CN107475389B - Primer group, kit and method for detecting mycoplasma pneumoniae - Google Patents
Primer group, kit and method for detecting mycoplasma pneumoniae Download PDFInfo
- Publication number
- CN107475389B CN107475389B CN201710728493.4A CN201710728493A CN107475389B CN 107475389 B CN107475389 B CN 107475389B CN 201710728493 A CN201710728493 A CN 201710728493A CN 107475389 B CN107475389 B CN 107475389B
- Authority
- CN
- China
- Prior art keywords
- mycoplasma pneumoniae
- internal standard
- kit
- pcr reaction
- probe
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a primer group for detecting mycoplasma pneumoniae. The primer group comprises a specific primer pair and a probe aiming at the mycoplasma pneumoniae genome, and a primer pair and a probe aiming at the internal standard plasmid. The invention also relates to a kit for detecting mycoplasma pneumoniae. The kit comprises PCR reaction liquid and two PCR reaction liquids of the PCR reaction liquid, wherein one PCR reaction liquid is a first PCR reaction liquid which comprises a specific primer pair and a probe aiming at a mycoplasma pneumoniae genome and a primer pair and a probe aiming at an internal standard plasmid, and the other PCR reaction liquid is a second PCR reaction liquid which comprises a hot start enzyme and a UNG enzyme. The invention also relates to a method for detecting the mycoplasma pneumoniae by using the kit. The kit and the detection method thereof provided by the invention have the advantages of simple operation, short detection time, high detection sensitivity and the like, and are particularly suitable for being popularized and applied in clinical examination work.
Description
Technical Field
The invention relates to the technical field of in-vitro diagnosis, in particular to a primer group, a kit and a method for detecting mycoplasma pneumoniae.
Background
Mycoplasma Pneumoniae Pneumonia (MPP), the old called primary atypical pneumonia, is caused by infection with Mycoplasma Pneumoniae (MP). Mycoplasma is a pathogenic microorganism that is between viruses and bacteria, can freely pass through a bacterial filter, has a simple structure, and has no cell wall. It has now been found that 3 mycoplasma species are certainly pathogenic to humans, of which mycoplasma pneumoniae is one.
MP is an important pathogen of respiratory infections and is also becoming the leading pathogen of community-acquired pneumonia in children. MPP is characterized pathologically by interstitial pneumonia or bronchiolitis changes, and clinically by intractable severe cough. The infection is spread all the year round, the late autumn and early winter are the peak season of the disease, and the epidemic cycle is about 4 years. Infection with MP can also cause damage to other systems outside the lungs. According to Vervloet LA, MP encephalitis is the most common MPP nervous system complication, the fatality rate of the MP encephalitis is up to 10%, and about 25% of MPP nervous system complications are left with sequelae. MP infections can also damage the skin mucosa, urinary system and blood system. In addition, MP can cause nonspecific pathological symptoms of tissue systems such as cardiovascular system, digestive system, joint muscle, etc.
Laboratory diagnostic methods for MP include the following three categories: the first is the isolated culture of MP, which is the gold standard for MP diagnosis, but the culture technique is demanding, takes long time, about 3-4 weeks, and has low sensitivity, which limits the application of the method in early diagnosis. The second category is serum specific antibody detection, with internationally accepted diagnostic criteria being: in the two serum samples in the acute stage and the convalescent stage, the mycoplasma pneumoniae infection can be confirmed when the specific antibody titer of the mycoplasma pneumoniae is increased or reduced by 4 times or more. At present, the gelatin particle agglutination test (PA) and the enzyme-linked immunosorbent assay (ELISA) are commonly used in China. However, serological methods are not suitable for early diagnosis due to the low operability of collecting duplicate sera. The third category is molecular biology methods. The method is approved to be applied to clinical RNA isothermal amplification method, loop-mediated isothermal amplification method and PCR fluorescence method in China. As the PCR fluorescence technology is mature, the sensitivity is high and the specificity is strong, the clinical application is the most extensive.
