CN110387427A - For detecting the primer sets and kit of streptococcus pneumonia - Google Patents
For detecting the primer sets and kit of streptococcus pneumonia Download PDFInfo
- Publication number
- CN110387427A CN110387427A CN201810336183.2A CN201810336183A CN110387427A CN 110387427 A CN110387427 A CN 110387427A CN 201810336183 A CN201810336183 A CN 201810336183A CN 110387427 A CN110387427 A CN 110387427A
- Authority
- CN
- China
- Prior art keywords
- kit
- streptococcus pneumonia
- primer
- detecting
- probe
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
Abstract
The present invention relates to a kind of for detecting the primer sets of streptococcus pneumonia.The primer sets include respectively for pneumococcal dna purpose segment and interior target specific primer and probe.The invention further relates to a kind of for detecting the kit of streptococcus pneumonia.The kit includes PCR reaction solution, enzymatic mixture, negative controls and positive reference substance, and the PCR reaction solution includes detection pneumococcal dna purpose segment and interior target specific primer and probe.Kit provided by the invention and its detection method have many advantages, such as that easy to operate, detection time is short, detection sensitivity is high and specific good, are particularly suitable for the popularization and application in clinical examination work.
Description
Technical field
The present invention relates to vitro diagnostic techniques fields more particularly to a kind of for detecting the primer sets and examination of streptococcus pneumonia
Agent box.
Background technique
Streptococcus pneumonia (Streptococcus pneumoniae, sp) is Grain stain positive cocci, is in way double-line more
Or short chain arrangement.Have a pod membrane, virulence size in pod membrane polysaccharide structures and content it is related.It is special according to the antigen of capsular polysaccharide
Property, 86 serotypes can be divided into.Adult pathogenic bacteria belong to 1-9 type and 12 types more, most strong with the 3rd type virulence, and children then more 6,14,19
And 23 type.When body's immunity is normal, streptococcus pneumonia is a kind of normal flora for residing in oral cavity and pharynx nasalis, is carried disease germs
For rate with the age, season and the variation for exempting from state are variant.When body's immunity is damaged, there is the streptococcus pneumonia invasion people of virulence
Body and cause a disease.Pneumococcal pneumonia is the pneumonia as caused by streptococcus pneumoniae infection, accounts for about the half of community acquired pneumonia
Number.Usual hurried onset is shivered with cold with high fever, and cough, bloody sputum and pectoralgia are characterized.In addition to causing pneumonia, bacterium can occur SP for minority
The state of an illness of mass formed by blood stasis or infectious shock, the elderly and infant are particularly acute.
It is as follows to the rapid detection method of streptococcus pneumonia in the prior art: 1, traditional cultural method (National Standard Method), i.e.,
Goldstandard of the SP still as diagnosis is obtained from blood or pleural effusion culture of isolated；2, latex agglutination, the method are a kind of needles
Method is aggregated to the immunology of pneumococcal capsule antigen；3, automatic method, the self-reacting device of microorganism detection has been at present
It is commonly used, for streptococcus pneumonia detection common methods have: APE20Streep identify strip, VITEK MAS system,
PHOENIX MIC/ID identification plate and MICRO-SAN Walk Away etc.；4, immunochromatographic method (Immunochromatograhy,
ICT-is now widely used in the fast method of SP diagnosis, is detected as antigens c polysaccharide common to each serotype of SP.This method
It can be used for detecting urine, pleural effusion, cerebrospinal fluid and bronchial perfusate；5, nucleic acid amplification technologies, PCR (Polymerase
Chain Reaction, polymerase chain reaction) belong to a kind of Progress of Nucleic Acid Amplification Technologies, the DNA by oligonucleotides guidance is closed
At repetitive cycling come the DNA that realizes the amplification to target nucleic acid sequence, and expanded using gel or probe hybridization check.
But shortcoming is still had in above-mentioned method, using traditional cultural method (National Standard Method), latex agglutination
And immunochromatographyassay assay, it may appear that false positive or false negative result influence the accuracy of experimental result；Automatic method due to
Automation identification systems are the identification bacteriums of the background information according to provided in database, and the imperfect of database data will be direct
The accuracy of identification is influenced, and there is no an energy at present includes the identification systems of all details materials of identification；And nucleic acid amplification
Although being as a result better than above-mentioned 4 kinds of methods, pcr amplification product is post-processed technology (PCR), and after PCR product
There is pollution in reason, can still result in false positive results, and can cause environmental pollution, have to experimenter potentially hazardous.
