mg/ml) (DNA of plants extraction test kit);
(3) 55 ℃ of digestion (digestion is as the criterion with histolysis, and the time was greater than 7 hours)
(4) after the complete digestion, the centrifugal 5min of 13000rpm;
(5) in the 1.5mlEP pipe that supernatant liquor is packed into new;
(6) add 500 μ l chloroforms: primary isoamyl alcohol (24: 1), mixing are placed in the trash ice, 5-10min;
(7) the centrifugal 10min of 13000rpm;
(8) supernatant liquor changes in the new 1.5mlEP pipe again;
(9) add 1ml 95% ethanol and 45 μ l 10M NH
4AC, mixing (placing 2min)
(10) the centrifugal 10min of 13000rpm;
(11) 70% washing with alcohol precipitation 2 times;
(12) 100% washing with alcohol precipitation 1 time;
(13) seasoning or 55 ℃ of kept dry;
(14) OD pH-value determination pH;
(15) DNA stoste-20 ℃ preservation;
2, the amplification of purpose fragment RBCL
After sample DNA extracts, use the gene with PCR method amplification rbcL.Amplification can be carried out on one PCR instrument.Table 6 is the concrete amplification condition that uses: the buffer in the PCR system, and magnesium ion, and dNTP and ExTaq enzyme all are purchased from Dalian precious biological (TaKaRa).
The upstream primer fRBCL of amplification RBCL (5 '-ATGTCACCACAAACAGAGACTAAAGC-3 ') and downstream primer rRBCL (5 '-CTTCTGCTACAAATAAGAATCGATCTC-3 '), give birth to worker (Sangon) company by Shanghai and synthesize.
Table 6rbcL amplification PCR reaction system
The reaction of PCR is carried out at the PTC200 thermal cycler, and through behind the condition optimizing repeatedly, concrete amplification program is: ((1) 95 ℃ 1 minute; (2) 94 ℃ 45 seconds; (3) 49 ℃ 45 seconds; (4) 72 ℃ 1 minute; GOTO step (2) 35more times; (6) 72 ℃ 10 minutes; (7) 4 ℃ of 4:00:00)
The sample of amplification is carried out agarose gel electrophoresis.Because the clip size of amplification is about 700bp, so the concentration of agarose selects 1%.
Sample to pcr amplification carries out purifying, selects OMEGA EZNA
TM, Cycle-purekit (OMEGA, USA) test kit; Or OMEGA EZNA
TM, Gel Extractionkit (OMEGA, USA) test kit.The step of purifying is referring to each products instruction.
Sample behind the detection purifying is delivered to the handsome biotechnology in Shanghai limited (Invirtrogen) company to check order.
3 sequential analyses
From the dna sequence dna storehouse of NCBI GeneBank, download available rbcL sequence.Calculate by cluster analysis, as can be known 7 coptis species all class get together and form independently offspring, each kind forms little offspring again in belonging to.The interspecies relation that is used for 7 samples of testing authentication can correctly be divided on dna sequence dna contract tree, show rbcL sequence classification results accurately and reliably, can identify 7 famous-region drug of Coptis, and then proof rbcL sequence possesses famous-region drug species evaluation function.
Determining of the specific oligonucleotide probe of embodiment three coptiss to be detected
1 probe design
Probe design will satisfy designed probe and species are one-to-one relationships, and in order to satisfy the condition of chip hybridization, need to take into full account 1) probe self is without secondary structure; 2) all probes should keep close Tm value, GC content; 3) one is the zone of hypermutation in the sequence for the probe of selecting, and also different haplotypes may occur in so of the same race, so use in case of necessity the impact that annexs the many factors such as probe.
Because the restriction of above factors, the probe of selecting need repeatedly checking.Owing in actual chips hybridization, can run into the factor of complicated hybridization kinetics, therefore according to the situation of reality hybridization probe carried out repeatedly adjusting.According to the rbcL sequence of introducing above, three sections probe sequences that final design of the present invention goes out have been listed every section probe sequence of 7 kinds of five kinds of probes respectively shown in table 1, table 2, table 3 in every table, comprise the sequence Tm value of probe, GC content and sequence length.As can be seen from the table, the scope of the Tm value of probe sequence is between 49-58 ℃, and length is adjusted at 25bp according to Tm, and scope is between 20-27bp.In order to make selected probe to the existing specificity of inspection species universality be arranged again, therefore also can annex probe according to the base design that occurs to the site of haplotype base difference, make the stability of detection and accuracy better.