In conclusion, the invention provides a primer group, a kit and a method for detecting mycoplasma pneumoniae by a PCR fluorescence method.
Disclosure of Invention
The invention aims to design a specific primer pair and a probe aiming at a mycoplasma pneumoniae genome, a primer pair and a probe aiming at an internal standard plasmid, and perform double fluorescence PCR amplification on a specific target fragment of a mycoplasma pneumoniae genome and the internal standard plasmid so as to judge whether to infect the mycoplasma pneumoniae by judging whether to obtain a specific amplified fragment of a sample to be detected.
The invention provides a primer group for detecting mycoplasma pneumoniae, which comprises a specific primer pair and a probe aiming at a mycoplasma pneumoniae genome, and a primer pair and a probe aiming at an internal standard plasmid, wherein:
the sequences of the specific primer pair and the probe aiming at the mycoplasma pneumoniae genome are as follows:
a specific upstream primer:
5’-ATTATTGGGCTCGCGAAACG-3’；
specific downstream primers:
5’-GGCTCGACAGCTTATACGAC-3’；
specific probes:
5’-FAM-AGGCACTACCAATCGCGGCTTG-TAMRA-3’；
the sequences of the primer pair and the probe aiming at the internal standard plasmid are as follows:
internal standard plasmid upstream primer:
5’-GGCATGTGGAGGAAGGTGGT-3’；
internal standard plasmid downstream primer:
5’-CCATGGACTGGCTCTCCGTT-3’；
internal standard plasmid probe:
5’-HEX-ACGCAGCCCTGCTTCGTTCGCCG-TAMRA-3’。
the invention also provides a kit for detecting mycoplasma pneumoniae, which comprises a first PCR reaction solution and a second PCR reaction solution, wherein the first PCR reaction solution comprises a specific primer pair and a probe aiming at the mycoplasma pneumoniae genome, and a primer pair and a probe aiming at an internal standard on a plasmid, wherein,
a specific upstream primer:
5’-ATTATTGGGCTCGCGAAACG-3’；
specific downstream primers:
5’-GGCTCGACAGCTTATACGAC-3’；
specific probes:
5’-FAM-AGGCACTACCAATCGCGGCTTG-TAMRA-3’；
internal standard plasmid upstream primer:
5’-GGCATGTGGAGGAAGGTGGT-3’；
internal standard plasmid downstream primer:
5’-CCATGGACTGGCTCTCCGTT-3’；
internal standard plasmid probe:
5’-HEX-ACGCAGCCCTGCTTCGTTCGCCG-TAMRA-3’；
the second PCR reaction solution includes a hot start enzyme and UNG enzyme.
In a preferred embodiment of the kit provided by the invention, the kit further comprises a negative quality control product and a positive quality control product.
In a preferred embodiment of the kit provided by the invention, the negative quality control product is physiological saline, and the positive quality control product is a target fragment recombinant plasmid using pUC57 as a vector.
The present invention also provides a method for detecting mycoplasma pneumoniae using the kit described above, comprising the steps of:
the method comprises the following steps: taking DNA extracted from a sample to be detected as a PCR template;
step two: constructing a PCR reaction system, taking out the first PCR reaction solution and the second PCR reaction solution from the kit, and uniformly mixing a proper amount of PCR template with the first PCR reaction solution and the second PCR reaction solution;
step three: in the PCR reaction system, carrying out PCR amplification on a PCR template to be detected;
step four: and (3) judging the PCR result: and under the condition that the negative quality control material and the positive quality control material of the kit meet the regulations, obtaining a CT value according to the fluorescence amplification curve to carry out result judgment so as to obtain a qualitative result of the sample to be detected.
In a preferred embodiment of the method for detecting mycoplasma pneumoniae by using the kit provided by the invention, the PCR amplification reaction conditions in step three are as follows:
the first stage is as follows: 120sec at 50 ℃;
and a second stage: 600sec at 95 ℃ 1 cycle;
and a third stage: capture fluorescence signal at 95 ℃ for 30sec, 60 ℃ for 30sec, 40 cycles;
a fourth stage: 30sec at 37 ℃ in 1 cycle.