Summary of the invention
The object of the present invention is to provide a kind of primer sets and kit for detecting streptococcus pneumonia, have operation quick, square
The advantage that method is simple, detection sensitivity is high, specificity is strong and accuracy is good.
The present invention provides a kind of for detecting the primer sets of streptococcus pneumonia, and the primer sets include such as following nucleotides sequence
Primer and probe shown in column:
Upstream primer:
5’-GGCTGCTGGAACATCGATAC-3’
Downstream primer:
5’-ACAGCGCTACAGTCAATGTC-3’
Probe:
5’-FAM-TGTCCTTAACGTTGTCTGCAACGGC-TAMRA-3’
Internal standard upstream primer:
5’-GGCATGTGGAGGAAGGTGGT-3’
Internal standard downstream primer:
5’-CCATGGACTGGCTCTCCGTT-3’
Internal standard probe:
5’-HEX-ACGCAGCCCTGCTTCGTTCGCCG-TAMRA-3’。
The present invention also provides a kind of for detecting the kit of streptococcus pneumonia, and the kit includes PCR reaction solution, institute
Stating PCR reaction solution includes the primer as shown in following nucleotide sequence and probe:
Upstream primer:
5’-GGCTGCTGGAACATCGATAC-3’
Downstream primer:
5’-ACAGCGCTACAGTCAATGTC-3’
Probe:
5’-FAM-TGTCCTTAACGTTGTCTGCAACGGC-TAMRA-3’
Internal standard upstream primer:
5’-GGCATGTGGAGGAAGGTGGT-3’
Internal standard downstream primer:
5’-CCATGGACTGGCTCTCCGTT-3’
Internal standard probe:
5’-HEX-ACGCAGCCCTGCTTCGTTCGCCG-TAMRA-3’。
In one preferred embodiment of kit provided by the present invention for detecting streptococcus pneumonia, the PCR reaction solution
In each primer final concentration of 0.4 μm of ol/L, final concentration of 0.125 μm of ol/L of each probe.
In one preferred embodiment of kit provided by the present invention for detecting streptococcus pneumonia, the kit is also wrapped
Enzymatic mixture is included, the enzymatic mixture is the mixed liquor of thermal starting enzyme and UNG enzyme.
In one preferred embodiment of kit provided by the present invention for detecting streptococcus pneumonia, the kit is also wrapped
Include positive reference substance and negative controls.
In one preferred embodiment of kit provided by the present invention for detecting streptococcus pneumonia, the positive reference substance
For the genomic DNA extracted in streptococcus pneumonia reference culture suspension, the negative controls are physiological saline.
In one preferred embodiment of kit provided by the present invention for detecting streptococcus pneumonia, the kit is also wrapped
Internal standard is included, the interior target nucleotide sequence is as follows:
TCACAAGCAGGAGTGTGCCAGGAGAAGGCCAAACCATCCAGTGCCGGTGGTTTGACCACGAGGAGTGCATCCTGCAC
GGAGTCACTGAGCTCGTGACCTCCACGCTGCTCGTCCCCTGCGCTATCGAGAGGGCACTCTCTGTGTCTCAGCTGGT
GCCGCTGGCGCAGAGTGTTTTGGGCCCCTTAAAGCTCAGCATGGCTGGTTCTGGAGAGATGGAAAAGAGAAAGGATT
TCCCCCATTTGGGTGCCTCGGGCATGTGGAGGAAGGTGGTCCGGCGAACGAAGCAGGGCTGCGTGAAGGGGATCTGA
TAACCCACGTCAACGGAGAGCCAGTCCATGG。
The present invention also provides a kind of use of primer sets as described above in the kit of preparation detection streptococcus pneumonia
On the way.
Compared to the prior art, provided by the present invention for the primer sets and kit beneficial effect of detection streptococcus pneumonia
It is:
One, kit operation provided by the invention is quickly, method is simple, detection sensitivity is high, specificity 100%, application
The kit can fast and accurately detect the streptococcus pneumonia in unknown sample, provide for diagnosis of pneumonia streptococcal infection
Reliable experimental basis is particularly suitable for the popularization and application in clinical examination work.
