CN105349660A - Chlamydia trachomatis and ureaplasma urealyticum nucleic acid detection kit - Google Patents
Chlamydia trachomatis and ureaplasma urealyticum nucleic acid detection kit Download PDFInfo
- Publication number
- CN105349660A CN105349660A CN201510848917.1A CN201510848917A CN105349660A CN 105349660 A CN105349660 A CN 105349660A CN 201510848917 A CN201510848917 A CN 201510848917A CN 105349660 A CN105349660 A CN 105349660A
- Authority
- CN
- China
- Prior art keywords
- chlamydia trachomatis
- ureaplasma urealyticum
- nucleic acid
- kit
- detecting nucleic
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a chlamydia trachomatis and ureaplasma urealyticum nucleic acid detection kit which comprises a chlamydia trachomatis and ureaplasma urealyticum PCR reaction solution. The PCR reaction solution comprises a reaction buffer solution, deoxyribonucleoside triphosphote, upstream and downstream primers used for target polynucleotide amplification, a probe used for target polynucleotide detection and the like. The probe used for target polynucleotide detection is high in specificity. By the adoption of the kit, chlamydia trachomatis and ureaplasma urealyticum DNA in an unknown sample like genital secretion can be rapidly detected at the same time, the detection sensitivity can reach 200 copies/ml, the detection range is 200 copies/ml-4.00E+10 copies/ml, the reliable experiment basis is provided for diagnosing chlamydia trachomatis and ureaplasma urealyticum infection, and the problems that an existing kit is low in detection efficiency, poor in specificity and low in sensitivity can be solved.
Description
Technical field
The present invention relates to a kind of chlamydia trachomatis/ureaplasma urealyticum kit for detecting nucleic acid, be specifically related to a kind of quantitative fluorescent PCR chlamydia trachomatis/ureaplasma urealyticum kit for detecting nucleic acid.
Background technology
Chlamydia trachomatis (CT) is that one has unique growth cycle, strict endotrophic prokaryotic microorganism, be a class between virus, peculiar microorganism between bacterium and rickettsia, microorganism classification belongs to Bacteriophyta, rickettsia guiding principle, Chlamydiales and chlamydiaceae.Be one of domestic and international modal sexual reverse, occupy the 3rd of STD at China's reproductive tract choamydiae infection, and its sickness rate have the trend increased year by year.After organism infection CT, generation type specific cellular immunity and humoral immunization can be induced, but immunizing power is not strong usually, and remains of short duration, thus often cause persistent infection, inapparent infection and repeated infection.
Ureaplasma urealyticum is also known as Ureaplasma urealyticum (UU), belong to the Ureaplasma of soft film guiding principle Mycoplasmas Mycoplasmataceae, the minimum prokaryotic micro-organisms of a class between bacterium and virus, mainly be distributed in human body urogenital tract, and contacted by property and propagate, also can by parent vertical infection to fetus.The modal parasitism of male genital is in urethral orifice and seminal fluid, and the modal parasitism of female genital tract is in vagina.Ureaplasma urealyticum is one of main pathogens of nongonococcal urethritis, can cause multiple urogenital tract infection after infection.The male sex, the generation of nongonococcal urethritis, acute epididymitis, prostatitis etc. can be caused; Can cause in women and comprise endometritis, salpingitis, ovaritis etc., intrauterine infection can cause the adverse consequencess such as miscarriage, stillborn foetus, premature labor.
The diagnostic method of current chlamydia trachomatis and ureaplasma urealyticum mainly contains culture method and immunological method, wherein, specificity and the susceptibility of culture method are high, but clinical detection overlong time (at least needs 24h-48h, the even longer time), process is loaded down with trivial details, needs to use special developing medium and be subject to miscellaneous bacteria impact, is not suitable for and detects on a large scale.Immunological method is simple and efficient, but poor specificity, sensitivity are not high.In recent years, poly-nuclear polymerase chain reaction (PCR) method gradually manifested its detect on advantage, standard PCR procedures is divided into three steps: DNA sex change (90 DEG C-96 DEG C): double-stranded DNA template under heat effect, hydrogen bond rupture, formed single stranded DNA; Annealing (60 DEG C-65 DEG C): system temperature reduces, and primer is combined with DNA profiling, forms local double-strand; Extend (70 DEG C-75 DEG C): in Taq enzyme (at about 72 DEG C, active best) effect under, with deoxyribonucleoside triphosphate (dNTP) for raw material, to extend from the direction of 5 ' → 3 ' end from 3 ' end of primer, finally synthesize the DNA chain with template complementation.Each circulates through sex change, annealing and extension, and namely DNA content doubles.
Use round pcr to detect and be mainly concerned with two aspects: the extraction of nucleic acid and the augmentation detection of nucleic acid.
At present, the domestic nucleic acid of boiling method to chlamydia trachomatis and ureaplasma urealyticum that mainly adopts clinically extracts: first by secretory product sample concentration, washing, then add lysate, boil, high speed centrifugation, getting supernatant is template.Boiling method has many weak points: 1) nucleic acid extraction process is more complicated, sample process length consuming time, and when processing sample, through multiple steps such as boiling lysis, high speed centrifugation enrichment DNAs, there is loss in the DNA in sample, especially for the sample of high density, cracking is insufficient, enrichment is incomplete, a large amount of loss of DNA can be caused to cause sample quantitatively on the low side, simultaneously owing to have employed the elevated temperature heating stage of water-bath or metal bath, easily cause Aerosol Pollution.2) detection sensitivity is not high, about about 10000copies/ml; 3) positive internal reference (namely mark) is not set, cannot false negative be monitored; 4) measure generally not preventing PCR primer to pollute.In addition, for this step concentrated, the concentrated effect of different manufacturers is different, and what have can see precipitation, and what have cannot see, what see precipitation is because virus and albumen are all concentrated, and like this, is difficult to fully mixing when adding lysate after causing; Cannot precipitation be seen, when making operator cannot determine that supernatant is abandoned in suction, can or can not viral nucleic acid be blown and beaten.