Compared with the prior art, the primer group, the kit and the method for detecting mycoplasma pneumoniae provided by the invention have the beneficial effects that:
firstly, a primer pair and a fluorescent probe with high specificity are designed respectively aiming at fragments and internal standard plasmids of mycoplasma pneumoniae genome which are specific to human beings and other species, and then the fragments and the internal standard plasmids are configured into a kit with convenient use and reliable detection result, and a scientific and reasonable PCR reaction system is designed, so that the method has the advantages of simple operation, high detection speed, high detection sensitivity, good specificity and the like, and is particularly suitable for popularization and application in clinical inspection work.
Secondly, by adding an internal standard plasmid gene in the primer design and the kit, the occurrence of false negative can be effectively avoided, so that the sensitivity of the method is improved, and the detection result is more accurate and reliable.
Drawings
FIG. 1 is a PCR amplification curve chart in the case of negative quality control detection;
FIG. 2 is a PCR amplification curve chart in the case of positive quality control detection;
FIG. 3 is a graph of PCR amplification in the detection of clinical sample 1;
FIG. 4 is a graph showing PCR amplification in the detection of clinical sample 2.
Detailed Description
In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention will be further described in detail with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.
Example 1: preparation of the kit
Design and synthesis of primers and probes
Through bioinformatics analysis, a fragment (SEQ ID NO: 8) specific to human and other species on the MP genome is found and has 2 repeats on the genome, and a specific primer pair (comprising SEQ ID NO: 1 and SEQ ID NO: 2) and a FAM-labeled probe (SEQ ID NO: 3) are designed by taking the target sequence as a template. Simultaneously, a primer pair (comprising SEQ ID NO: 4 and SEQ ID NO: 5) aiming at the internal standard plasmid and a probe (SEQ ID NO: 6) marked by HEX are designed, and the DNA sequence of the internal standard fragment in the internal standard plasmid is SEQ ID NO: 7.
the primer pairs and probe sequences were as follows:
TABLE I, primer pairs and Probe sequence Listing
SEQ ID NO: 7 the sequence is as follows:
TCACAAGCAGGAGTGTGCCAGGAGAAGGCCAAACCATCCAGTGCCGGTGGTTTGACCACGAGGAGTGCATCCTGCACGGAGTCACTGAGCTCGTGACCTCCACGCTGCTCGTCCCCTGCGCTATCGAGAGGGCACTCTCTGTGTCTCAGCTGGTGCCGCTGGCGCAGAGTGTTTTGGGCCCCTTAAAGCTCAGCATGGCTGGTTCTGGAGAGATGGAAAAGAGAAAGGATTTCCCCCATTTGGGTGCCTCGGGCATGTGGAGGAAGGTGGTCCGGCGAACGAAGCAGGGCTGCGTGAAGGGGATCTGATAACCCACGTCAACGGAGAGCCAGTCCATGG。
SEQ ID NO: the sequence of 8 is as follows:
TGTTTCACTTGGTTTGCCAGTCAAACAACCCGGTGCGGGAGGATGTATTGGATTGTTGGGTTTGACCATTCTTCTGCTCCGGAAACACCGCCTTAATGAAATCCCCGAAGTTTTGGGCACTGTTGGGGGTGGGGTCGAAGGTGGTTTTACCTTGGCTTTGTCCATTATTGGGCTCGCGAAACGCGGGGAAGGCATAGCCCAACTGTAAGGCACTACCAATCGCGGCTTGGTCGTATAAGCTGTCGAGCCCGTCCTTGGGTGCTTGGTACGCGAAGAA。
second, quality control material selection
The kit also comprises a negative quality control product and a positive quality control product, wherein the negative quality control product is physiological saline, the positive quality control product is a target fragment recombinant plasmid taking pUC57 as a vector, and the DNA sequence of the target fragment is SEQ ID NO: 8.
third, PCR reaction solution composition
The PCR reaction solution comprises two reaction solutions, wherein one PCR reaction solution is a first PCR reaction solution which comprises a specific primer pair and a probe aiming at a mycoplasma pneumoniae genome, and a primer pair and a probe aiming at an internal standard plasmid, and the other PCR reaction solution is a second PCR reaction solution which comprises a hot start enzyme and a UNG enzyme.