2 electronic virtual hybridization checking
The present invention carries out computer virtual hybridization to designed probe and carries out compliance test result.The RBCL gene segment sequence of 7 samples in this project is carried out electronic virtual hybridization with DNA barcode chip respectively, and the electronic hybridization result is carried out cluster analysis, with the accuracy of validating DNA barcode classified calculating.
Computer virtual hybridization results of hybridization such as table 7 are shown in table 8 and the table 9.The computer results of hybridization represents with a string 0 and 1 code.Wherein the probe site sequence is just the same on 1 expression rbcL gene segment and the chip, shows and hybridizes successfully, becomes positive; There is the unpaired of at least 1 base in probe sequence on 0 expression rbcL gene segment and the chip, can not hybridize, and becomes negative.
The 1st section virtual results of hybridization of probe of table 7
| 1 | The high eyebrow coptis | 1000000 |
| 2 | Rhizoma coptidis teetoidis | 0100000 |
| 3 | Coptis deltoidea C.Y.Cheng et Hsiao | 0010000 |
| 4 | The coptis | 0001000 |
| 5 | The five leaf coptiss | 0000100 |
| 6 | Coptis japonica Makino | 0000010 |
| 7 | Five split the coptis | 0000001 |
As can be seen from Table 7, the position that " 1 " occurs just in time is the clinodiagonal in the table, shows between species and the probe it is specific hybrid, and this one to one relation can effectively improve the identification result of chip.
The 2nd section virtual results of hybridization of probe of table 8
| 1 | The high eyebrow coptis | 1000000 |
| 2 | Rhizoma coptidis teetoidis | 0100000 |
| 3 | Coptis deltoidea C.Y.Cheng et Hsiao | 0010000 |
| 4 | The coptis | 0001000 |
| 5 | The five leaf coptiss | 0000100 |
| 6 | Coptis japonica Makino | 0000010 |
| 7 | Five split the coptis | 0000001 |
As can be seen from Table 8, the position that " 1 " occurs just in time is the clinodiagonal in the table, shows between species and the probe it is specific hybrid, and this one to one relation can effectively improve the identification result of chip.
The 3rd section virtual results of hybridization of probe of table 9
| 1 | The high eyebrow coptis | 1000000 |
| 2 | Rhizoma coptidis teetoidis | 0100000 |
| 3 | Coptis deltoidea C.Y.Cheng et Hsiao | 0010000 |
| 4 | The coptis | 0001000 |
| 5 | The five leaf coptiss | 0000100 |
| 6 | Coptis japonica Makino | 0000010 |
| 7 | Five split the coptis | 0000001 |
As can be seen from Figure 9, the position that " 1 " occurs just in time is the clinodiagonal in the table, shows between species and the probe it is specific hybrid, this one to one relation, identification result that can more effective raising chip.
Statistics shows, neither one surpasses the gene segment of 25bp and is shared by all mankind, infer that according to this also there is this situation in other species, therefore, 3 probes of each species design, as long as with at least 1 probe on the sample PCR product hybridization coupling to be identified, just can think that DNA chip identification result is positive.Certainly preferably mate 3, the result just can affirm very much so.
The present invention is take DNA of plants barcode candidate regions rbcL gene standard area as template, and the design dna chip probe has comparatively desirable species identification rate and accuracy, can effectively identify this 7 kinds of genuine coptis medicinal materials to be checked.Especially 3 sections probes are united use, effect is better.
Design and the preparation of the gene chip of embodiment four coptiss to be detected
1 chip is positive in and negative design
When the making of chip, for the checking to stability and the validity of chip hybridization, positive and negative reference have been designed.Positive is conserved sequence on the Coptis Chloroplast rbcL Gene with reference to what select.The Coptis rbcL gene order that is used for analyzing obtains from GenBank, and is positive in selecting way selecting with probe.Owing to be positive reference, coptis species all when chip hybridization all should detect fluorescent signal, so positive reference selection is sequence very conservative on the rbcL gene, sequence is all identical in all coptis species of analyzing.Negative with reference to selecting ultrapure water.