Two, include in PCR reaction solution for streptococcus pneumonia design specific primer, probe and for interior target it is special
Property primer and probe, have the advantages that expression is stable based on internal standard, it is possible to prevente effectively from the generation of false negative, and can also be preferably
Destination gene expression amount is corrected, so that the sensitivity and repeatability of the method for the present invention are improved, so that testing result is more
Accurately and reliably.
Detailed description of the invention
Fig. 1 is the PCR amplification curve graph provided by the present invention for negative controls in detection streptococcus pneumonia kit；
Fig. 2 is the PCR amplification curve graph provided by the present invention for positive reference substance in detection streptococcus pneumonia kit；
Fig. 3 is the PCR amplification curve graph of clinical sample.
Specific embodiment
In order to make the objectives, technical solutions, and advantages of the present invention clearer, with reference to the accompanying drawings and embodiments, right
The present invention is described in further detail.It should be appreciated that described herein, specific examples are only used to explain the present invention, and
It is not used in the restriction present invention.
Embodiment 1: the design and synthesis of primer and probe
Streptococcus is downloaded in internal authority database GenBank nucleic acid database (Nucleotide)
The canonical sequence (GenBank:NC_003098.1, sequence 2038615bp) of pneumoniae, and using freely increasing income
Kers tool Jellyfish (https: //github.com/gmarcais/Jellyfish) connects whole genome sequence
Continuous cutting, the nucleotide sequence library that the sequence length that base stroke obtains in turn is 80 to 250, therefrom preferably repeat it is more (>=
2) sequence alignment finally obtains highly conserved sequence Spec_i29457 to the NR database of NCBI.Using this aim sequence as mould
Plate separately designs specific primer using Primer Premier 3.0 and Methyl Primer Express v1.0 software
And probe, marked for the probe of streptococcus pneumonia primer using 5'-FAM and 3'-TRAMA, internal standard probe using 5'-HEX and
3'-TRAMA label.
Specific primer and probe sequence:
The preparation of embodiment two, kit
The present invention provides a kind of for detecting the kit of streptococcus pneumonia, and the kit includes mentioning containing embodiment one
The specific primer of confession and PCR reaction solution, enzymatic mixture, positive reference substance, negative controls and the internal standard of probe, in which:
PCR reaction solution: the final concentration of each ingredient and each ingredient is respectively as follows: the upstream of 0.4 μm of ol/L in the PCR reaction solution
Primer, the downstream primer of 0.4 μm of ol/L, the probe of 0.125 μm of ol/L, the internal standard upstream primer of 0.4 μm of ol/L, 0.4 μm of ol/L
Internal standard downstream primer, the internal standard probe of 0.125 μm of ol/L；
Enzymatic mixture: the enzymatic mixture is the mixed liquor of thermal starting enzyme (0.01U/ μ L) and UNG enzyme (0.03U/ μ L)；
Positive reference substance: the positive reference substance is the genomic DNA extracted in streptococcus pneumonia reference culture suspension；
Negative controls: the negative controls are physiological saline；
Internal standard: the interior target nucleotide sequence is as shown in SEQ ID NO.7:
SEQ ID NO.7:
TCACAAGCAGGAGTGTGCCAGGAGAAGGCCAAACCATCCAGTGCCGGTGGTTTGACCACGAGGAGTGCATCCTGCAC
GGAGTCACTGAGCTCGTGACCTCCACGCTGCTCGTCCCCTGCGCTATCGAGAGGGCACTCTCTGTGTCTCAGCTGGT
GCCGCTGGCGCAGAGTGTTTTGGGCCCCTTAAAGCTCAGCATGGCTGGTTCTGGAGAGATGGAAAAGAGAAAGGATT
TCCCCCATTTGGGTGCCTCGGGCATGTGGAGGAAGGTGGTCCGGCGAACGAAGCAGGGCTGCGTGAAGGGGATCTGA
TAACCCACGTCAACGGAGAGCCAGTCCATGG。
Embodiment 3
The present embodiment provides the operating procedures that kit described in above-described embodiment 2 is used to detect streptococcus pneumonia in sample:
One, biological sample
Take deep sputum, timely inspection.Sample 197 is collected altogether, and all clinical samples derive from Shenzhen Children's Hospital.