The first PCR reaction solution comprises a specificity upstream primer (SEQ ID NO: 1), a specificity downstream primer (SEQ ID NO: 2), a specificity probe (SEQ ID NO: 3), an internal standard plasmid upstream primer (SEQ ID NO: 4), an internal standard plasmid downstream primer (SEQ ID NO: 5) and an internal standard plasmid probe (SEQ ID NO: 6).
Example 2: the method for detecting the mycoplasma pneumoniae by using the kit comprises the following steps:
first, biological sample
Pharyngeal swab specimens were collected from patients with preliminary clinical suspicion of respiratory tract infections. Taking the oropharyngeal secretions with a cotton swab, placing into a test tube filled with normal saline, and sealing for inspection. All clinical samples were sourced from Shenzhen city children hospital.
Secondly, taking DNA extracted from a sample to be detected as a PCR template:
2.1 adding an internal standard into the sample treatment fluid, wherein the adding ratio is 1: 50;
2.2 adding 1ml of sterilized normal saline into the tube for containing the swab, fully oscillating and shaking up, and squeezing out swab heads;
2.3 sucking all liquid, transferring the liquid into a 1.5ml centrifuge tube, and centrifuging for 5 minutes at 12,000 g;
2.4 removing the supernatant, adding 50 mul of sample treatment solution into the precipitate, fully and uniformly mixing, and carrying out constant temperature treatment at 100 ℃ for 10 minutes;
after 2.54 ℃ or ice bath for 2 minutes, 12,000g of the suspension was centrifuged for 5 minutes for further use.
Thirdly, constructing a PCR reaction system:
determining the number of detection tubes, taking out the first PCR reaction solution and the second PCR reaction solution from the kit, and respectively and uniformly mixing a proper amount of PCR template, a negative quality control product and a positive quality control product with the first PCR reaction solution and the second PCR reaction solution; the method comprises the following specific steps:
1) sample detecting tube
Sample adding system of sample detection tube
| Component name | Composition of matter | Addition of |
| First PCR reaction solution | Primer and probe | 15.7μL |
| Second PCR reaction solution | Hot start enzyme, UNG enzyme | 0.8μL |
| Sample(s) | Detecting DNA extracted from a sample | 3.5μL |
| Total volume | 20μL |
2) Negative control detecting tube
Sample adding system of third-table and negative control detection tube
| Component name | Composition of matter | Addition of |
| First PCR reaction solution | Primer and probe | 15.7μL |
| Second PCR reaction solution | Hot start enzyme, UNG enzyme | 0.8μL |
| Negative control | Physiological saline | 3.5μL |
| Total volume | 20μL |
3) Positive control detection tube
Sample adding system of positive control detection tube
Fourthly, respectively carrying out PCR amplification on the PCR template to be detected, the negative quality control product and the positive quality control product in the PCR reaction system;
loading the sample detection tube, the negative control detection tube and the positive control detection tube into an ABI7500 fluorescent quantitative PCR instrument (applied biosystems, USA); setting PCR reaction parameters to carry out PCR amplification, wherein the specific PCR amplification reaction conditions are as follows:
the first stage is as follows: 120sec at 50 ℃;
and a second stage: 600sec at 95 ℃ 1 cycle;
and a third stage: capture fluorescence signal at 95 ℃ for 30sec, 60 ℃ for 30sec, 40 cycles;
a fourth stage: 30sec at 37 ℃ in 1 cycle.
Fifth, PCR result judgment
And under the condition that the negative quality control material and the positive quality control material of the kit accord with the regulations, obtaining a CT value according to the fluorescence amplification curve to carry out result judgment so as to obtain a qualitative result of the sample to be detected. Specifically, the PCR result judgment criteria are shown in Table five.