Synthesizing of 2 probes
With 21 probes of 7 coptis species designing and serve the sea as the rbcL probe of positive reference to give birth to worker's biotechnology company limited synthetic.Probe is synthetic and use the HPLC purifying, then-20 ℃ of preservations.Carry out for enabling hybridization reaction is easier, connected a segment length at 5 ' end of probe and be the oligomerization T fragment of 15bp, and carry out at the 5 ' end of oligomerization T amido modified so that the aldehyde radical on the chip carries out chemical reaction.
The preparation of 3DNA chip
In biochip Beijing National Engineering Research Center (Bo Ao)---joint laboratory of Chengdu University of Traditional Chinese Medicine makes chip.
The design of chip dot matrix is as shown in table 4.Synthetic probe is dissolved with ultrapure water, and making its final concentration is 40 μ M.Then with the probe of dissolving and point sample damping fluid (brilliant core gene chip sampling liquid) fully mixing divide and install in 384 orifice plates, also that nucleic acid is fixing positive in (the fixing positive function with reference to each point location on the chip is arranged of nucleic acid in addition, this example amplifying nucleic acid fixedly positive is consulted and used HEX, Hexachlorofluorescein chlordene fluorescein) and pack into the correspondence position of 384 orifice plates of positive and negative confidential reference items.Afterwards 384 orifice plates and aldehyde radical chip are put into such as the chip point sample instrument and carried out point sample.The process of point sample is finished under designed " brilliant core SmartArrayer48 " the point sample program of Bo Ao Biochip company.Present embodiment adopts is 18 * 6 matrix, and each parameter is undertaken by the system-computed result during point sample.The model of the employed Bo Ao of process of the test company is SmartArraryerTM48 chip point sample instrument.What select system is the aldehyde radical substrate of CapitalBio (Bo Ao), and the chip after the some system as shown in Figure 1.
For whether detection chip has the situation of leak source, the chip of a system is scanned, in order to leak source is mended a little.Chip scanning result such as Fig. 2 that point makes, the white bright spot among the figure is Hex, all the other are probe points.Dot matrix middle probe site is identical with site in the table 4 chip array schema.Matrix is totally 6 row, 18 row.The first row and last column are fixing positive reference, negative reference and positive reference of Hex nucleic acid.Middle ten behaviors detect coptis kind specific probe.Three sections probes of each species wherein, each probe points repeats for three times.
Carry out conventional chip fixation procedure after the chip point makes, probe firmly is attached on the chip.
Embodiment five the present invention detect the confirmatory experiment of the gene chip effect of the coptis
The chip that utilization is made is verified existing sample segment.The sample of checking has been selected the high eyebrow coptis, Yunnan company, Coptis deltoidea C.Y.Cheng et Hsiao, the coptis, the five leaf coptiss, coptis japonica Makino, five to split the coptis to verify.
Concrete operating process is as follows:
1) extraction of dna profiling: the sample (coptis sample) that obtains is placed the EP pipe---add 50mM SDS 180 μ l, sample is pulverized, and fully shake with Vortex---95 ℃ of metal baths, 10min---adds 1M Tris-HCl (pH8.0) 20 μ---and 13, the centrifugal 2min of 000rmp, supernatant liquor can be directly as the PCR reaction template.
2) the PCR reaction system sees Table 10:
Table 10DNA barcode sample amplification PCR reaction system
Response procedures is as follows: 94 ℃, and 2min; Carry out again following three steps of 35 circulations: 94 ℃, 10sec; 56-47 ℃, 30sec; 68 ℃, 1min; Then 68 ℃, 7min.The method of touchdown PCR, 0.3 ℃ of each cycle annealing drop in temperature are adopted in reaction.
The electrophoretogram of the amplified band by this method as shown in Figure 3.As can be seen from the figure utilize the method for High Efficiency PC R polysaccharase and touchdown PCR can amplify the purpose band, and the brightness of band illustrate that greater than markerD2000 this method expanding effect is good.
1 sample and chip pre-treatment
The preparation of hybridization system and denaturation process hybridization volume are 12 μ l, and the commercialization hybridization solution of selecting Bo Ao to provide is transferred to hybridization solution and sample mix in the centrifuge tube of 0.2ml again, and is of short duration centrifugal.95 ℃ of thermally denature 3min in the PCR instrument, ice bath quenching 2-3min is used for hybridization.Hybridization solution 12 μ l systems see Table 11.
The prescription of table 1112 μ l system hybridization system
SSC (saline sodium citrate damping fluid)
Chip pastes fence.Fence non-setting adhesive face paster is taken off, clamped fence with tweezers and be placed in the mould that holds fence, sticking one faces up.The chip front end is withstood on the inboard of mould, and hand-held chip tag one end is adjacent to chip and fence slowly toward pressing down.Attention: the chip point has one of sample to face down.
2 chip hybridizations
Hybridizing box and hybridization: the chip that posts fence is put into hybridizing box, and point has one of probe to face up.To be placed on the cover glass card of projection on the black fence of chip, note having projection one facing to chip; Then after slowly adding the hybridization solution of 12 μ l from the aperture of cover glass, hybridization solution can rely on surface tension of liquid below cover glass convex surface and chip between form together liquid film.Do not shake cover glass or chip to avoid destroying liquid film.Fast slide is put into hybridizing box (groove of hybridizing box adds 150 μ l distilled water in advance), cover tightly the hybridization lid, again hybridizing box is put into BioMixerTMII chip hybridization cleaning apparatus, 42 ℃, hybridization 12～14h.
3 chips clean and scanning
The operating process that chip cleans is as follows:
A. successively washing lotion I, washing lotion II are placed on and are preheated to 42 ℃ in the microwave oven, be transposed in the cleaning box.
B. after hybridization finishes, chip is transferred to (fence can keep) in the cleaning box that holds washing lotion, hybridization surface is placed on the horizontal shaking table and slowly cleans up.Cleaning step such as table 12.
Washing lotion preparation and the cleaning condition of table 12 three-dimensional amino-group chip
C. after chip cleans, be placed in the 50ml taper centrifuge tube, centrifugal 1 minute of 2000rpm removes the liquid of surface of glass slide, and the chip of this moment can be used for scanning.
Employed chip hybridization instrument in sample and the chip hybridization experimentation, model: Biomixer
TMII, chip cleaning apparatus chip cleaning apparatus, model: Slidewasher
TM8 and chip scanner chip scanner model: LuxScan-10K/A.
To sum up, to scan employed experiment material, reagent and instrument as shown in table 13 from being prepared into the sample hybridization check for chip.
Experiment material, reagent and instrument in the preparation of table 13 substrate and the sample detection
4 chip hybridization scanning results
4.1 high eyebrow coptis hybridization the result
This project has been verified the high eyebrow coptis sample that Sichuan Province science of natural resources research institute provides, and sample number is MH021, and chip hybridization the results are shown in Figure 4.
As can be seen from the figure, six green fluorescence points in the upper left corner of whole chip matrix and the lower right corner are the HEX coordinate probe, the upper right corner of matrix and the positive reference of the lower left corner six bright spots, 6 negative references in centre of first row and last row, identical with background color in the drawings.All to present hybridization positive with nine point of samples of first row three sections probes from left to right of the high eyebrow coptis of representative for sample, and as a result Pass Test design shows that this chip can the little coptis of specific evaluation tangerine.Occurred some darker non-specific hybridizations among the hybridization figure, this may be long with hybridization time relevant with the hybridization sample size, also with probe between the position in difference site relevant.But the species that three sections probes all present the obvious positive only have the high eyebrow coptis, meet this chip and determine the design of species with three probes, so the false positive site does not affect the judgement to the result.
4.2 rhizoma coptidis teetoidis hybridization the result
Verified the rhizoma coptidis teetoidis sample that is provided by Sichuan Province's science of natural resources research institute for this.Sample is numbered MH046, and chip hybridization the results are shown in Figure 5.
As can be seen from the figure, the deployment scenarios that in the theoretical crossing pattern figure of the rhizoma coptidis teetoidis in left side, has shown whole chip matrix.Test sample book all with the first row that represents rhizoma coptidis teetoidis three sections probes from right to left in six point of samples to present hybridization positive, as a result Pass Test design shows that this chip can specific evaluation rhizoma coptidis teetoidis.
4.3 Coptis deltoidea C.Y.Cheng et Hsiao hybridization the result
This project has been provided by Coptis deltoidea C.Y.Cheng et Hsiao sample altogether that provided by Chengdu Inst. of Biology, Chinese Academy of Sciences.Be numbered MH052, chip hybridization the results are shown in Figure 6.
As can be seen from the figure, sample presents the hybridization positive with nine point of samples that represent second row three sections probes from left to right of Coptis deltoidea C.Y.Cheng et Hsiao, and as a result Pass Test design shows that this chip can specific evaluation Coptis deltoidea C.Y.Cheng et Hsiao.
4.4 coptis hybridization the result
This project has been provided by the coptis sample that is provided by Sichuan Province's science of natural resources research institute.Sample is numbered MH067, and chip hybridization the results are shown in Figure 7.
As can be seen from the figure, sample presents the hybridization positive with nine point of samples that represent second row three sections probes from right to left of the piscidia coptis, and as a result Pass Test design shows that this chip can the specific evaluation coptis.
4.5 five leaf coptiss hybridization the result
This project has been provided by the five leaf coptis samples that provided by Chengdu Inst. of Biology, Chinese Academy of Sciences, and sample is numbered MH076, and chip hybridization the results are shown in Figure 8.
As can be seen from the figure, sample presents the hybridization positive with nine point of samples of the 3rd row three sections probes from left to right that represent the five leaf coptiss, and as a result Pass Test design shows that this chip can the specific evaluation five leaf coptiss.
4.6 coptis japonica Makino hybridization the result
This project has been verified the coptis japonica Makino sample by five stone medicinal materials market purchasing in Chengdu altogether.Sample is by being numbered MH085, and chip hybridization the results are shown in Figure 9.
As can be seen from the figure, sample and the 3rd row coptis japonica Makino from right to left that represents the five leaf coptiss, hybridization signal appears in totally six probes of two sections probes in three sections probes, meet this experiment and determine the design of species with two and two above probes, therefore do not affect the judgement to the result, qualification result is coptis japonica Makino.
4.7 Mediterranean Sea coptis hybridization the result
This project verified by what Chengdu Inst. of Biology, Chinese Academy of Sciences provided and five split coptis sample, and sample is numbered MH097, and chip hybridization the results are shown in Figure 10.As can be seen from the figure, to present hybridization positive with represent five the 4th row nine point of samples of three sections probes from left to right that split the coptis for sample, and as a result Pass Test designs, and shows that this chip can specific evaluation five split the coptis.
Attached 1: English is write a Chinese character in simplified form
The rbcL sequence source of attached 27 kinds of genuine coptis medicinal materials that the present invention relates to
GeneBank numbering species latin name species Chinese name
＞AF093730.1|_Coptis_trifolia
＞AB163771.1|_Coptis_trifolia
＞AB163770.1|_Coptis_quinquefolia five leaf the coptiss
＞AB163767.1|_Coptis_quinquefolia five leaf the coptiss
＞AB163769.1|_Coptis_ramosa
＞AB163768.1|_Coptis_trifoliolata
＞AB163766.1|_Coptis_lutescens
＞AB163765.1|_Coptis_japonica coptis japonica Makino
＞AB163764.1|_Coptis_japonica coptis japonica Makino
＞AB163780.1|_Xanthorhiza_simplicissim yellow-root
＞AB163779.1|_Coptis_occidentalis
＞AB163778.1|_Coptis_laciniata
＞AB163777.1|_Coptis_aspleniifolia
＞AB163772.1|_Coptis_quinquesecta five splits the coptis
＞AY954497.1|_Coptis_chinensis the coptis
＞FJ449856.1|_Coptis_chinensis the coptis
＞AB163775.1|_Coptis_chinensis the coptis
The high eyebrow coptis of＞AB163776.1|_Coptis_omeiensis
＞AB163774.1|_Coptis_deltoidea Coptis deltoidea C.Y.Cheng et Hsiao
＞AB163773.1|_Coptis_teetat rhizoma coptidis teetoidis
Claims (6)
1. detect the gene chip of genuine coptis medicinal materials, it is characterized in that: comprise solid phase carrier, the surface of described solid phase carrier is fixed with respectively the oligonucleotide probe that the oligonucleotide probe group that detects coptis plant comprises, and described oligonucleotide probe can carry out hybridization with testing sample respectively; Described oligonucleotide probe group comprises No. 1 sequence oligonucleotide probe as follows:
Described coptis plant is: high eyebrow coptis Coptis omeiensis, rhizoma coptidis teetoidis Coptis teeta, Coptis deltoidea C.Y.Cheng et Hsiao Coptis deltoidea, coptis Coptis chinensis, five leaf coptis Coptis quinquefolia, coptis japonica Makino Coptis japonica, five split coptis Coptis quinquesecta;
Described oligonucleotide probe group also comprises No. 2 sequence oligonucleotide probe that is selected from corresponding coptis kind in each sequence as follows:
；
Described oligonucleotide probe group also comprises No. 3 oligonucleotide probe of the corresponding coptis kind that is selected from each sequence as follows:
。
2. the gene chip of detection genuine coptis medicinal materials according to claim 1 is characterized in that: the surface of described solid phase carrier also is fixed with positive in probe and negative reference; Positive sequence with reference to probe is: 5 '-GCTGCTGTAGCTGCCGAATCTTCTA-3 '.
3. the gene chip of detection genuine coptis medicinal materials according to claim 2, it is characterized in that: the surface of described solid phase carrier is fixed with oligonucleotide probe array shown in 1～5 following table:
HEX is the fixing positive reference of nucleic acid in the upper table; The sun ginseng is positive with reference to probe, and its nucleotides sequence is classified 5 '-GCTGCTGTAGCTGCCGAATCTTCTA-3 ' as; Cloudy ginseng is negative reference, is ultrapure water.
4. the gene chip of detection Coptis according to claim 3, it is characterized in that: described solid phase carrier is the carrier-pellet of aldehyde radical, every nucleotide probe in the described array repeats 2～5 times.
5. gene chip kit that detects genuine coptis medicinal materials, it is characterized in that comprising each described gene chip of claim 1～4 and be used for from its ribulose 1 of the total DNA amplification of testing sample, large subunit (the ribulose-1 of 5-bisphosphate Carboxylase/oxygenase, 5-bisphosphate carboxylase/oxygenase large subunit, rbcL) Auele Specific Primer pair of gene:
5’-ATGTCACCACAAACAGAGACTAAAGC-3’
5’-CTTCTGCTACAAATAAGAATCGATCTC-3’。
6. method that detects genuine coptis medicinal materials is characterized in that may further comprise the steps:
Total DNA of a, extraction coptis sample to be checked;
B, from the total DNA that extracts amplification coptis sample rbcL gene to be checked; Increase the primer of coptis sample rbcL gene to be checked to being:
5’-ATGTCACCACAAACAGAGACTAAAGC-3’
5’-CTTCTGCTACAAATAAGAATCGATCTC-3’；
C, rbcL gene and each described gene chip of claim 1～4 of obtaining with amplification carry out hybrid experiment, and the positive corresponding coptis kind of the probe name of hybrid experiment result is the kind name of coptis sample to be checked.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201010524492 CN101962681B (en) | 2010-10-29 | 2010-10-29 | Gene chip for detecting genuine coptis medicinal materials |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201010524492 CN101962681B (en) | 2010-10-29 | 2010-10-29 | Gene chip for detecting genuine coptis medicinal materials |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101962681A CN101962681A (en) | 2011-02-02 |
| CN101962681B true CN101962681B (en) | 2013-03-13 |
Family
ID=43515733
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201010524492 Expired - Fee Related CN101962681B (en) | 2010-10-29 | 2010-10-29 | Gene chip for detecting genuine coptis medicinal materials |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101962681B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102367485B (en) * | 2011-11-30 | 2013-04-17 | 福建农林大学 | Primer for carrying out PCR (Polymerase Chain Reaction) detection on reference gene of plant disease and application of primer |
| CN103305620B (en) * | 2013-06-26 | 2014-12-31 | 中国科学院植物研究所 | Specific primer pair based on rbcL gene and used for identifying land plant species and application thereof |
| CN107190090A (en) * | 2017-07-19 | 2017-09-22 | 福建农林大学 | The molecular identificalion primer and method of a kind of Chinese lobelia and Mazus japonicus |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1553188A (en) * | 2003-06-06 | 2004-12-08 | 克 宋 | Microarray signal amplifying method |
-
2010
- 2010-10-29 CN CN 201010524492 patent/CN101962681B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1553188A (en) * | 2003-06-06 | 2004-12-08 | 克 宋 | Microarray signal amplifying method |
Non-Patent Citations (1)
| Title |
|---|
| 贾恩礼等.中药鉴定中现代分析技术的国内应用概况.《实用医药杂志》.2006,第23卷(第8期),第989－991页. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101962681A (en) | 2011-02-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| REN et al. | Species identification of Alnus (Betulaceae) using nrDNA and cpDNA genetic markers | |
| CN101851675B (en) | Probe set of inspection and quarantine fruit fly and inspection method thereof | |
| CN103060318B (en) | SSR (Simple Sequence Repeat) core primer group developed based on whole genome sequence of foxtail millet and application of SSR core primer group | |
| CN108048595B (en) | Indel molecular labelings with pumpkin photoperiod insensitive character close linkage and its application | |
| Chuang et al. | Authentication of domestic Taiwan rice varieties based on fingerprinting analysis of microsatellite DNA markers. | |
| Huang et al. | Identification of Crocus sativus and its adulterants from Chinese markets by using DNA barcoding technique | |
| CN105177150B (en) | A kind of the multiple PCR primer system and detection method of quick detection pig sheep ox animal derived materials | |
| CN105483282A (en) | PCR specificity identifying primers and paris polyphylla identifying method adopting same | |
| Chen et al. | DNA barcoding in herbal medicine: retrospective and prospective | |
| CN103074433A (en) | Turtle shell DNA detection kit and identification method | |
| CN108977571A (en) | Identify the fluorescence PCR detection reagent kit and application of four kinds of Araeceae medicinal plants | |
| CN101962681B (en) | Gene chip for detecting genuine coptis medicinal materials | |
| Zhao et al. | Molecular identification of mung bean accessions (Vigna radiata L.) from Northeast China using capillary electrophoresis with fluorescence‐labeled SSR markers | |
| CN108265123B (en) | Kit and method for identifying paris polyphylla genuine product and different genotypes | |
| CN107630102B (en) | PCR identification kit and identification method for radix paeoniae alba | |
| CN104450888B (en) | Hemp DNA fluorescent composite amplification systems | |
| CN107400723B (en) | identification method and use of seed plant species | |
| Ryuk et al. | Identification of Acorus gramineus, A. calamus, and A. tatarinowii using sequence characterized amplified regions (SCAR) primers for monitoring of Acori graminei rhizoma in Korean markets | |
| CN104774948B (en) | PCR (Polymerase chain reaction) identification kit and identification method for largehead atractylode in Hebei | |
| KR101286989B1 (en) | Multiplex real time pcr method for discrimination of rice cultivar | |
| CN102168142A (en) | Primer, probe and detection method for real-time fluorescent polymerase chain reaction (PCR) of Planococcus minor | |
| CN107779521A (en) | A kind of DNA bar code and its purposes in muscat is identified | |
| CN107142333B (en) | Fluorescent PCR detection primer group and kit for identifying saffron, detection method and application | |
| CN108998554A (en) | Identify the fluorescence PCR detection reagent kit of 3 kinds of medicinal dendrobiums and application in pharmacopeia | |
| CN104611442A (en) | Primer composition for identifying Ningxia rice varieties and application of primer composition |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20130313 Termination date: 20151029 |
|
| EXPY | Termination of patent right or utility model |