At present, the method for domestic detection chlamydia trachomatis and ureaplasma pathogen DNA is clinically mainly based on Real-Time Fluorescent Quantitative PCR Technique and improvement thereof.Fluorescent quantitative PCR technique is sensitiveer, more special, the more accurate nucleic acid detection technique of the one grown up based on traditional PCR technique and in conjunction with spectroscopic techniques.Detected result is accurate, and repeatability is high, dynamic reaction patient treatment forward and backward pathogenic agent dynamic change and with clinical relation, and in whole process, avoid the problem that normal PCR needs aftertreatment, decrease pollution.Real-Time Fluorescent Quantitative PCR Technique uses a kind of PCR amplification instrument with fluorescence detection device, fluorescence detection device can send the exciting light of specific wavelength according to certain routines periodically, collect and detect fluorescent signal, the level of amplification of each circulation of PCR is reflected in real time by the dynamic change detecting fluorescent signal, amplification curve is obtained by software automatic analysis after off-test, according to amplification curve and the intersection point (i.e. Ct value) of fluorescence threshold line and the shape of amplification curve, yin and yang attribute result can be judged; If have qualitative reference product or the standard substance of concentration known in same reaction, then can obtain typical curve by software automatic analysis, realize the definite value (i.e. detection by quantitative) to unknown sample thus.Compare with traditional PCR, it adds the probe of a two ends difference mark fluorescent reporter group and quenching group in reaction system.When probe structure is complete, the fluorescent energy that fluorescent reporter group sends is quenched group absorptions, presents quenching effect; If there is the existence of target sequence in amplification procedure, along with the extension of target fragment, probe molecule is cut off by Taq enzyme hydrolysis gradually, fluorescent reporter group and quenching group dissociate mutually, blocked fluorescence energy transfer effect between the two, the fluorescent signal that fluorescent reporter group sends is collected by fluorescence detection device.Along with the carrying out of amplification, fluorescent signal presents linear enhancing along with the amplification of object fragment.After off-test, the software automatic analysis data that can be carried by fluorescent PCR instrument, the definite value result of yin and yang attribute result and concentration of specimens can be obtained, therefore, this technology is in the detection and quantitative analysis of target polynucleotide sample, replace traditional PCR method gradually, obtain applying very widely.
Multiple PCR technique develops on the basis of round pcr and comes, and detects or identify the Classification Identification of some pathogenic micro-organism, some inherited disease and oncogene while being mainly used in multiple pathogenic microorganisms.Detect while multiple pathogenic microorganisms or qualification, refer to the Auele Specific Primer simultaneously adding multiple pathogenic microorganisms in same PCR reaction tubes, carry out pcr amplification, can be used for the infection type detecting multiple pathogens simultaneously or identify concrete pathogenic agent.Multiple PCR technique there is following characteristics: 1. high efficiency: simultaneously detect multiple pathogenic microorganisms in same PCR reaction tubes, or to there being the goal gene of multiple type to carry out somatotype, particularly can detect multiple pathogens with bleeding.2. systematicness: multiplex PCR is suitable for the detection of pathogenic agent in groups very much, as detected while hepatitis virus, intestinal pathological bacteria, venereal disease, non-pressure three-product cyclone, war wound bacterial infection and bacterial warfare agent.3. economical and convenient: multiple pathogens detects in same reaction tubes simultaneously, saves time, reagent and other expenditures greatly, for clinically providing more, sooner, diagnostic message more accurately.Meanwhile, multiple PCR technique also can realize fluorescent quantitation in conjunction with spectroscopic techniques and detect, thus makes test result sensitiveer, more special, more accurate.
But, the specific primer design difficulty of the multiple pathogenic microorganisms added in multiple PCR technique is comparatively large, can not be combined with each other, can not be combined in the region beyond interest on template DNA fragment, in addition, the different amplified fragments in multiplex PCR also can competitive resource mutually.Based on above reason, the application of multiple PCR technique in clinical detection have received very big restriction.
At present, the domestic existing multiple test kit based on Real-Time Fluorescent Quantitative PCR Technique detection chlamydia trachomatis or ureaplasma urealyticum DNA is applied in clinical detection, but major part is for chlamydia trachomatis or the single detection method of ureaplasma urealyticum, is seldom applied in clinical detection by multiple PCR technique in prior art.For the requirement of clinical detection two kinds and multiple pathogens, multitube must be made to same sample and detect and just can reach, add testing cost and complex operation degree, reduce detection efficiency.Further, the extracting method that these test kits provide mainly boiling method, poor specificity, sensitivity is low, Detection results is not good enough.
Summary of the invention
The invention provides a kind of chlamydia trachomatis/ureaplasma urealyticum kit for detecting nucleic acid, test kit detection efficiency in prior art be low to solve, poor specificity and the low problem of sensitivity.
The invention provides a kind of chlamydia trachomatis/ureaplasma urealyticum kit for detecting nucleic acid, described chlamydia trachomatis/ureaplasma urealyticum kit for detecting nucleic acid comprises: chlamydia trachomatis/ureaplasma urealyticum PCR reaction solution, described PCR reaction solution comprise reaction buffer, deoxyribonucleoside triphosphate, for target polynucleotide amplification upstream and downstream primer and for target polynucleotide detect probe, wherein, the described probe sequence for target polynucleotide detection is: chlamydia trachomatis probe: 5 '-CTTAAAAGACAATGGATTACCTAT-3 '; Ureaplasma urealyticum probe: 5 '-TGGAAGGGGCAAGAGATGGTAAGT-3 '.
Preferably, the sequence of the described upstream and downstream primer for target polynucleotide amplification is: chlamydia trachomatis upstream primer: 5 '-CATATTCATAGTATTTAAAT-3'; Chlamydia trachomatis downstream primer: 5 '-CGGCGTCGTATCAAAGATATGGAC-3 '; Ureaplasma urealyticum upstream primer: 5 '-CTTTAATTACTGACCACGTAG-3 '; Ureaplasma urealyticum downstream primer: 5 '-CAAGTTATGGAAGGTGTAGAT-3 '.
Preferably, described chlamydia trachomatis/ureaplasma urealyticum kit for detecting nucleic acid also comprises interior mark, is designated as in described: GACTCTCTCTGCCTATTGGTCTATTTTCCCACCCTTAGGCTGCTGGTGGTCTACCC TTGGACCCAGAGGTTCTTTGAGTCCTTTGGGGATCTGTCCACTCCTGATGCTGTTA TGGG.
Preferably, described chlamydia trachomatis/ureaplasma urealyticum kit for detecting nucleic acid also comprises: for the upstream and downstream primer of interior mark fragment amplification with for detecting interior target probe, and in described detection, the sequence of target probe is: 5'-CAGATCCCCAAAGGACTCAAAGAACC-3'.
Preferably, the described upstream and downstream primer sequence for interior mark fragment amplification is: upstream primer: 5 '-GACTCTCTCTGCCTATTGGTCTATT-3 '; Downstream primer: 5 '-CCCATAACAGCATCAGGAGTG-3 '.
Preferably, also comprise enzyme mixation in described chlamydia trachomatis/ureaplasma urealyticum kit for detecting nucleic acid, described enzyme mixation comprises hot resistant DNA polymerase and uracil dna glycosylase, also comprises dUTP in described PCR reaction solution simultaneously.
Preferably, described chlamydia trachomatis/ureaplasma urealyticum kit for detecting nucleic acid also comprises positive control and negative control.
Preferably, described chlamydia trachomatis/ureaplasma urealyticum kit for detecting nucleic acid also comprises: DNA extraction solution I: containing sodium lauryl sulphate 0.2-1.0g/100ml, Triton 1.0-4.0ml/100ml, guanidinium isothiocyanate 0.2mol/L-1.0mol/L and magnetic bead 100-400tg/ml; DNA extraction solution II: containing 4-hydroxyethyl piperazine ethanesulfonic acid 0.1-0.3mol/L and sodium-chlor 0.1-0.3mol/L and the pH value of described DNA extraction solution II is 6.5 ± 0.2; DNA extraction solution III: containing Triton 0.1-1.0ml/100ml and sodium-chlor 0.1-0.3mmol/L; DNA extraction solution IV: mineral oil.
Preferably, described chlamydia trachomatis/ureaplasma urealyticum kit for detecting nucleic acid also comprises: sample releasing agent, described sample releasing agent is Sha graceful tensio-active agent 0.01-0.5mM/L, Repone K 50-200mM/L, sodium laurylsulfonate 0.01-2% and ethanol 0.05-1% of ancient India.
The technical scheme that embodiments of the invention provide can comprise following beneficial effect:
The invention provides a kind of chlamydia trachomatis/ureaplasma urealyticum kit for detecting nucleic acid, described chlamydia trachomatis/ureaplasma urealyticum kit for detecting nucleic acid comprises: chlamydia trachomatis/ureaplasma urealyticum PCR reaction solution, described PCR reaction solution comprise reaction buffer, deoxyribonucleoside triphosphate, for target polynucleotide amplification upstream and downstream primer and for target polynucleotide detect probe, wherein, the described probe sequence for target polynucleotide detection is: chlamydia trachomatis probe: 5 '-CTTAAAAGACAATGGATTACCTAT-3 '; Ureaplasma urealyticum probe: 5 '-TGGAAGGGGCAAGAGATGGTAAGT-3 '.The invention provides a kind of operation fast, method is easy, detection specificity is good, highly sensitive, chlamydia trachomatis/ureaplasma urealyticum kit for detecting nucleic acid that sensing range is wide, the probe specificity for target polynucleotide detection that this test kit provides is higher, apply this test kit, rapid detection can be carried out to the chlamydia trachomatis in the unknown sample such as genital secretion/ureaplasma urealyticum DNA simultaneously, for diagnosis chlamydia trachomatis and Ureaplasma Urealyticum Infection provide reliable experimental basis, test kit detection efficiency in prior art can be solved low, poor specificity and the low problem of sensitivity.
Should be understood that, it is only exemplary and explanatory that above general description and details hereinafter describe, and can not limit the present invention.
Accompanying drawing explanation
Fig. 1 is that the chlamydia trachomatis/ureaplasma urealyticum kit for detecting nucleic acid provided in the embodiment of the present invention is positives with reference to product A, B, C, D amplification curve for chlamydia trachomatis;
Fig. 2 is that the chlamydia trachomatis/ureaplasma urealyticum kit for detecting nucleic acid provided in the embodiment of the present invention is positives with reference to product A, B, C, D amplification curve for ureaplasma urealyticum;
Fig. 3 is the canonical plotting of chlamydia trachomatis quantitative analysis in the chlamydia trachomatis/ureaplasma urealyticum kit for detecting nucleic acid provided in the embodiment of the present invention;
Fig. 4 is the canonical plotting of ureaplasma urealyticum quantitative analysis in the chlamydia trachomatis/ureaplasma urealyticum kit for detecting nucleic acid provided in the embodiment of the present invention;
Fig. 5 is the amplification curve of the positive reference material chlamydia trachomatis provided in the embodiment of the present invention;
Fig. 6 is the amplification curve of the positive reference material ureaplasma urealyticum provided in the embodiment of the present invention;
Fig. 7 is the amplification curve of the negative reference product chlamydia trachomatis provided in the embodiment of the present invention;
Fig. 8 is the amplification curve of the negative reference product ureaplasma urealyticum provided in the embodiment of the present invention;
Fig. 9 is the amplification curve of chlamydia trachomatis in the 2 increment product provided in the embodiment of the present invention;
Figure 10 is the amplification curve of ureaplasma urealyticum in the 2 increment product provided in the embodiment of the present invention.
Embodiment
Here will be described exemplary embodiment in detail, its sample table shows in the accompanying drawings.When description below relates to accompanying drawing, unless otherwise indicated, the same numbers in different accompanying drawing represents same or analogous key element.Embodiment described in following exemplary embodiment does not represent all embodiments consistent with the present invention.On the contrary, they only with as in appended claims describe in detail, the example of device that aspects more of the present invention are consistent.
Each embodiment in this specification sheets all adopts the mode of going forward one by one to describe, between each embodiment identical similar part mutually see, what each embodiment stressed is the difference with other embodiment.
Embodiment one
The present embodiment provides a kind of chlamydia trachomatis/ureaplasma urealyticum kit for detecting nucleic acid, described chlamydia trachomatis/ureaplasma urealyticum kit for detecting nucleic acid comprises chlamydia trachomatis/ureaplasma urealyticum PCR reaction solution, and described chlamydia trachomatis/ureaplasma urealyticum PCR reaction solution comprises following component further:
The probe detected for target polynucleotide of (1) 0.2 μm of ol/L-0.4 μm of ol/L, the described probe sequence for target polynucleotide detection is: chlamydia trachomatis probe: 5 '-CTTAAAAGACAATGGATTACCTAT-3 '; Ureaplasma urealyticum probe: 5 '-TGGAAGGGGCAAGAGATGGTAAGT-3 '.
(2) 0.2mmol/L deoxyribonucleoside triphosphate.
The upstream and downstream primer for target polynucleotide amplification of (3) 0.2 μm of ol/L-0.4 μm of ol/L, the described upstream and downstream primer for target polynucleotide amplification and be primer and the probe of the conservative region coming from chlamydia trachomatis and ureaplasma pathogen nucleic acid for the probe that target polynucleotide detects, the sequence of the described upstream and downstream primer for target polynucleotide amplification is: chlamydia trachomatis upstream primer: 5 '-CATATTCATAGTATTTAAAT-3 '; Chlamydia trachomatis downstream primer: 5 '-CGGCGTCGTATCAAAGATATGGAC-3 '; Ureaplasma urealyticum upstream primer: 5 '-CTTTAATTACTGACCACGTAG-3 '; Ureaplasma urealyticum downstream primer: 5 '-CAAGTTATGGAAGGTGTAGAT-3 '.
(4) 10 × PCR reaction buffer 5 μ l.
Preferably, described 10 × PCR reaction buffer comprises the 200mmol/L Tri(Hydroxymethyl) Amino Methane Hydrochloride solution of pH7.5,30mmol/L magnesium chloride solution, 500mmol/L Klorvess Liquid, 0.2% (volume/volume) Triton solution and 10% (volume/volume) formamide soln.
The probe that this chlamydia trachomatis/ureaplasma urealyticum kit for detecting nucleic acid adopts the above-mentioned upstream and downstream primer for target polynucleotide amplification and detects for target polynucleotide, specificity is higher, apply this test kit, rapid detection can be carried out to the chlamydia trachomatis in the unknown sample such as genital secretion/ureaplasma urealyticum DNA simultaneously, for diagnosis chlamydia trachomatis and Ureaplasma Urealyticum Infection provide reliable experimental basis, can solve that test kit detection efficiency in prior art is low, poor specificity and the low problem of sensitivity.
Preferably, described chlamydia trachomatis/ureaplasma urealyticum kit for detecting nucleic acid comprises interior mark further, and described interior target sequence is: GACTCTCTCTGCCTATTGGTCTATTTTCCCACCCTTAGGCTGCTGGTGGTCTACCC TTGGACCCAGAGGTTCTTTGAGTCCTTTGGGGATCTGTCCACTCCTGATGCTGTTA TGGG.
Preferably, described chlamydia trachomatis/ureaplasma urealyticum kit for detecting nucleic acid comprises further for the upstream and downstream primer of interior mark fragment amplification with for detecting interior target probe, and the described upstream and downstream primer sequence for interior mark fragment amplification is: upstream primer: 5 '-GACTCTCTCTGCCTATTGGTCTATT-3 '; Downstream primer: 5 '-CCCATAACAGCATCAGGAGTG-3 '; In described detection, the sequence of target probe is: 5'-CAGATCCCCAAAGGACTCAAAGAACC-3'.
Preferably, described chlamydia trachomatis/ureaplasma urealyticum kit for detecting nucleic acid comprises enzyme mixation further, and described enzyme mixation comprises hot resistant DNA polymerase and uracil dna glycosylase, also comprises dUTP in described PCR reaction solution simultaneously.Utilize UNG enzyme can degrade containing the feature of the DNA chain of dU, in PCR system, with the addition of UNG enzyme and dUTP, the pollution of previous PCR product can be prevented, prevent pattern detection false positive.
Preferably, described chlamydia trachomatis/ureaplasma urealyticum kit for detecting nucleic acid comprises positive control and negative control further.Wherein, positive control derives from the cloned plasmids containing chlamydia trachomatis, ureaplasma urealyticum and betaglobulin goal gene fragment, and its concentration is 1.00-5.00E+05copies/ml; Negative control is sterile saline.
Preferably, it is positive in product that described chlamydia trachomatis/ureaplasma urealyticum kit for detecting nucleic acid comprises chlamydia trachomatis/ureaplasma urealyticum further, described positive reference product derive from containing chlamydia trachomatis, the cloned plasmids of ureaplasma urealyticum and betaglobulin goal gene fragment, same concentrations is mixed in proportion into after definite value, diluting successively with TE damping fluid is A again, B, C, D tetra-concentration, its concentration is respectively 1.00-5.00E+07copies/ml (A), 1.00-5.00E+06copies/ml (B), 1.00-5.00E+05copies/ml (C), 1.00-5.00E+04copies/ml (D).
Preferably, described chlamydia trachomatis/ureaplasma urealyticum kit for detecting nucleic acid comprises DNA extraction solution I further: containing sodium lauryl sulphate 0.2-1.0g/100ml, Triton 1.0-4.0ml/100ml, guanidinium isothiocyanate 0.2mol/L-1.0mol/L and magnetic bead 100-400tg/ml; DNA extraction solution II: containing 4-hydroxyethyl piperazine ethanesulfonic acid 0.1-0.3mol/L and sodium-chlor 0.1-0.3mol/L and the pH value of described DNA extraction solution II is 6.5 ± 0.2; DNA extraction solution III: containing Triton 0.1-1.0ml/100ml and sodium-chlor 0.1-0.3mmol/L; DNA extraction solution IV: mineral oil.
Preferably, described chlamydia trachomatis/ureaplasma urealyticum kit for detecting nucleic acid comprises sample releasing agent further, described sample releasing agent is Sha graceful tensio-active agent 0.01-0.5mM/L, Repone K 50-200mM/L, sodium laurylsulfonate 0.01-2% and ethanol 0.05-1% of ancient India.
Embodiment two
The present embodiment provides chlamydia trachomatis described in above-described embodiment 1/ureaplasma urealyticum kit for detecting nucleic acid for detecting the operation steps of the chlamydia trachomatis/ureaplasma urealyticum DNA in the unknown sample such as genital secretion:
One, reagent prepares
According to sample to be tested, negative control, positive control and the positive quantity with reference to product A-D, (reaction solution 40 μ l/ person-portion+enzyme mixation 2 μ l/ person-portion) gets PCR reaction solution, the enzyme mixation of respective amount in proportion, fully be mixed into PCR-mix, for subsequent use after brief centrifugation.
Two, sample process
1, method A: paramagnetic particle method extracts nucleic acid
(1) lytic virus: often pipe adds 200 μ l-1mlDNA and extracts solution I, then adds 100 μ l-1ml samples to be tested, lid upper tube cap, concussion mixing 10 second, brief centrifugation;
(2) magnetic bead adsorbs nucleic acid: often pipe adds 50 μ l-400 μ lDNA and extracts solution II, after concussion mixing 10 second, room temperature leaves standstill 5-10 minute;
(3) impurity is removed: after brief centrifugation, be placed in by centrifuge tube on Beads enrichment device, slowly by solution sucking-off after 2-5 minute;
(4) wash: often pipe adds 400 μ l-1mlDNA extraction solution III and 100 μ l-500 μ lDNA extraction solution IV, and concussion mixes 3-7 second, is again placed on separator by centrifuge tube after brief centrifugation;
(5) after 2-5 minute, supernatant liquor is divided into two-layer, is inserted by suction nozzle bottom centrifuge tube, slowly complete for liquid sucking-off is abandoned from bottom, leaves standstill after 1-3 minute, complete for residual liquid at the bottom of pipe sucking-off is abandoned.
(6) often pipe adds 50-100 μ lDNA elutriant, draws with suction nozzle the brown residue that DNA elution is adsorbed in centrifugal tube wall, repeatedly several times as far as possible by its complete wash-out;
(7) leave standstill after 5-10 minute, centrifuge tube is placed on separator again, after 2-5 minute, elutriant sucking-off is placed in new centrifuge tube for subsequent use;
(8) each reaction tubes adds above-mentioned pretreated sample to be tested, negative control, positive control 5-10 μ l;
(9) often pipe adds PCR-mix40-45 μ l, lid upper tube cap (after removing bubble), centrifugal 30 seconds of 2000rpm.
2, method B: sample releasing agent extracts nucleic acid
(1) get 200-500 μ l sample to be tested, 13000rpm inhales after centrifugal 5 minutes and abandons supernatant, adds 20-50 μ l sample releasing agent and leaves standstill after 10 minutes, for subsequent use;
(2) each reaction tubes adds above-mentioned pretreated sample to be tested, negative control, positive control 5-10 μ l;
(3) often pipe adds PCR-mix40-45 μ l, lid upper tube cap (after removing bubble), centrifugal 30 seconds of 2000rpm.
Three, Fluorescence PCR
(1) PCR reaction tubes is put into amplification instrument sample cell, sample to be tested title and positive reference product concentration are set by correspondence order.
(2) fluorescence detection channel is selected: 1) select FAM passage (Reporter:FAM, Quencher:none) to detect ureaplasma urealyticum DNA; 2) HEX or VIC passage (Reporter:HEX/VIC, Quencher:none) is selected to detect Chlamydia Trachomatis DNA; 3) ROX passage (Reporter:ROX, Quencher:none) is selected to detect interior mark; 4) reference fluorescent (PassiveReference) is set to none.
(3) quantitative fluorescent PCR reaction conditions is in table 1:
Table 1: quantitative fluorescent PCR reaction conditions
Four, interpretation of result
After reaction terminates, the automatic saving result of instrument, the software that instrument can be utilized to carry carries out automatic analysis (also can the starting value of manual regulation baseline, end value and threshold line value analyze), then records sample Ct value and definite value result.The intersection point of amplification curve and threshold line, is called Ct (i.e. cyclethreshold, the cycling numerical value experienced when the fluorescent signal referring in PCR reaction tubes reaches the threshold value of setting); Instrument software is according to each sample Ct value size, by positive reference product A, B, C, D amplification curve of tetra-concentration gradients for chlamydia trachomatis such as shown in Fig. 1 and 2 difference and the amplification curve for ureaplasma urealyticum, draw the canonical plotting of chlamydia trachomatis quantitative analysis as shown in Fig. 3 and Fig. 4 difference and the canonical plotting of ureaplasma urealyticum quantitative analysis, and automatically try to achieve the definite value result of each sample according to canonical plotting.If sample amplification curve is S-type, there is Ct value and Ct≤38, chlamydia trachomatis/ureaplasma urealyticum can be judged to positive; If sample amplification curve is straight, without Ct value display (Undet) display, chlamydia trachomatis/ureaplasma urealyticum can be judged to negative.
The present embodiment also comprises chlamydia trachomatis/ureaplasma urealyticum kit for detecting nucleic acid accuracy experiment, the chlamydia trachomatis utilizing the present embodiment to provide/ureaplasma urealyticum kit for detecting nucleic acid detects the positive reference material of 8 parts of enterprises, result is the positive and differentiates accurately, no cross reaction, specific experiment data are as shown in table 2:
Table 2: accuracy experimental data
Fig. 5 and Fig. 6 is depicted as the amplification curve of the positive reference material chlamydia trachomatis of 8 parts of enterprises and ureaplasma urealyticum respectively, as seen from the figure, the amplification curve of 8 parts of reference materials is all S-type, there is Ct value and Ct≤38,8 parts of reference materials are the positive, and cross reacting rate=0 appears in 8 parts of positive reference materials, show that the accuracy that this chlamydia trachomatis/ureaplasma urealyticum kit for detecting nucleic acid detects is higher.
The present embodiment also comprises chlamydia trachomatis/ureaplasma urealyticum kit for detecting nucleic acid specificity experiments, the chlamydia trachomatis utilizing the present embodiment to provide/ureaplasma urealyticum kit for detecting nucleic acid detects 8 parts of enterprise's negative reference product, result is feminine gender, show this chlamydia trachomatis/ureaplasma urealyticum kit for detecting nucleic acid high specificity, specific experiment data are as shown in table 3:
Table 3: specificity experiments data
Fig. 7 and Fig. 8 is depicted as the amplification curve of 8 parts of enterprise negative reference product chlamydia trachomatises and ureaplasma urealyticum respectively, from Fig. 7 and Fig. 8, the amplification curve of chlamydia trachomatis and ureaplasma urealyticum is straight straight line, without Ct value display display, 8 parts of enterprise's negative reference product can be judged to and be feminine gender, show this chlamydia trachomatis/ureaplasma urealyticum kit for detecting nucleic acid high specificity.
The present embodiment also comprises chlamydia trachomatis/ureaplasma urealyticum kit for detecting nucleic acid Precision Experiment, the chlamydia trachomatis utilizing the present embodiment to provide/ureaplasma urealyticum kit for detecting nucleic acid does 10 groups of replica tests to 2 increment product (R1 and R2), result shows the variation coefficient (CV of this chlamydia trachomatis/ureaplasma urealyticum kit for detecting nucleic acid precision Ct value, %)≤5%, precision is higher, and specific experiment data are as shown in table 4:
Table 4: Precision Experiment data
| Numbering | CT-Ct value | UU-Ct value | Numbering | CT-Ct value | UU-Ct value |
| R1 | 28.3 | 28.23 | R2 | 34.96 | 35.44 |
| R1 | 28.21 | 28.22 | R2 | 34.33 | 35.41 |
| R1 | 28.28 | 28.25 | R2 | 34.5 | 35.77 |
| R1 | 28.29 | 28.33 | R2 | 34.57 | 34.16 |
| R1 | 28.25 | 28.24 | R2 | 33.92 | 35 |
| R1 | 28.3 | 28.21 | R2 | 34.91 | 34.65 |
| R1 | 28.35 | 28.22 | R2 | 34.32 | 35.76 |
| R1 | 28.31 | 28.2 | R2 | 35.01 | 34.45 |
| R1 | 28.2 | 28.25 | R2 | 34.75 | 35.5 |
| R1 | 28.19 | 28.14 | R2 | 34.43 | 35.59 |
| CV，％ | 0.19％ | 0.17％ | CV，％ | 0.99％ | 1.63％ |
Fig. 9 and Figure 10 is depicted as the amplification curve of chlamydia trachomatis and ureaplasma urealyticum in 2 increment product respectively, from Fig. 9 and Figure 10, this chlamydia trachomatis/ureaplasma urealyticum kit for detecting nucleic acid to the detection repeatability of 2 increment product better, the variation coefficient (the CV of precision Ct value, %)≤5%, shows that this chlamydia trachomatis/ureaplasma urealyticum kit for detecting nucleic acid precision is higher.
Above-described embodiment of the present invention, does not form limiting the scope of the present invention.Any amendment done within the spirit and principles in the present invention, equivalent replacement and improvement etc., all should be included within protection scope of the present invention.
The above is only the specific embodiment of the present invention, those skilled in the art is understood or realizes the present invention.To be apparent to one skilled in the art to the multiple amendment of these embodiments, General Principle as defined herein can without departing from the spirit or scope of the present invention, realize in other embodiments.Therefore, the present invention can not be restricted to these embodiments shown in this article, but will meet the widest scope consistent with principle disclosed herein and features of novelty.
Claims (9)
1. chlamydia trachomatis/ureaplasma urealyticum kit for detecting nucleic acid, it is characterized in that, described chlamydia trachomatis/ureaplasma urealyticum kit for detecting nucleic acid comprises: chlamydia trachomatis/ureaplasma urealyticum PCR reaction solution, described PCR reaction solution comprise reaction buffer, deoxyribonucleoside triphosphate, for target polynucleotide amplification upstream and downstream primer and for target polynucleotide detect probe, wherein, the described probe sequence for target polynucleotide detection is:
Chlamydia trachomatis probe: 5 '-CTTAAAAGACAATGGATTACCTAT-3 ';
Ureaplasma urealyticum probe: 5 '-TGGAAGGGGCAAGAGATGGTAAGT-3 '.
2. chlamydia trachomatis according to claim 1/ureaplasma urealyticum kit for detecting nucleic acid, is characterized in that, the sequence of the described upstream and downstream primer for target polynucleotide amplification is:
Chlamydia trachomatis upstream primer: 5 '-CATATTCATAGTATTTAAAT-3 ';
Chlamydia trachomatis downstream primer: 5 '-CGGCGTCGTATCAAAGATATGGAC-3 ';
Ureaplasma urealyticum upstream primer: 5 '-CTTTAATTACTGACCACGTAG-3 ';
Ureaplasma urealyticum downstream primer: 5 '-CAAGTTATGGAAGGTGTAGAT-3 '.
3. chlamydia trachomatis according to claim 1/ureaplasma urealyticum kit for detecting nucleic acid, is characterized in that, described chlamydia trachomatis/ureaplasma urealyticum kit for detecting nucleic acid also comprises interior mark, and described interior target sequence is:
GACTCTCTCTGCCTATTGGTCTATTTTCCCACCCTTAGGCTGCTGGTGGTCTACCCTTGGACCCAGAGGTTCTTTGAGTCCTTTGGGGATCTGTCCACTCCTGATGCTGTTATGGG。
4. chlamydia trachomatis according to claim 3/ureaplasma urealyticum kit for detecting nucleic acid, it is characterized in that, described chlamydia trachomatis/ureaplasma urealyticum kit for detecting nucleic acid also comprises: for the upstream and downstream primer of interior mark fragment amplification with for detecting interior target probe, and in described detection, the sequence of target probe is: 5'-CAGATCCCCAAAGGACTCAAAGAACC-3'.
5. chlamydia trachomatis according to claim 4/ureaplasma urealyticum kit for detecting nucleic acid, is characterized in that, the described upstream and downstream primer sequence for interior mark fragment amplification is:
Upstream primer: 5 '-GACTCTCTCTGCCTATTGGTCTATT-3 ';
Downstream primer: 5 '-CCCATAACAGCATCAGGAGTG-3 '.
6. chlamydia trachomatis according to claim 5/ureaplasma urealyticum kit for detecting nucleic acid, it is characterized in that, also enzyme mixation is comprised in described chlamydia trachomatis/ureaplasma urealyticum kit for detecting nucleic acid, described enzyme mixation comprises hot resistant DNA polymerase and uracil dna glycosylase, also comprises dUTP in described PCR reaction solution simultaneously.
7. the chlamydia trachomatis according to any one of claim 1-6/ureaplasma urealyticum kit for detecting nucleic acid, is characterized in that, described chlamydia trachomatis/ureaplasma urealyticum kit for detecting nucleic acid also comprises positive control and negative control.
8. chlamydia trachomatis according to claim 7/ureaplasma urealyticum kit for detecting nucleic acid, is characterized in that, described chlamydia trachomatis/ureaplasma urealyticum kit for detecting nucleic acid also comprises:
DNA extraction solution I: containing sodium lauryl sulphate 0.2-1.0g/100ml, Triton 1.0-4.0ml/100ml, guanidinium isothiocyanate 0.2mol/L-1.0mol/L and magnetic bead 100-400tg/ml;
DNA extraction solution II: containing 4-hydroxyethyl piperazine ethanesulfonic acid 0.1-0.3mol/L and sodium-chlor 0.1-0.3mol/L and the pH value of described DNA extraction solution II is 6.5 ± 0.2;
DNA extraction solution III: containing Triton 0.1-1.0ml/100ml and sodium-chlor 0.1-0.3mmol/L;
DNA extraction solution IV: mineral oil.
9. chlamydia trachomatis according to claim 7/ureaplasma urealyticum kit for detecting nucleic acid, it is characterized in that, described chlamydia trachomatis/ureaplasma urealyticum kit for detecting nucleic acid also comprises: sample releasing agent, described sample releasing agent is Sha graceful tensio-active agent 0.01-0.5mM/L of ancient India, Repone K 50-200mM/L, sodium laurylsulfonate 0.01-2% and ethanol 0.05-1%.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510848917.1A CN105349660A (en) | 2015-11-27 | 2015-11-27 | Chlamydia trachomatis and ureaplasma urealyticum nucleic acid detection kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510848917.1A CN105349660A (en) | 2015-11-27 | 2015-11-27 | Chlamydia trachomatis and ureaplasma urealyticum nucleic acid detection kit |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105349660A true CN105349660A (en) | 2016-02-24 |
Family
ID=55325720
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510848917.1A Pending CN105349660A (en) | 2015-11-27 | 2015-11-27 | Chlamydia trachomatis and ureaplasma urealyticum nucleic acid detection kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105349660A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106381328A (en) * | 2016-08-29 | 2017-02-08 | 英科新创（苏州）生物科技有限公司 | Single-tube CT/NG/UU nucleic acid fluorescence detection kit |
| CN114164288A (en) * | 2021-12-24 | 2022-03-11 | 苏州中科先进技术研究院有限公司 | Primer probe composition, kit and method for detecting ureaplasma urealyticum |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101613763A (en) * | 2009-07-30 | 2009-12-30 | 港龙生物科技有限公司 | The fluorescence PCR method of diagnosis chlamydia trachomatis, gonococcus and ureaplasma urealyticum infection |
| CN103060452A (en) * | 2013-01-10 | 2013-04-24 | 湖南圣湘生物科技有限公司 | Kit for detecting chlamydia trachomatis (CT) |
| CN103060453A (en) * | 2013-01-10 | 2013-04-24 | 湖南圣湘生物科技有限公司 | Kit for detecting neisseria gonorrheae (NG) |
| CN103074429A (en) * | 2013-01-10 | 2013-05-01 | 湖南圣湘生物科技有限公司 | UU (ureaplasma urealyticum) detection kit |
-
2015
- 2015-11-27 CN CN201510848917.1A patent/CN105349660A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101613763A (en) * | 2009-07-30 | 2009-12-30 | 港龙生物科技有限公司 | The fluorescence PCR method of diagnosis chlamydia trachomatis, gonococcus and ureaplasma urealyticum infection |
| CN103060452A (en) * | 2013-01-10 | 2013-04-24 | 湖南圣湘生物科技有限公司 | Kit for detecting chlamydia trachomatis (CT) |
| CN103060453A (en) * | 2013-01-10 | 2013-04-24 | 湖南圣湘生物科技有限公司 | Kit for detecting neisseria gonorrheae (NG) |
| CN103074429A (en) * | 2013-01-10 | 2013-05-01 | 湖南圣湘生物科技有限公司 | UU (ureaplasma urealyticum) detection kit |
Non-Patent Citations (1)
| Title |
|---|
| 刘云国等: "《DNA小分子检测技术及其应用》", 31 March 2011, 科学出版社 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106381328A (en) * | 2016-08-29 | 2017-02-08 | 英科新创（苏州）生物科技有限公司 | Single-tube CT/NG/UU nucleic acid fluorescence detection kit |
| CN114164288A (en) * | 2021-12-24 | 2022-03-11 | 苏州中科先进技术研究院有限公司 | Primer probe composition, kit and method for detecting ureaplasma urealyticum |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103060451B (en) | A kind of mycoplasma pneumoniae MP detection kit | |
| CN107937580A (en) | The application method of the primer and probe of urogenital tract microorganism detection, kit and kit | |
| CN108588277A (en) | A kind of canine distemper virus visualization nucleic acid detection method | |
| CN108950067A (en) | Detect LAMP primer group, kit and its method of prawn irido virus | |
| CN105349661A (en) | Chlamydia trachomatis and gonococcus nucleic acid detection kit | |
| CN105624329A (en) | Real-time fluorescence nucleic acid isothermal amplification detection kit for human herpesvirus 1 | |
| CN103060452B (en) | Kit for detecting chlamydia trachomatis (CT) | |
| CN103074428B (en) | A kind of mycobacterium tuberculosis TB detection kits | |
| CN116121413A (en) | Real-time fluorescent nucleic acid isothermal amplification detection kit for group B streptococcus and special primer and probe thereof | |
| CN103725800B (en) | Human adenovirus detection kit | |
| CN103074429B (en) | UU (ureaplasma urealyticum) detection kit | |
| CN105349660A (en) | Chlamydia trachomatis and ureaplasma urealyticum nucleic acid detection kit | |
| CN103773884B (en) | For detecting the primer sets of Chlamydia pneumoniae 98KDa MOMP gene and probe and application thereof | |
| CN103060453A (en) | Kit for detecting neisseria gonorrheae (NG) | |
| CN109457052A (en) | Detect primer, probe, kit and the detection method of human immunodeficiency virus nucleic acid | |
| AU2021103861A4 (en) | Method and kit for differentially detecting porcine pseudorabies vaccine virus and wild virus | |
| CN114525349A (en) | Method for identifying semen by using digital PCR and special kit thereof | |
| CN1952174A (en) | LUX fluorescent primer special for detecting bovine herpes virus type I and process for nucleic acid amplification | |
| CN102140548B (en) | Real-time fluorescence quantitative PCR (polymerase chain reaction) kit for herpes simplex virus | |
| CN103122394B (en) | Herpes simplex virus 2 (HSV-2) detection kit | |
| CN104561317A (en) | Fluorescent PCR detection kit for detecting treponema pallidum | |
| CN108950027A (en) | It is a kind of for detecting the kit and method of klebsiella pneumoniae | |
| CN108546744A (en) | Based on RNA target mark SAT infection due to Neisseria gonorrhoeae molecular biology for detection | |
| CN109234418A (en) | A kind of primer, kit and method identifying mycoplasma hyopneumoniae street strain and vaccine strain | |
| TWI681056B (en) | Primer pair for detecting ureaplasma parvum serovar 3 and kit thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20160224 |