TABLE V determination of PCR results
Meanwhile, when the sample and the internal standard plasmid are subjected to double fluorescence PCR amplification, a false positive result cannot occur, namely, the sample can be judged to be positive only by the sample having an S-shaped amplification curve; in order to avoid the false negative result, the sample needs to be judged according to the amplification curve of the sample and the amplification curve of the internal standard plasmid, and when the sample has no amplification curve and Ct of the internal standard plasmid is less than 35, the sample can be judged to be negative.
Please refer to fig. 1 to 4 for the amplification curve graphs of the negative quality control product, the positive quality control product, the clinical sample 1 and the clinical sample 2 of the present invention, and the Ct values read are detailed in tables six to nine. Wherein, fig. 1 is a PCR amplification curve chart during the detection of a negative quality control product, fig. 2 is a PCR amplification curve chart during the detection of a positive quality control product, fig. 3 is a PCR amplification curve chart during the detection of a clinical sample 1, and fig. 4 is a PCR amplification curve chart during the detection of a clinical sample 2. In FIGS. 1 to 4, the solid line represents the amplification curve showing the FAM detection channel and the dotted line represents the amplification curve showing the HEX detection channel.
TABLE VI negative quality control Ct value
| Ct | |
| FAM | — |
| HEX | 29.24 |
TABLE seven, Ct value of positive quality control material
| Ct | |
| FAM | 21.61 |
| HEX | 30.25 |
TABLE VIII, 1Ct value of clinical specimen and result determination
TABLE nine, 2Ct values and results determination for clinical samples
The clinical significance is as follows: can be used for diagnosing mycoplasma pneumoniae infection and provides reference for clinical treatment.
The primer group, the kit and the method for detecting the mycoplasma pneumoniae provided by the invention have the beneficial effects that:
firstly, a primer pair and a fluorescent probe with high specificity are designed respectively aiming at a specific target fragment and an internal standard plasmid of mycoplasma pneumoniae genome, and then are configured into a kit with convenient use and reliable detection result, and a scientific and reasonable PCR reaction system is designed, so that the method has the advantages of simple operation, high detection speed, good specificity and the like, and is particularly suitable for popularization and application in clinical inspection work.
Secondly, by adding an internal standard plasmid gene in the primer design and the kit, the occurrence of false negative can be effectively avoided, so that the sensitivity of the method is improved, and the detection result is more accurate and reliable.
The above description is only an embodiment of the present invention, and not intended to limit the scope of the present invention, and all equivalent flow transformations made by the present specification, or directly or indirectly applied to other related technical fields, are included in the scope of the present invention.
Sequence listing
<110> Shenzhen city children hospital
<120> primer set, kit and method for detecting mycoplasma pneumoniae
<130> 2017
<141> 2017-08-23
<160> 8
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
attattgggc tcgcgaaacg 20
<210> 2
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
ggctcgacag cttatacgac 20
<210> 3
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
aggcactacc aatcgcggct tg 22
<210> 4
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
ggcatgtgga ggaaggtggt 20
<210> 5
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
ccatggactg gctctccgtt 20
<210> 6
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
acgcagccct gcttcgttcg ccg 23
<210> 7
<211> 339
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
tcacaagcag gagtgtgcca ggagaaggcc aaaccatcca gtgccggtgg tttgaccacg 60
aggagtgcat cctgcacgga gtcactgagc tcgtgacctc cacgctgctc gtcccctgcg 120
ctatcgagag ggcactctct gtgtctcagc tggtgccgct ggcgcagagt gttttgggcc 180
ccttaaagct cagcatggct ggttctggag agatggaaaa gagaaaggat ttcccccatt 240
tgggtgcctc gggcatgtgg aggaaggtgg tccggcgaac gaagcagggc tgcgtgaagg 300
ggatctgata acccacgtca acggagagcc agtccatgg 339
<210> 8
<211> 277
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
tgtttcactt ggtttgccag tcaaacaacc cggtgcggga ggatgtattg gattgttggg 60
tttgaccatt cttctgctcc ggaaacaccg ccttaatgaa atccccgaag ttttgggcac 120
tgttgggggt ggggtcgaag gtggttttac cttggctttg tccattattg ggctcgcgaa 180
acgcggggaa ggcatagccc aactgtaagg cactaccaat cgcggcttgg tcgtataagc 240
tgtcgagccc gtccttgggt gcttggtacg cgaagaa 277
Claims (4)
1. A primer and a probe set for detecting mycoplasma pneumoniae, which are characterized by consisting of a specific primer pair and a probe aiming at a mycoplasma pneumoniae genome and a primer pair and a probe aiming at an internal standard plasmid, wherein:
the sequences of the specific primer pair and the probe aiming at the mycoplasma pneumoniae genome are as follows:
a specific upstream primer:
5’- ATTATTGGGCTCGCGAAACG -3’；
specific downstream primers:
5’- GGCTCGACAGCTTATACGAC -3’；
specific probes:
5’-FAM-AGGCACTACCAATCGCGGCTTG -TAMRA-3’；
the sequences of the primer pair and the probe aiming at the internal standard plasmid are as follows:
internal standard plasmid upstream primer:
5’- GGCATGTGGAGGAAGGTGGT-3’；
internal standard plasmid downstream primer:
5’-CCATGGACTGGCTCTCCGTT -3’；
internal standard plasmid probe:
5’-HEX-ACGCAGCCCTGCTTCGTTCGCCG-TAMRA-3’。
2. a kit for detecting mycoplasma pneumoniae is characterized by comprising a first PCR reaction solution and a second PCR reaction solution, wherein the first PCR reaction solution comprises a specific primer pair and a probe aiming at a mycoplasma pneumoniae genome, and a primer pair and a probe aiming at an internal standard plasmid, wherein,
the sequences of the specific primer pair and the probe aiming at the mycoplasma pneumoniae genome are as follows:
a specific upstream primer:
5’- ATTATTGGGCTCGCGAAACG -3’；
specific downstream primers:
5’- GGCTCGACAGCTTATACGAC -3’；
specific probes:
5’-FAM-AGGCACTACCAATCGCGGCTTG -TAMRA-3’；
the sequences of the primer pair and the probe aiming at the internal standard plasmid are as follows:
internal standard plasmid upstream primer:
5’- GGCATGTGGAGGAAGGTGGT-3’；
internal standard plasmid downstream primer:
5’-CCATGGACTGGCTCTCCGTT -3’；
internal standard plasmid probe:
5’-HEX-ACGCAGCCCTGCTTCGTTCGCCG-TAMRA-3’。
3. the kit for detecting mycoplasma pneumoniae according to claim 2, wherein the kit further comprises a negative quality control substance and a positive quality control substance.