Two, sample extraction:
1) physiological saline for adding 4 times of volumes in sputum, after being blown and beaten repeatedly with the sample loading gun of 1ml, sets 4 DEG C of refrigerator overnights, makes
Sputum sufficiently liquefies；
2) liquefaction sputum 1ml to 1.5ml is taken to be placed in centrifuge tube, 12000rpm is centrifuged 5 minutes；
3) internal standard is taken to be added in sample treatment solution, additional proportion 1:50；
4) centrifugate removes supernatant, and 50 μ l sample treatment solutions are added in precipitating, mix well, and 100 DEG C of constant temperature are handled 10 minutes；
5) 12,000g is centrifuged 5 minutes, spare.
In the present embodiment, 1 has been selected to be detected from clinical sample.
Three, it is loaded into PCR reaction tube
Sample, the positive reference substance, each 3.5 μ of negative controls of step 2 extraction are separately added into each PCR reaction tube
L, 15.7 μ L of PCR reaction solution, 0.8 μ L of enzymatic mixture, total volume are 20 μ L, pay attention to avoiding generating bubble, are covered abundant after pipe lid
It mixes, is transferred to amplification region.
Four, Fluorescence PCR
1) PCR reaction tube is sequenced and is put into amplification instrument sample cell, the title of each PCR reaction tube is set by corresponding sequence；
By table 1, PCR response parameter is set；
2) PCR reaction condition is as shown in table 1
Table 1
Five, fluorescence channel selects
FAM Air conduct measurement sample is selected, HEX Air conduct measurement internal standard is selected.
Six, interpretation of result and testing result are explained
After reaction, result is saved.According to PCR instrument specification and fluorescence curve automatic or manual adjustment baseline and threshold
Value.Highest point of the threshold value setting principle with threshold value just above negative control detection fluorescence.After setting, analysis " analysis is clicked
(Analyze) " key can obtain the Ct value of each sample from report (Reports) window.
Under conditions of meeting quality control, sample to be tested inspection result is likely to occur following several situations:
1) if the channel FAM and the channel HEX do not occur S type amplification curve, testing result is invalid, in fact it could happen that pipe
Interior inhibition should extract pattern detection again.
If 2) S type amplification curve occurs in the channel FAM, sample to be detected is the positive；
3) if obvious S type amplification curve does not occur in the channel FAM, and the Ct value in the channel HEX is less than or equal to 35, then for
It is negative.
It is specific as shown in table 2:
Table 2
By detecting to fixed positive reference substance with negative controls, obtained PCR amplification curve is detected
Fig. 1, Fig. 2, table 3 and table 4 are please referred to, Fig. 1 is provided by the present invention for negative control in detection herpes-like virus EBV kit
The PCR amplification curve graph of product；Fig. 2 is provided by the present invention for positive reference substance in detection herpes-like virus EBV kit
PCR amplification curve graph；The corresponding FAM and HEX channel C t value of Fig. 1 is as shown in table 3；The corresponding FAM and HEX channel C t value of Fig. 2 is such as
Shown in table 4.From Fig. 1 and table 3 as can be seen that when detecting negative controls, there is not S type amplification curve in the channel FAM, and HEX is logical
The Ct in road is less than 35, and from Fig. 2 and table 4 as can be seen that when detecting positive reference substance, it is bent that apparent S type amplification occurs in the channel FAM
Line, reagent yin and yang attribute reference substance coincidence rate 100%.
Table 3
| Ct | |
| FAM | - |
| HEX | 32.72 |
Table 4
| Ct | |
| FAM | 24.20 |
| HEX | 31.41 |
The testing result of sample is detailed in Fig. 3 and table 5, and Fig. 3 is the PCR amplification curve graph of clinical sample；The corresponding FAM of Fig. 3
It is as shown in table 5 with HEX channel C t value.
Table 5
It is provided by the present invention for the primer sets and kit beneficial effect for detecting streptococcus pneumonia:
One, kit operation provided by the invention is quickly, method is simple, detection sensitivity is high, specificity 100%, application
The kit can fast and accurately detect the streptococcus pneumonia in unknown sample, provide for diagnosis of pneumonia streptococcal infection
Reliable experimental basis is particularly suitable for the popularization and application in clinical examination work.
Two, include in PCR reaction solution for streptococcus pneumonia design specific primer, probe and for interior target it is special
Property primer and probe, have the advantages that expression is stable based on internal standard, it is possible to prevente effectively from the generation of false negative, and can also be preferably
Destination gene expression amount is corrected, so that the sensitivity and repeatability of the method for the present invention are improved, so that testing result is more
Accurately and reliably.
The above description is only an embodiment of the present invention, is not intended to limit the scope of the invention, all to utilize this hair
Equivalent process transformation made by bright description is applied directly or indirectly in other relevant technical fields, similarly wraps
It includes in scope of patent protection of the invention.
SEQUENCE LISTING
<110>Shenzhen Children's Hospital
<120>for detecting the primer sets and kit of streptococcus pneumonia
<130> 2018
<160> 7
<170> PatentIn version 3.5
<210> 1
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 1
ggctgctgga acatcgatac 20
<210> 2
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 2
acagcgctac agtcaatgtc 20
<210> 3
<211> 25
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 3
tgtccttaac gttgtctgca acggc 25
<210> 4
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 4
ggcatgtgga ggaaggtggt 20
<210> 5
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 5
ccatggactg gctctccgtt 20
<210> 6
<211> 23
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 6
acgcagccct gcttcgttcg ccg 23
<210> 7
<211> 339
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 7
tcacaagcag gagtgtgcca ggagaaggcc aaaccatcca gtgccggtgg tttgaccacg 60
aggagtgcat cctgcacgga gtcactgagc tcgtgacctc cacgctgctc gtcccctgcg 120
ctatcgagag ggcactctct gtgtctcagc tggtgccgct ggcgcagagt gttttgggcc 180
ccttaaagct cagcatggct ggttctggag agatggaaaa gagaaaggat ttcccccatt 240
tgggtgcctc gggcatgtgg aggaaggtgg tccggcgaac gaagcagggc tgcgtgaagg 300
ggatctgata acccacgtca acggagagcc agtccatgg 339
Claims (8)
1. a kind of for detecting the primer sets of streptococcus pneumonia, which is characterized in that including drawing as shown in following nucleotide sequence
Object and probe:
Upstream primer:
5’-GGCTGCTGGAACATCGATAC-3’
Downstream primer:
5’-ACAGCGCTACAGTCAATGTC-3’
Probe:
5’-FAM-TGTCCTTAACGTTGTCTGCAACGGC-TAMRA-3’
Internal standard upstream primer:
5’-GGCATGTGGAGGAAGGTGGT-3’
Internal standard downstream primer:
5’-CCATGGACTGGCTCTCCGTT-3’
Internal standard probe:
5’-HEX-ACGCAGCCCTGCTTCGTTCGCCG-TAMRA-3’。
2. a kind of for detecting the kit of streptococcus pneumonia, which is characterized in that the kit includes PCR reaction solution, described
PCR reaction solution includes the primer as shown in following nucleotide sequence and probe:
Upstream primer:
5’-GGCTGCTGGAACATCGATAC-3’
Downstream primer:
5’-ACAGCGCTACAGTCAATGTC-3’
Probe:
5’-FAM-TGTCCTTAACGTTGTCTGCAACGGC-TAMRA-3’
Internal standard upstream primer:
5’-GGCATGTGGAGGAAGGTGGT-3’
Internal standard downstream primer:
5’-CCATGGACTGGCTCTCCGTT-3’
Internal standard probe:
5’-HEX-ACGCAGCCCTGCTTCGTTCGCCG-TAMRA-3’。
3. according to claim 2 for detecting the kit of streptococcus pneumonia, which is characterized in that the PCR reaction solution
In each primer final concentration of 0.4 μm of ol/L, final concentration of 0.125 μm of ol/L of each probe.
4. according to claim 2 for detecting the kit of streptococcus pneumonia, which is characterized in that the kit also wraps
Enzymatic mixture is included, the enzymatic mixture is the mixed liquor of thermal starting enzyme and UNG enzyme.
5. according to claim 2 for detecting the kit of streptococcus pneumonia, which is characterized in that the kit also wraps
Include positive reference substance and negative controls.
6. according to claim 5 for detecting the kit of streptococcus pneumonia, which is characterized in that the positive reference substance
For the genomic DNA extracted in streptococcus pneumonia reference culture suspension, the negative controls are physiological saline.
7. according to claim 2 for detecting the kit of streptococcus pneumonia, which is characterized in that the kit also wraps
Internal standard is included, the interior target nucleotide sequence is as follows:
TCACAAGCAGGAGTGTGCCAGGAGAAGGCCAAACCATCCAGTGCCGGTGGTTTGACCACGAGGAGTGCATCCT
GCACGGAGTCACTGAGCTCGTGACCTCCACGCTGCTCGTCCCCTGCGCTATCGAGAGGGCACTCTCTGTGTCTCAGC
TGGTGCCGCTGGCGCAGAGTGTTTTGGGCCCCTTAAAGCTCAGCATGGCTGGTTCTGGAGAGATGGAAAAGAGAAAG
GATTTCCCCCATTTGGGTGCCTCGGGCATGTGGAGGAAGGTGGTCCGGCGAACGAAGCAGGGCTGCGTGAAGGGGAT
CTGATAACCCACGTCAACGGAGAGCCAGTCCATGG。
8. a kind of purposes of primer sets as described in claim 1 in the kit of preparation detection streptococcus pneumonia.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810336183.2A CN110387427A (en) | 2018-04-16 | 2018-04-16 | For detecting the primer sets and kit of streptococcus pneumonia |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810336183.2A CN110387427A (en) | 2018-04-16 | 2018-04-16 | For detecting the primer sets and kit of streptococcus pneumonia |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN110387427A true CN110387427A (en) | 2019-10-29 |
Family
ID=68282647
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810336183.2A Pending CN110387427A (en) | 2018-04-16 | 2018-04-16 | For detecting the primer sets and kit of streptococcus pneumonia |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110387427A (en) |
Citations (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5656432A (en) * | 1992-02-10 | 1997-08-12 | Bio Merieux | Genomic DNA fragment of Streptococcus pneumoniae, hybridization probe, amplification primer, reagent and method for the detection of Streptococcus pneumoniae |
| US20040101919A1 (en) * | 2002-09-13 | 2004-05-27 | Magnus Hook | Bioinformatic method for identifying surface-anchored proteins from gram-positive bacteria and proteins obtained thereby |
| CN101293921A (en) * | 1998-07-27 | 2008-10-29 | 赛诺菲巴斯德有限公司 | Streptococcus pneumoniae proteins and nucleic acid molecules |
| CN101760520A (en) * | 2008-10-23 | 2010-06-30 | 上海复星医药（集团）股份有限公司 | Target sequence for detection of Mycoplasma pneumoniae and kit |
| US20100183596A1 (en) * | 2007-04-12 | 2010-07-22 | Hester Jeanette Bootsma | Virulence Factors of Streptoccus Pnuemoniae |
| US20100227341A1 (en) * | 2006-08-17 | 2010-09-09 | The Uab Research Foundation | Diagnosing Pneumococcal Pneumonia |
| CN102876774A (en) * | 2012-08-31 | 2013-01-16 | 武汉百泰基因工程有限公司 | Primer, fluorescence probe and kit for quantitative detection of streptococcus pneumonia nucleic acid and detection method of streptococcus pneumonia nucleic acid |
| CN105063218A (en) * | 2015-08-20 | 2015-11-18 | 杭州市第一人民医院 | Multiple quantitative PCR (polymerase chain reaction) kit for quick combined detection of four bacteria difficult to cultivate and identify |
| CN107475389A (en) * | 2017-08-23 | 2017-12-15 | 深圳市儿童医院 | For detecting primer sets, kit and the method for mycoplasma pneumoniae |
-
2018
- 2018-04-16 CN CN201810336183.2A patent/CN110387427A/en active Pending
Patent Citations (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5656432A (en) * | 1992-02-10 | 1997-08-12 | Bio Merieux | Genomic DNA fragment of Streptococcus pneumoniae, hybridization probe, amplification primer, reagent and method for the detection of Streptococcus pneumoniae |
| CN101293921A (en) * | 1998-07-27 | 2008-10-29 | 赛诺菲巴斯德有限公司 | Streptococcus pneumoniae proteins and nucleic acid molecules |
| US20040101919A1 (en) * | 2002-09-13 | 2004-05-27 | Magnus Hook | Bioinformatic method for identifying surface-anchored proteins from gram-positive bacteria and proteins obtained thereby |
| US20100227341A1 (en) * | 2006-08-17 | 2010-09-09 | The Uab Research Foundation | Diagnosing Pneumococcal Pneumonia |
| US20100183596A1 (en) * | 2007-04-12 | 2010-07-22 | Hester Jeanette Bootsma | Virulence Factors of Streptoccus Pnuemoniae |
| US20170065698A1 (en) * | 2007-04-12 | 2017-03-09 | Stichting Katholieke Universiteit/Radboud University Nijmegen Medical Centre | Virulence factors of streptococcus pnuemoniae |
| CN101760520A (en) * | 2008-10-23 | 2010-06-30 | 上海复星医药（集团）股份有限公司 | Target sequence for detection of Mycoplasma pneumoniae and kit |
| CN102876774A (en) * | 2012-08-31 | 2013-01-16 | 武汉百泰基因工程有限公司 | Primer, fluorescence probe and kit for quantitative detection of streptococcus pneumonia nucleic acid and detection method of streptococcus pneumonia nucleic acid |
| CN105063218A (en) * | 2015-08-20 | 2015-11-18 | 杭州市第一人民医院 | Multiple quantitative PCR (polymerase chain reaction) kit for quick combined detection of four bacteria difficult to cultivate and identify |
| CN107475389A (en) * | 2017-08-23 | 2017-12-15 | 深圳市儿童医院 | For detecting primer sets, kit and the method for mycoplasma pneumoniae |
Non-Patent Citations (2)
| Title |
|---|
| 颜善活等: "实时荧光定量PCR快速诊断肺炎链球菌", 《检验医学》 * |
| 黄红等: "肺炎链球菌的实验室检测研究进展", 《西藏医药》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111500776A (en) | Novel coronavirus 2019-nCoV fluorescent RPA detection primer, probe, kit and method | |
| CN102618655B (en) | Loop-mediated isotherm amplification (LAMP) kit for detecting mycoplasma pneumoniae (Mp) | |
| CN103614489B (en) | Constant-temperature amplification detection kit for dengue viruses and detection method | |
| CN110791578B (en) | CRISPR (clustered regularly interspaced short palindromic repeats) detection primer group for bordetella pertussis and application of CRISPR detection primer group | |
| CN108504778B (en) | Kit that is a kind of while detecting porcine circovirus 2 type and porcine pseudorabies virus and application | |
| Saukkoriipi et al. | Real-time quantitative PCR for the detection of Streptococcus pneumoniae in the middle ear fluid of children with acute otitis media | |
| CN101760560A (en) | Fluorescent PCR detection method for human cytomegalovirus (HCMV) | |
| CN105567872A (en) | RT-RPA detection reagent kit for quickly detecting pest des petits ruminant viruses and application thereof | |
| CN109913564A (en) | It is a kind of for detecting primer combination of probe object, kit and the method for chlamydia pneumoniae | |
| CN109371148A (en) | Identify the fluorescent PCR kit and quantitative detecting method of three kinds of porcine respiratory bacteriums | |
| ITVT20110002A1 (en) | METHOD OF DETERMINING THE ORIGIN OF FLUIDS OR BIOLOGICAL TRACKS AND REAGENT KITS FOR THEIR IDENTIFICATION IN A SAMPLE. | |
| CN105349661A (en) | Chlamydia trachomatis and gonococcus nucleic acid detection kit | |
| CN103060447B (en) | Triple real-time fluorescent PCR testing primers of four kinds of bacterium, probe, detection kit and detection method | |
| CN111763752A (en) | RPA-based method for rapidly detecting urogenital mycoplasma | |
| CN105936945A (en) | Multiplex reverse transcription PCR kit for detecting four respiratory viruses | |
| CN110904194A (en) | Mycoplasma pneumoniae and chlamydia pneumoniae nucleic acid combined detection kit and application thereof | |
| CN112301159A (en) | RDA method and kit for rapidly detecting influenza B virus | |
| Nour et al. | Amplification of P1 and 16S rRNA genes by nested PCR for detection of Mycoplasma pneumoniae in paediatric patients | |
| CN110387427A (en) | For detecting the primer sets and kit of streptococcus pneumonia | |
| CN108060244A (en) | A kind of nucleotide sequence and application for mycobacterium tuberculosis complex detection | |
| CN102337352B (en) | Kit for detecting multiple influenza viruses by polymerase chain reaction (PCR) microarray | |
| CN1952174A (en) | LUX fluorescent primer special for detecting bovine herpes virus type I and process for nucleic acid amplification | |
| CN109666750B (en) | Multiplex real-time fluorescence PCR detection primer probe set and detection method for identifying streptococcus suis and pasteurella multocida | |
| WO2016078215A1 (en) | Primers, probes and kit for detecting and typing five ebola virus subtypes by one-step method reverse transcription pcr | |
| CN105349660A (en) | Chlamydia trachomatis and ureaplasma urealyticum nucleic acid detection kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |