CN103060453A

CN103060453A - Kit for detecting neisseria gonorrheae (NG)

Info

Publication number: CN103060453A
Application number: CN2013100090766A
Authority: CN
Inventors: 戴立忠; 邓中平; 李勃
Original assignee: Sansure Biotech Inc
Current assignee: Sansure Biotech Inc
Priority date: 2013-01-10
Filing date: 2013-01-10
Publication date: 2013-04-24

Abstract

The invention provides a kit for detecting neisseria gonorrheae (NG). The kit comprises a nucleic acid releaser and a PCR (Polymerase Chain Reaction) solution, wherein the nucleic acid releaser comprises 0.01-0.5mM/L of surfactin, 20-300mM/L of potassium chloride, 0.01-2% of sodium dodecyl sulfate and 0.05-1% of ethanol; and the PCR solution comprises a forward primer and a reverse primer which are used for amplifying targeted polynucleotide, and a probe for detecting the targeted polynucleotide. A method of releasing nucleic acid by using the nucleic acid releaser in the kit provided by the invention is not obviously different from a boiling method in the detection result, and a violent protein denaturant adopted for the nucleic acid extraction in the method provided by the invention quickly breaks a coat protein structure of a pathogen to release pathogen nucleic acid, so the release and extraction of DNA (Deoxyribonucleic Acid) can be realized without heating; besides, the sensitivity of the provided kit for detecting the NG can be 400 copies/ml, the linearity region of the detection is 400-4.00E+10 copies/ml; and moreover, NG-DNA in an unknown sample such as genital secretions can be quickly and precisely detected by using the kit, so a reliable experiment basis is provided for diagnosing NG infection.

Description

Gonococcus NG detection kit

Technical field

The invention provides a kind of gonococcus (NG) detection kit, specifically a kind of NG-DNA detection kit based on fluorescent PCR.

Background technology

Neisseria gonorrhoeae (Neisseria gonorrheae, NG) was commonly called as gonorrhea diplococcus or gonococcus by the Neisser discovery in 1879, was the infective pathogen body that causes human gonorrhoea, belonged to neisseria.Gonococcus (NG) has strict human parasitics, and human body is had stronger adaptation and invasive ability, and its main morbid substance comprises pili, outer membrane protein, proteolytic enzyme, lipopolysaccharides etc., is one of higher sexually transmitted disease (STD) of developing country's sickness rate.The main trafficability characteristic of NG contact direct infection, the indirect infections such as clothing that also can be by the contact patient or toilet, the fetus in the time of can also infecting childbirth by birth canal.

Gonorrhoea is one of more venereal disease of number of the infected in the world, estimates the number of patients nearly 100,000,000 in the annual world; In the U.S., at a conservative estimate, 1,000,000 routine patients occur at least every year.China is at gonorrhoea Eradication soon after liberation, but gonorrhoea was revivable from 1977, and rapid spread is in all parts of the country, the reported cases number is soaring rapidly in short several years, peak to middle nineteen nineties, after this its morbidity level begins slow falling, but still maintains higher level.In recent years, the morbidity level of gonorrhoea is again ascendant trend, ranks among the best in sexually transmitted disease (STD).

Infecting the disease cause by NG is a kind of important diseases in the sexually transmitted disease (STD), because how NG the infected's atypical symptoms to detect fast and accurately, diagnosis, treatment and the control etc. of disease is had very important meaning.

Present gonococcal laboratory diagnostic method mainly contains the detection method of isolated culture, smear for microscopic examination method, immunological method, PCR-based technology etc.Isolated culture simple to operate, specificity is higher, is considered to diagnose gonococcal " gold standard ", but cultivates consuming time longly, and susceptibility is lower simultaneously, and due to illness the amount of pathogenic microorganism is very few, or pathogenic micro-organism does not survive and delay treatment after the inoculation.The smear for microscopic examination method is simple and easy to do, and is cheap, but the impact of the various factorss such as its specificity is drawn materials, smear, dyeing, and gonorrhea diplococcus is very easily obscured with other gram-negative diplococci under the mirror, mistaken diagnosis easily occurs and fails to pinpoint a disease in diagnosis.Immunological method mainly comprises enzyme connection adsorption test and immune colloidal gold technique, and simple to operate and susceptibility is better than culture method.In recent years, poly-ribozyme chain reaction (PCR) method has manifested its advantage on detecting gradually, Fluorescence PCR assay be based on the normal PCR technology and grow up in conjunction with spectroscopic techniques a kind of sensitiveer, more special, more accurate nucleic acid detection technique.Detected result is accurate, and repeatability is high, can dynamically react the forward and backward pathogenic agent dynamic change of patient treatment and reach and clinical relation, and avoid normal PCR to need the problem of aftertreatment in the whole process, has reduced pollution.

The appearance of quantitative PCR, break qualitatively situation of PCR, wherein quantitative fluorescent PCR clinical more accurate, the objective detected result that provides is provided, and understands in time the state of an illness and prognosis with characteristics such as its highly sensitive, high specific, low pollution rate, Real-Time Monitorings.

Use round pcr to detect and be mainly concerned with two aspects, the extraction of nucleic acid and the augmentation detection of nucleic acid.

The domestic boiling method that mainly adopts clinically extracts gonococcal nucleic acid at present, specifically first with secretory product sample concentration, washing, adds lysate again, boil, and high speed centrifugation, getting supernatant is template; The method nucleic acid extraction process is complicated, sample process length consuming time, and when processing sample, through a plurality of steps such as boiling lysises, high speed centrifugation enrichment DNA, there is loss in the DNA in the sample, especially for the sample of high density, cracking is insufficient, enrichment is incomplete, can cause losing in a large number of DNA to cause sample quantitatively on the low side, owing to having adopted the heat step of water-bath or metal bath, easily cause aerosol dirty simultaneously; In addition, for concentrated this step, the concentrated effect of different manufacturers is different, and what have can see precipitation, and what have can't see, can see that precipitation is because this step has all concentrated nucleic acid and albumen, is difficult to abundant mixing in the time of can causing like this back to add lysate; The operator that then makes that can't see precipitation can't determine can or can not blow and beat nucleic acid when supernatant is abandoned in suction.

The method that detects clinically NG-DNA mainly is based on technology and the improvement thereof of real-time fluorescence quantitative PCR at present, Real-Time Fluorescent Quantitative PCR Technique is rapidly a kind of nucleic acid detection technique of development in recent years, use a kind of pcr amplification instrument with fluorescence detection device, fluorescence detection device can according to certain property program loop send the exciting light of specific wavelength, collect and detect fluorescent signal, the level of amplification that reflects in real time each circulation of PCR by the dynamic change that detects fluorescent signal, can obtain amplification curve by the software automatic analysis after the off-test, according to the intersection point (being the Ct value) of amplification curve and fluorescence threshold line and the shape of amplification curve, can judge the yin and yang attribute result; If quantitative reference material or the standard substance of concentration known are arranged in the same reaction, then can obtain typical curve by the software automatic analysis, realize thus the definite value (being detection by quantitative) to unknown sample.Compare with traditional PCR, it has increased the respectively probe of mark fluorescent reporter group and quenching group of two ends in reaction system.When probe structure was complete, the fluorescent energy that the fluorescence report group sends was absorbed by quenching group, presents quenching effect; If the existence of target sequence is arranged in the amplification procedure, extension along with target fragment, probe molecule is cut off by the Taq enzymic hydrolysis gradually, fluorescence report group and quenching group dissociate mutually, blocked the two fluorescence energy transfer effect, the fluorescent signal that the fluorescence report group sends is collected by fluorescence detection device.Along with the carrying out of amplification, fluorescent signal presents linear the enhancing along with the amplification of purpose fragment.After the off-test, the software automatic analysis data that can carry by the fluorescent PCR instrument, can obtain the definite value result of yin and yang attribute result and concentration of specimens, therefore, this technology is in the detection and quantitative analysis of target polynucleotide sample, replace gradually traditional PCR method, obtain using very widely.

Existing test kit based on Real-Time Fluorescent Quantitative PCR Technique detection NG-DNA is applied in the clinical detection both at home and abroad at present, but these test kits extract nucleic acid with boiling method mostly, and its detection sensitivity is not high, about about 500 ~ 1000copies/ml; In addition, these test kits lack perfect system of quality control mostly, also need further to improve and improve technical level, and make this series products more satisfy the needs of clinical Accurate Diagnosis.

Summary of the invention

The invention provides the application of a kind of nucleic acid releasing agent in gonococcus NG detects, described nucleic acid releasing agent comprises Buddhist Sha graceful (surfactin) 0.01 ~ 0.5mM/L, Repone K 20 ~ 300mM/L, sodium laurylsulfonate 0.01 ~ 2% and ethanol 0.05 ~ 1%.

In nucleic acid releasing agent of the present invention, its solvent can be commonly used for this area, for example is sterilized water or TE damping fluid.The present invention is disclosed in first in the gonococcus NG detection and uses the nucleic acid releasing agent that contains strong protein denaturant, simplified to a great extent the step of this detection of nucleic acids, and detection sensitivity is greatly improved.

The invention provides a kind of gonococcus NG detection kit, comprise nucleic acid releasing agent and PCR reaction solution in the described test kit, described nucleic acid releasing agent comprises Buddhist Sha graceful (surfactin) 0.01 ~ 0.5mM/L, Repone K 20 ~ 300mM/L, sodium laurylsulfonate 0.01 ~ 2% and ethanol 0.05 ~ 1%; Comprise upstream primer, the downstream primer for the target polynucleotide amplification in the described PCR reaction solution and be used for the probe that target polynucleotide detects.

Use the method for the nucleic acid releasing agent release nucleic acid in the test kit of the present invention and the detected result of boiling method extraction nucleic acid not to have notable difference, and adopt strong protein denaturant when extracting nucleic acid among the present invention, rapid damage pathogenic agent coat protein structure, discharge pathogen nucleic acid, need not to heat release and the extraction that to finish DNA; The sensitivity that test kit of the present invention detects gonococcus NG can reach 400copies/ml, and the detection linearity range is 400 ~ 4.00E+10copies/ml.

Particularly, the probe sequence for target polynucleotide is 5 '-CCTAGCAAGCTCCACAGATAGGGCTTG-3 '; Being preferred for the upstream primer of target polynucleotide and the sequence of downstream primer is respectively: 5 '-CTATCAACCCTGCCGCCG-3 ' and 5 '-CCCGGCAGTTACGCATGAG-3 '.Test kit of the present invention has good specificity because adopting above-mentioned primer and/or the probe sequence for detection of target polynucleotide.

Among the present invention, also comprise interior mark in the preferred described test kit, described interior target sequence is 5 '-GTGTCTGCGGCGTTTTATCATCTTCCTCTGTCATCCAGTGCAAGTCTTGATCCTGT CGTTGGTTCTTCTGGACTATCAAGGTATGTTGCCCGTTTGT-3 '.Being designated as a segment length who inserts the pUC18T carrier in described in the present invention is the recombinant chou of the dna artificial sequence synthetic of 97 base pairs, it is plasmid, it is as the positive internal reference in the pcr amplification system, and prevention is because the false negative that the PCR interfering substance that may exist in the sample causes.In described test kit, comprise in the interior target situation, also comprise the upstream primer, downstream primer and the probe that detect for interior mark in the described PCR reaction solution; And the sequence of mark probe is 5'-TCATCCAGTGCAAGTCTTGATCCTGTC-3' in preferred.

Also comprise enzyme mixation in the preferred test kit of the present invention, comprise the uracil dna glycosylase (UNG enzyme) of hot resistant DNA polymerase (Taq enzyme) and 0.5 ~ 2U/ μ l in the described enzyme mixation, in described PCR reaction solution, also comprise dUTP simultaneously.Wherein the function of UNG enzyme is the PCR product that degraded contains dU, utilizes the dUTP in UNG enzyme and the PCR reaction solution can play the effect of prevention PCR product pollution, thereby prevents the pattern detection false positive.

In an embodiment, also comprise NG positive control, NG negative control and the quantitative reference material of NG in the described test kit.

The present invention also provides a kind of LCx Neisseria Gonorrhoeae Assay, comprise the PCR reaction solution in the described test kit, comprise upstream primer, the downstream primer for the target polynucleotide amplification in the described PCR reaction solution and be used for the probe that target polynucleotide detects, and be respectively 5 '-CTATCAACCCTGCCGCCG-3 ' and 5 '-CCCGGCAGTTACGCATGAG-3 ' for the upstream primer of target polynucleotide and the sequence of downstream primer.

The present invention provides again a kind of LCx Neisseria Gonorrhoeae Assay, comprise the PCR reaction solution in the described test kit, comprise upstream primer, the downstream primer for target polynucleotide amplification in the described PCR reaction solution and be used for the probe that target polynucleotide detects, and the probe sequence that is used for target polynucleotide is 5 '-CCTAGCAAGCTCCACAGATAGGGCTTG-3 '.

The present invention also specifically provides a kind of LCx Neisseria Gonorrhoeae Assay, comprises nucleic acid releasing agent, PCR reaction solution, interior mark, enzyme mixation, NG positive control, NG negative control and the quantitative reference material of NG in the described test kit; And comprise Buddhist Sha graceful (surfactin) 0.01 ~ 0.5mM/L in the described nucleic acid releasing agent, Repone K 20 ~ 300mM/L, sodium laurylsulfonate 0.01 ~ 2%, ethanol 0.05 ~ 1% and solvent TE damping fluid; Comprise upstream primer, downstream primer and probe for target polynucleotide amplification and detection in the described PCR reaction solution, the upstream primer, downstream primer and the probe that are used for interior mark amplification and detect, 10 * PCR reaction buffer, deoxyribonucleoside triphosphate and/or ribonucleotide triphosphate dNTP; Being designated as a segment length who inserts the pUC18T carrier in described is the recombinant chou of the dna artificial sequence synthetic of 97 base pairs; Comprise archaeal dna polymerase and uracil dna glycosylase in the described enzyme mixation.

NG fluorescence PCR detection reagent kit operation provided by the invention fast, method is easy, detection sensitivity is high, sensing range is wide, using this test kit can detect fast and accurately to the NG-DNA in the unknown sample such as genital secretion, for the diagnosis gonococcal infection provides reliable experimental basis.Its detected result can be used for auxiliary diagnosis that NG infects and the observation of curative effect of medication, for the early diagnosis of venereal disease and venereal disease high risk population's primary dcreening operation provide the molecular diagnosis foundation.

Description of drawings

2. 1. be the amplification curve of the positive sample to be tested of gonococcus NG-DNA detected result among the embodiment among Fig. 1, be the amplification curve of the negative sample to be tested of NG-DNA detected result among the embodiment among Fig. 1.

Embodiment

Be preferred implementation of the present invention only below, protection scope of the present invention is not limited to this, and any those skilled in the art can be easy to the change of carrying out or change be encompassed within protection scope of the present invention in technical scope disclosed by the invention.Therefore, protection scope of the present invention should be as the criterion with the protection domain of claims.

Embodiment 1

The present embodiment provides a kind of concrete gonococcus fluorescence PCR detection reagent kit, and it comprises following component:

1. nucleic acid releasing agent: comprise Buddhist Sha graceful (surfactin) 0.1mM/L, Repone K 100mM/L, the ethanol of sodium laurylsulfonate (SDS) 0.1%, 0.1%.

2. mark (positive internal reference) in: for the segment length that inserts the pUC18T carrier is the recombinant chou of the dna artificial sequence synthetic of 97 base pairs, it is plasmid, concentration is 5.00E+05copies/ml, and the sequence of 97 base pairs is: 5 '-GTGTCTGCGGCGTTTTATCATCTTCCTCTGTCATCCAGTGCAAGTCTTGATCCTGT CGTTGGTTCTTCTGGACTATCAAGGTATGTTGCCCGTTTGT-3 '.

3. PCR reaction solution: comprise 10 * PCR reaction buffer, 5 μ l, 0.2mmol/L dNTP, the upstream and downstream primer that is used for the target polynucleotide amplification is 0.3 μ mol/L, the probe that is used for the target polynucleotide detection is 0.3 μ mol/L, the upstream and downstream primer that is used for interior mark fragment amplification is 0.3 μ mol/L, is 0.1 μ mol/L for detection of interior target probe.Wherein, described 10 * PCR reaction buffer is the 200mmol/L Tri(Hydroxymethyl) Amino Methane Hydrochloride solution that comprises pH7.5,30mmol/L magnesium chloride solution, 500mmol/L Klorvess Liquid, 0.2% Triton solution and 10% formamide soln; Described dNTP comprises dATP, dCTP, dUTP and dGTP; Described is primer and the probe that comes from the conservative region of gonococcus nucleic acid for the upstream and downstream primer of target polynucleotide amplification and the probe that detects for target polynucleotide, and its base sequence is respectively: upstream primer: 5 '-CTATCAACCCTGCCGCCG-3 '; Downstream primer: 5 '-CCCGGCAGTTACGCATGAG-3 '; Probe: 5 '-CCTAGCAAGCTCCACAGATAGGGCTTG-3 '; Describedly be respectively for detection of interior target primer probe sequence: upstream primer: 5 '-GTGTCTGCGGCGTTTTATCAT-3 '; Downstream primer: 5 '-ACAAACGGGCAACATACCTTG-3 '; Probe: 5'-TCATCCAGTGCAAGTCTTGATCCTGTC-3'.

4. enzyme mixation: comprise the hot resistant DNA polymerase (Taq enzyme) of 5U/ μ l and the uracil dna glycosylase (UNG enzyme) of 1U/ μ l.

5. the quantitative reference material of NG: derive from the NG strong positive plasmid that uses after the NG quantitative linearity reference material L1 of enterprise ~ L5 definite value, the quantitative reference material of this gonococcus comprises the gradient reference material that A, B, C, four concentration of D form, and its concentration is respectively 4.00E+07copies/ml(A), 4.00E+06copies/ml(B), 4.00E+05copies/ml(C), 4.00E+04copies/ml(D).

6. NG positive control: be the NG strong positive sample that clinical hospitals is collected, its concentration is 4.00E+05copies/ml.

7. NG negative control: the negative clinical sample of deactivation that does not contain gonococcus, hsv, chlamydia trachomatis, ureaplasma urealyticum and human papillomavirus etc.

Embodiment 2

The present embodiment provides the operation steps of above-described embodiment 1 described test kit for detection of NG-DNA in the unknown sample such as genital secretion:

One, reagent is prepared

Quantity according to sample to be tested, NG negative control, NG positive control and the quantitative reference material A of NG ~ D, get in proportion PCR reaction solution (38 μ l/ person-portion), enzyme mixation (2 μ l/ person-portion) and the interior mark 1.0 μ l/ person-portions of respective amount, fully be mixed into PCR-mix, when for example sample to be tested is 3 person-portion, need altogether the PCR-mix of preparation 9 person-portions (people's umber of above-mentioned four is respectively 3,1,1 and 4); Instantaneous centrifugal rear for subsequent use.

Two, sample process

1. method A: sample directly fast nucleic acid discharge

Add shallow the beating of the dark suction of nucleic acid releasing agent 2～5 μ l(suggestion in each PCR reaction tubes, avoid occurring bubble), each pipe adds each 3 ~ 5 μ l of sample to be tested, NG negative control, NG positive control and the quantitative reference material A of NG ~ D successively, inhales and makes a call to 3 ~ 5 mixings (inhale gently and beat, avoid occurring bubble); The interval is more than 10 minutes, and every pipe adds PCR-mix40 ~ 45 μ l, inhales and beats mixing 2-3 time, lid upper tube cap (after removing bubble), centrifugal 30 seconds of 2000rpm.

2. method B: sample nucleic acid after high speed centrifugation is concentrated discharges

Get 200 ~ 500 μ l samples to be tested, 13,000rpm inhales after centrifugal 5 minutes and abandons supernatant, adds 20 ~ 50 μ l nucleic acid releasing agents, leave standstill 10 minutes after, for subsequent use; Each PCR reaction tubes adds each 5 ~ 10 μ l of above-mentioned pretreated sample to be tested, NG negative control, NG positive control and the quantitative reference material A of NG ~ D; Each PCR reaction tubes adds PCR-mix40 ~ 45 μ l, lid upper tube cap (after removing bubble), centrifugal 30 seconds of 2000rpm.

Three, Fluorescence PCR and interpretation of result (carrying out at the fluorescent quantitative PCR instrument)

1) the PCR reaction tubes is put into the amplification instrument sample cell, by correspondence sample to be tested title and quantitative reference material concentration are set sequentially.

2) fluorescence detection channel is selected: select FAM passage (Reporter:FAM, Quencher:None) to detect NG; Select HEX or VIC passage (Reporter:VIC, Quencher:None) to detect interior mark; Reference fluorescence (Passive Reference) is set to none.

3) the quantitative fluorescent PCR reaction conditions sees Table 1:

Table 1

4) interpretation of result

After reaction finishes, the automatic saving result of instrument, the software that can utilize instrument to carry carries out automatic analysis, and starting value, end value and threshold value that also can the manual regulation baseline be analyzed, and then record sample Ct value and result.The intersection point of amplification curve and threshold line is called Ct value (be cycle threshold, refer to the cycling numerical value that fluorescent signal in the PCR reaction tubes experiences when reaching the threshold value of setting); Instrument software by the typical curve that 4 quantitative reference materials of concentration gradient are drawn, can be tried to achieve the definite value result of each sample according to each sample Ct value size automatically.For measuring Ct value≤38(Ct value＞0) sample, be reported as the NG-DNA positive, the amplification curve of sample to be tested is S-type at this moment, as among Fig. 1 1.; For the sample that measure to show without Ct value, simultaneously in mark test positive (Ct value≤38), be reported as the NG-DNA feminine gender, the sample to be tested amplification curve is straight at this moment, as among Fig. 1 2.; For measuring Ct value〉38 sample, mark test positive (Ct value≤38) in simultaneously, be reported as and be lower than the detection lower limit.If interior mark Ct value〉38 or interior mark show that without the Ct value, then the detected result of this sample is invalid, should search and get rid of reason, and this sample is carried out revision test.

Use the specific test of test kit among the present invention to show, itself and the equal no cross reaction such as common venereal diseases pathogenic agent HPV, HSV-2, CT, UU illustrate that test kit of the present invention has good specificity.

Using the yin and yang attribute coincidence rate of test kit detection enterprise work reference material among the present invention is 100%, and the detected result of quantitative linearity reference material, sensitivity reference material meets quality standard; In precision test shows batch and batch between good reproducibility, the variation coefficient of its Ct value＜10%, the concentration variation coefficient＜50%.Test kit shows the detection test of clinical sample among use the present invention, and the detection linearity range of this test kit is 400～4.00E+10copies/ml, and detecting lower limit is that sensitivity is 400copies/ml.

Claims

1. the application of nucleic acid releasing agent in gonococcus NG detects, described nucleic acid releasing agent comprises Buddhist Sha graceful (surfactin) 0.01 ~ 0.5mM/L, Repone K 20 ~ 300mM/L, sodium laurylsulfonate 0.01 ~ 2% and ethanol 0.05 ~ 1%.

2. gonococcus NG detection kit, comprise nucleic acid releasing agent and PCR reaction solution in the described test kit, described nucleic acid releasing agent comprises Buddhist Sha graceful (surfactin) 0.01 ~ 0.5mM/L, Repone K 20 ~ 300mM/L, sodium laurylsulfonate 0.01 ~ 2% and ethanol 0.05 ~ 1%; Comprise upstream primer, the downstream primer for the target polynucleotide amplification in the described PCR reaction solution and be used for the probe that target polynucleotide detects.

3. detection kit according to claim 2 is characterized in that, the probe sequence that is used for target polynucleotide is 5 '-CCTAGCAAGCTCCACAGATAGGGCTTG-3 '.

4. detection kit according to claim 2 is characterized in that, is used for the upstream primer of target polynucleotide and the sequence of downstream primer and is respectively: 5 '-CTATCAACCCTGCCGCCG-3 ' and 5 '-CCCGGCAGTTACGCATGAG-3 '.

5. the described test kit of any one according to claim 2 ~ 4, it is characterized in that, also comprise interior mark in the described test kit, described interior label sequence is 5 '-GTGTCTGCGGCGTTTTATCATCTTCCTCTGTCATCCAGTGCAAGTCTTGATCCTGT CGTTGGTTCTTCTGGACTATCAAGGTATGTTGCCCGTTTGT-3 '.

6. detection kit according to claim 5 is characterized in that, also comprises the upstream primer, downstream primer and the probe that detect for interior mark in the described PCR reaction solution; And the sequence of interior mark probe is 5'-TCATCCAGTGCAAGTCTTGATCCTGTC-3'.

7. the described detection kit of any one according to claim 2 ~ 4, it is characterized in that, also comprise enzyme mixation in the described test kit, the uracil dna glycosylase (UNG enzyme) that comprises hot resistant DNA polymerase (Taq enzyme) and 0.5 ~ 2U/ μ l in the described enzyme mixation also comprises dUTP simultaneously in described PCR reaction solution.

8. the described detection kit of any one is characterized in that according to claim 1 ~ 4, also comprises NG positive control, NG negative control and the quantitative reference material of NG in the described test kit.

9. LCx Neisseria Gonorrhoeae Assay, comprise the PCR reaction solution in the described test kit, comprise upstream primer, the downstream primer for the target polynucleotide amplification in the described PCR reaction solution and be used for the probe that target polynucleotide detects, and be respectively 5 '-CTATCAACCCTGCCGCCG-3 ' and 5 '-CCCGGCAGTTACGCATGAG-3 ' for the upstream primer of target polynucleotide and the sequence of downstream primer.

10. LCx Neisseria Gonorrhoeae Assay, comprise the PCR reaction solution in the described test kit, comprise upstream primer, the downstream primer for target polynucleotide amplification in the described PCR reaction solution and be used for the probe that target polynucleotide detects, and the probe sequence that is used for target polynucleotide is 5 '-CCTAGCAAGCTCCACAGATAGGGCTTG-3 '.