4. The kit for detecting mycoplasma pneumoniae according to claim 3, wherein the negative quality control substance is physiological saline, and the positive quality control substance is a target fragment recombinant plasmid using pUC57 as a vector.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710728493.4A CN107475389B (en) | 2017-08-23 | 2017-08-23 | Primer group, kit and method for detecting mycoplasma pneumoniae |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710728493.4A CN107475389B (en) | 2017-08-23 | 2017-08-23 | Primer group, kit and method for detecting mycoplasma pneumoniae |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107475389A CN107475389A (en) | 2017-12-15 |
| CN107475389B true CN107475389B (en) | 2021-07-02 |
Family
ID=60601172
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710728493.4A Active CN107475389B (en) | 2017-08-23 | 2017-08-23 | Primer group, kit and method for detecting mycoplasma pneumoniae |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107475389B (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110387434A (en) * | 2018-04-16 | 2019-10-29 | 马东礼 | For detecting the primer sets and kit of herpes-like virus EBV |
| CN110387427A (en) * | 2018-04-16 | 2019-10-29 | 马东礼 | For detecting the primer sets and kit of streptococcus pneumonia |
| WO2019221537A1 (en) * | 2018-05-18 | 2019-11-21 | 재단법인 아산사회복지재단 | Method for detecting mycoplasma using mitochondrial dna as internal control sample |
| CN109913564B (en) * | 2019-04-09 | 2024-01-09 | 深圳市儿童医院 | Primer probe composition, kit and method for detecting chlamydia pneumoniae |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5712090A (en) * | 1993-05-18 | 1998-01-27 | Iowa State University Research Foundation, Inc. | PCR-based assay for Mycoplasma hyopneumoniae |
| CN101492741A (en) * | 2009-01-22 | 2009-07-29 | 中国农业科学院北京畜牧兽医研究所 | Method for quantitative detection of mycoplasma hyopneumoniae |
| CN103060451B (en) * | 2013-01-10 | 2016-03-02 | 湖南圣湘生物科技有限公司 | A kind of mycoplasma pneumoniae MP detection kit |
| CN104988242A (en) * | 2015-08-11 | 2015-10-21 | 上海睿玻生物科技有限公司 | Kit for detecting mycoplasma hominis nucleic acid through PCR-fluorescence probe method and detecting method of kit |
-
2017
- 2017-08-23 CN CN201710728493.4A patent/CN107475389B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN107475389A (en) | 2017-12-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| WO2021174674A1 (en) | Composition, kit and method for detecting and typing coronaviruses | |
| WO2021208382A1 (en) | Composition, kit and method for detecting and classifying pathogens causing respiratory tract infections, and application | |
| CN107475389B (en) | Primer group, kit and method for detecting mycoplasma pneumoniae | |
| WO2021155638A1 (en) | Dual detection kit for 2019 novel corona virus | |
| CN104195266B (en) | Detect the quadruple PCR kit for fluorescence quantitative of infantile pneumonia three kinds of pathogenic agent | |
| CN111286559B (en) | Primer, probe and kit for detecting African swine fever virus | |
| WO2022095731A1 (en) | Kit and method for detecting sars-cov-2 | |
| CN111733298B (en) | Composition, kit and method for detecting and typing polyoma virus and application thereof | |
| CN109913564B (en) | Primer probe composition, kit and method for detecting chlamydia pneumoniae | |
| CN111518877B (en) | One-tube method nest type real-time quantitative PCR detection kit for detecting echinococcus multilocularis and echinococcus granulosus by parting trace samples | |
| CN112410472A (en) | Primer probe combination and detection kit for detecting mycoplasma pneumoniae, chlamydia pneumoniae and adenovirus | |
| WO2021179469A1 (en) | Composition for detecting pathogens, and kit and method therefor | |
| CN104131006A (en) | Rapid detection kit for human adenoviruses | |
| CN107574261A (en) | For detecting the detection primer, detection kit and detection method of Hantaan virus | |
| CN104946753A (en) | Specificity primer pair for cow mycoplasma detection, detection kit, as well as using method and application of detection kit | |
| CN105936945B (en) | A kind of multiple reverse transcription quantitative PCR kit of four kinds of Respirovirus of joint inspection | |
| CN115627297B (en) | Kit for detecting human excrement helicobacter pylori nucleic acid | |
| CN110904194A (en) | Mycoplasma pneumoniae and chlamydia pneumoniae nucleic acid combined detection kit and application thereof | |
| CN107513583A (en) | Detect the absolute fluorescence quantification PCR primer and kit of the pestivirus of atypia pig | |
| CN114836580B (en) | Multiplex qPCR detection primer combination for respiratory tract infectious disease pathogens | |
| WO2023109031A1 (en) | Respiratory pathogen detection kit, and preparation method therefor and use thereof | |
| CN115612753A (en) | Method for detecting aleuti, enteritis and canine distemper | |
| CN107699638A (en) | A kind of method for detecting feline calicivirus | |
| CN110760590A (en) | Method for detecting schistosoma japonicum infection by using host exosome miRNA-223-3p | |
| CN111471780A (en) | Helicobacter pylori saliva detection biomarker and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |