CN103725800B - Human adenovirus detection kit - Google Patents

Human adenovirus detection kit Download PDF

Info

Publication number
CN103725800B
CN103725800B CN201410017219.2A CN201410017219A CN103725800B CN 103725800 B CN103725800 B CN 103725800B CN 201410017219 A CN201410017219 A CN 201410017219A CN 103725800 B CN103725800 B CN 103725800B
Authority
CN
China
Prior art keywords
hadv
pcr reaction
adenovirus
primer
reaction solution
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201410017219.2A
Other languages
Chinese (zh)
Other versions
CN103725800A (en
Inventor
戴立忠
艾颖娟
邓中平
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Sansure Biotech Inc
Original Assignee
Hunan Co Ltd Of Sheng Weier Medical Test Institute
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Hunan Co Ltd Of Sheng Weier Medical Test Institute filed Critical Hunan Co Ltd Of Sheng Weier Medical Test Institute
Priority to CN201410017219.2A priority Critical patent/CN103725800B/en
Publication of CN103725800A publication Critical patent/CN103725800A/en
Application granted granted Critical
Publication of CN103725800B publication Critical patent/CN103725800B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/686—Polymerase chain reaction [PCR]

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Immunology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • Virology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention provides a human adenovirus (HAdV) detection kit. The kit comprises a nucleic releaser and PCR (polymerase chain reaction) liquid, wherein the nucleic releaser contains 0.01mM/L to 0.5mM/L of surfactin, 20mM/L to 300mM/L of potassium chloride, 0.01 to 2 percent of sodium dodecyl sulfate and 0.05 to 1 percent of ethanol; the PCR reaction liquid contains primers for HAdV detection and a probe sequence, wherein the HAdV upstream primer is AGTGTAACATGACCAAAGACTGGTTC, the HAdV downstream primer is AAGAAGGAGTACATGCGRTCCTT, and the HAdV probe is ACTACAACATTGGCTACCAGGGCTTCTA. The sensitivity of the kit for detecting the HAdV can reach 400copies/ml, and the quantitative linear range is 400 to 4.00 E+09copies/ml; by utilizing the kit, the HAdV-DNA (deoxyribonucleic acid) in unknown samples such as sputum and throat swab can be rapidly and accurately detected, and reliable experimental reference can be provided for the early diagnosis of the infection of the HAdV.

Description

A kind of adenovirus hominis detection kit
Technical field
The invention provides a kind of adenovirus hominis detection kit, specifically a kind of adenovirus detection kit based on fluorescent PCR.
Background technology
((Human adenoviruses, HAdV) belongs to Adenoviridae to adenovirus hominis, is the widely distributed DNA virus of a group, can be divided into A ~ F six subspecies, totally 51 serotypes.Adenovirus is nonenveloped virus, under low ph environment, Absorbable organic halogens exists, and has the ability of the effect of the very strong reagent of resistance to physics and chemistry, and adenovirus can produce tolerance to gastrointestinal secretion thing and bile, therefore adenovirus can copy in stomach and intestine, produces very high virus load.Adenovirus is everlasting, and pharynx, conjunctiva, enteron aisle and Lymphoid tissue are interior breeds, and causes various clinical symptom, the infection, conjunctivitis, gastro-enteritis, hepatitis, hemorrhagic cystitis, neural disorder etc. of such as respiratory system.Different adenovirus subspecies can cause different diseases, as adenovirus hominis C subspecies mainly cause paediatric upper respiratory tract infection, adenovirus hominis B subspecies be everlasting cause in grownup popular, adenovirus hominis B and E subspecies are Etiologicals that military camp personnel infect, and adenovirus hominis F subspecies can cause infectious diarrhea.Adenovirus is gentle at immune host's In vivo infection, and has self limiting.Adenovirus is propagated by people, water, vehicle and apparatus, and under room temperature condition, adenovirus exists the cycle and can extend to 3 weeks in dirt.Adenovirus more easily occurs to infect and popular on a large scale in children and military camp personnel, and most of infant at least infected a kind of adenopathy strain in after birth 5 years.In the past few years, adenovirus often causes high incidence and mortality ratio as main pathogenic agent in immunologic hypofunction host is as the patient of aids patient, immune genetic defect, bone marrow recipients, solid organs and hematopoietic stem cell transplantation person; Paediatrics stands the patient of isotype stem cell transplantation, and after it infects adenovirus, mortality ratio can up to 60%.Some fatal infection are often caused by adenoviral serotype 1,2,3, often there will be the situation of the microorganism such as bacterium, fungi coinfection in these patient bodies.Aids patient infects adenovirus can produce the complication such as pneumonia, hepatitis, meningomalacia, ephritis, gastro-enteritis.Therefore, it is possible to make a definite diagnosis which kind of cause of disease in time cause a disease, accomplish early to find early treatment, sb.'s illness took a turn for the worse in minimizing, therefore early diagnosis is very important.
The type depend on disease to the detection of adenovirus and the sample obtaining, the existence of making a definite diagnosis adenovirus can adopt the technology such as the cell cultures of virus, antigen measuring and genome detection.Although cell cultures remains the gold standard of HAdV, it is insensitive to clinical samples, and slow, is subject to the pollution of bacterium and fungi.Detection of antigen is commonly used to direct-detection adenovirus in respiratory tract and GI infection, faster and sensitivity is higher.Immunofluorescence (especially to respiratory tract specimens, throat swab and living tissue specimen) and enzyme immunoassay (especially for stool sample) are conventional methods, and compared with cell cultures, the sensitive performance of Immunofluorescence test adenovirus improves 40 ~ 60%.Other method directly measuring antigen comprises immunochromatographic method and latex agglutination.Research confirms, compared with cell cultures detection method, the sensitivity using immune chromatography reagent kit to measure can reach 90%.
In recent years, poly-nuclear polymerase chain reaction (PCR) method gradually manifested its detect on advantage, Fluorescence PCR assay is that the one grown up based on traditional PCR technique and in conjunction with spectroscopic techniques is sensitiveer, more special, more accurate nucleic acid detection technique.Detected result is accurate, and repeatability is high, dynamic reaction patient treatment forward and backward pathogenic agent dynamic change and with clinical relation, and in whole process, avoid the problem that normal PCR needs aftertreatment, decrease pollution.
Round pcr is that the detection of adenovirus hominis provides another new approach.The appearance of quantitative PCR, breaking PCR can only situation qualitatively, wherein quantitative fluorescent PCR is with features such as its highly sensitive, high specific, low stain rate, Real-Time Monitorings, can be clinically to provide more accurately, objective detected result, and understand the state of an illness and prognosis in time.Domestic at present also do not have fluorescent PCR diagnostic kit to use in clinical HAdV Infect And Diagnose, therefore designs and develops highly sensitive, the HAdV nucleic acid fluorescent PCR diagnostic kit tool of high specific has very great significance.
Use round pcr to carry out detection and be mainly concerned with two aspects, the extraction of nucleic acid and the augmentation detection of nucleic acid.
The direct boiling method of domestic main employing clinically extracts the HAdV nucleic acid in sputum, throat swab equal samples at present, and specifically to adding certain nucleic acid cleavage liquid in pretreated sample, directly boil, high speed centrifugation, supernatant is template; The method nucleic acid extraction process is more complicated, sample process length consuming time, and when processing sample through multiple steps such as boiling lysis, high speed centrifugation enrichment DNAs, there is loss in the DNA in sample, especially insufficient to the sample cracking of high density, enrichment is incomplete, a large amount of loss of DNA can be caused to cause sample quantitatively on the low side, simultaneously owing to have employed the elevated temperature heating stage of water-bath or metal bath, easily cause Aerosol Pollution.
The detection method of HAdV-DNA is at present mainly based on the technology of real-time fluorescence quantitative PCR, Real-Time Fluorescent Quantitative PCR Technique is development in recent years a kind of nucleic acid detection technique rapidly, use a kind of PCR amplification instrument with fluorescence detection device, fluorescence detection device can send the exciting light of specific wavelength according to certain routines periodically, collect and detect fluorescent signal, the level of amplification of each circulation of PCR is reflected in real time by the dynamic change detecting fluorescent signal, amplification curve is obtained by software automatic analysis after off-test, according to amplification curve and the intersection point (i.e. Ct value) of fluorescence threshold line and the shape of amplification curve, yin and yang attribute result can be judged, if have qualitative reference product or the standard substance of concentration known in same reaction, then can obtain typical curve by software automatic analysis, realize the definite value (i.e. detection by quantitative) to unknown sample thus.Compare with traditional PCR, it adds the probe of a two ends difference mark fluorescent reporter group and quenching group in reaction system.When probe structure is complete, the fluorescent energy that fluorescent reporter group sends is quenched group absorptions, presents quenching effect; If there is the existence of target sequence in amplification procedure, along with the extension of target fragment, probe molecule is cut off by Taq enzyme hydrolysis gradually, fluorescent reporter group and quenching group dissociate mutually, blocked fluorescence energy transfer effect between the two, the fluorescent signal that fluorescent reporter group sends is collected by fluorescence detection device.Along with the carrying out of amplification, fluorescent signal presents linear enhancing along with the amplification of object fragment.After off-test, the software automatic analysis data that can be carried by fluorescent PCR instrument, the definite value result of yin and yang attribute result and concentration of specimens can be obtained, therefore, this technology is in the detection and quantitative analysis of target polynucleotide sample, replace traditional PCR method gradually, obtain applying very widely.
The external existing research kit detecting HAdV-DNA based on Real-Time Fluorescent Quantitative PCR Technique at present, but these test kits extract nucleic acid with boiling method mostly, and its detection sensitivity is not high, about about 500 ~ 1000copies/ml; In addition, these test kits lack perfect system of quality control mostly, also need to improve further and improve technical level, and make this series products more meet the needs of clinical Accurate Diagnosis.
Summary of the invention
The invention provides the application of a kind of nucleic acid releasing agent in adenovirus hominis detects, described nucleic acid releasing agent comprises Buddhist Sha graceful (surfactin) 0.01 ~ 0.5mM/L, Repone K 20 ~ 300mM/L, sodium laurylsulfonate 0.01 ~ 2% and ethanol 0.05 ~ 1%.
In nucleic acid releasing agent of the present invention, its solvent can be conventional for this area, such as, be sterilized water or TE damping fluid.The present invention is disclosed in during adenovirus detects the nucleic acid releasing agent used containing strong protein denaturant first, considerably simplify the step of this detection of nucleic acids, and detection sensitivity is greatly improved.
The invention provides a kind of adenovirus hominis HAdV detection kit, described test kit comprises nucleic acid releasing agent and PCR reaction solution, described nucleic acid releasing agent comprises Buddhist Sha graceful (surfactin) 0.01 ~ 0.5mM/L, Repone K 20 ~ 300mM/L, sodium laurylsulfonate 0.01 ~ 2% and ethanol 0.05 ~ 1%; Comprise in described PCR reaction solution for HAdV detect primer and probe sequence as follows,
HAdV upstream primer: AGTGTAACATGACCAAAGACTGGTTC,
HAdV downstream primer: AAGAAGGAGTACATGCGRTCCTT,
HAdV probe: ACTACAACATTGGCTACCAGGGCTTCTA.
The detected result using the method for the release of the nucleic acid releasing agent in test kit of the present invention nucleic acid and boiling method to extract nucleic acid does not have notable difference, and when extracting nucleic acid in the present invention, adopt strong protein denaturant, rapid damage pathogenic agent coat protein structure, discharge pathogen nucleic acid, release and the extraction of DNA can be completed without the need to heating; The sensitivity that test kit of the present invention detects adenovirus can reach 400copies/ml, and quantitative linearity scope is 400 ~ 4.00E+09copies/ml.In addition, test kit of the present invention, because adopting above-mentioned primer and the probe sequence for detecting target polynucleotide, has good specificity.
In the present invention, in preferred described test kit, also comprise interior mark, and also comprise for detecting interior target primer and probe sequence in described PCR reaction solution,
Interior mark: CACCACTTAAATCCTAAGGTTCCAGCTCTGTCATCCAGTTTTGCTGACTCACGTAT TCGTAGCCAATCTTCTGGAGGTGCAATCTCAATTATGTCATCAG;
Interior mark upstream primer: CACCACTTAAATCCTAAGGTTCCAG,
Interior mark downstream primer: CTGATGACATAATTGAGATTGCACC,
Interior mark probe: TTTTGCTGACTCACGTATTCGTAGCCAA.
The recombinant chou that the segment length inserting pUC18T carrier is the DNA artificial sequence synthetic of 100 base pairs is designated as in described in the present invention, i.e. plasmid, it prevents as the positive internal reference in PCR amplification system the false negative that the PCR interfering substance owing to may exist in sample causes.
Also comprise enzyme mixation in preferred test kit of the present invention, in described enzyme mixation, comprise the uracil dna glycosylase (UNG enzyme) of hot resistant DNA polymerase (Taq enzyme) and 0.5 ~ 2U/ μ l, in described PCR reaction solution, also comprise dUTP simultaneously.Wherein the function of UNG enzyme is the PCR primer of degraded containing dU, utilizes the dUTP in UNG enzyme and PCR reaction solution can play the effect of prevention PCR primer pollution, thus prevents pattern detection false positive.
In an embodiment, described test kit comprises nucleic acid releasing agent, interior mark, PCR reaction solution, enzyme mixation, adenovirus hominis qualitative reference product, adenovirus hominis positive control, adenovirus hominis negative control and adenovirus hominis concentrated solution.
The present invention also provides a kind of adenovirus hominis HAdV detection kit, and described test kit comprises PCR reaction solution, comprise in described PCR reaction solution for HAdV detect primer and probe sequence as follows,
HAdV upstream primer: AGTGTAACATGACCAAAGACTGGTTC,
HAdV downstream primer: AAGAAGGAGTACATGCGRTCCTT,
HAdV probe: ACTACAACATTGGCTACCAGGGCTTCTA.
Adenovirus hominis fluorescent quantificationally PCR detecting kit operation provided by the invention fast, method is easy, detection sensitivity is high, sensing range is wide, apply this test kit to detect fast and accurately the HAdV-DNA in the unknown sample such as sputum, throat swab, for diagnosis adenovirus infection provides reliable experimental basis.
Embodiment
Below be only the preferred embodiment of the present invention, protection scope of the present invention is not limited thereto, and any those skilled in the art, in technical scope disclosed by the invention, can be easy to the change carried out or change is all encompassed within protection scope of the present invention.Therefore, protection scope of the present invention should be as the criterion with the protection domain of claims.
In addition, as do not done special explaining, then the percentage composition in the present invention refers to mass percentage.
Embodiment 1
The present embodiment provides a kind of concrete adenovirus detection kit, and it comprises following component:
1. nucleic acid releasing agent: comprise Buddhist Sha graceful (surfactin) 0.1mmol/L, Repone K 100mmol/L, the second alcohol and solvent TE damping fluid of sodium laurylsulfonate (SDS) 0.1%, 0.1%.
2. mark (positive internal reference) in: for the segment length inserting pUC18T carrier is the recombinant chou of the DNA artificial sequence synthetic of 100 base pairs, i.e. plasmid, concentration is 2.00E+04copies/ml, and the sequence of 100 base pairs is: 5 '-CACCACTTAAATCCTAAGGTTCCAGCTCTGTCATCCAGTTTTGCTGACTCACGTAT TCGTAGCCAATCTTCTGGAGGTGCAATCTCAATTATGTCATCAG-3 '.
3. PCR reaction solution: comprise 10 × PCR reaction buffer 5 μ l, the dNTP of 0.2mmol/L, upstream and downstream primer for target polynucleotide amplification is 0.3 μm of ol/L, the probe detected for target polynucleotide is 0.3 μm of ol/L, upstream and downstream primer for interior mark fragment amplification is 0.3 μm of ol/L, is 0.1 μm of ol/L for detecting interior target probe.Wherein, described 10 × PCR reaction buffer is comprise the 200mmol/L Tri(Hydroxymethyl) Amino Methane Hydrochloride solution of pH7.5,30mmol/L magnesium chloride solution, 500mmol/L Klorvess Liquid, the Triton solution of 0.2% and the formamide soln of 10%; Described dNTP comprises dATP, dCTP, dUTP, dGTP and dTTP; The described upstream and downstream primer for target polynucleotide amplification and be primer and the probe of the conservative region coming from adenoviral nucleic acid for the probe that target polynucleotide detects, its base sequence is respectively:
HAdV upstream primer: 5 '-AGTGTAACATGACCAAAGACTGGTTC-3 ';
HAdV downstream primer: 5 '-AAGAAGGAGTACATGCGRTCCTT-3 ';
HAdV probe: 5 '-ACTACAACATTGGCTACCAGGGCTTCTA-3 ';
Described is respectively for detecting interior target primer probe sequence:
Interior mark upstream primer: 5 '-CACCACTTAAATCCTAAGGTTCCAG-3 ';
Interior mark downstream primer: 5 '-CTGATGACATAATTGAGATTGCACC-3 ';
Interior mark probe: 5 '-TTTTGCTGACTCACGTATTCGTAGCCAA – 3 '.
4. enzyme mixation: comprise the hot resistant DNA polymerase (Taq enzyme) of 5U/ μ l and the uracil dna glycosylase (UNG enzyme) of 1U/ μ l.
5. adenovirus hominis qualitative reference product: derive from the HAdV strong positive plasmid after end user's adenovirus enterprise quantitative linearity reference material L1 ~ L5 definite value, these adenovirus qualitative reference product comprise the gradient reference material of A, B, C, D tetra-concentration composition, and its concentration is respectively 4.00E+07copies/ml(A), 4.00E+06copies/ml(B), 4.00E+05copies/ml(C), 4.00E+04copies/ml(D).
6. adenovirus hominis positive control: be the HAdV strong positive throat swab sample of the deactivation that clinical hospitals is collected, after concentrated centrifugal, add sterile saline dissolution precipitation, and after the detection of qualified adenovirus hominis test kit also definite value, being diluted to concentration with sterile saline is 4.00E+05copies/ml.
7. adenovirus hominis negative control: the negative throat swab sample of HAdV of the deactivation that clinical hospitals is collected, after diluting 100 times, is detected as feminine gender through qualified HAdV test kit with sterile saline.
8. adenovirus hominis concentrated solution: polyethylene glycol 6000 (PEG-6000) 10 ~ 100mmol/L(mass/volume), sodium-chlor 50 ~ 500mmol/L(mass/volume).
Embodiment 2
The present embodiment provides test kit described in above-described embodiment 1 for detecting the operation steps of HAdV-DNA in the unknown sample such as sputum, throat swab:
One, reagent prepares
According to the quantity of sample to be tested, adenovirus negative control, adenovirus positive control and adenovirus qualitative reference product A ~ D, get the PCR reaction solution (38 μ l/ person-portion) of respective amount, enzyme mixation (2 μ l/ person-portion) and interior mark 0.5 μ l/ person-portion in proportion, be fully mixed into PCR-mix; For subsequent use after brief centrifugation.
Two, nucleic acid extraction
1. sputum sample: the physiological saline adding 2 ~ 3 times of volumes in sputum sample, leave standstill after abundant concussion mixing and make a sputum liquefaction in hour, the sample 1000 μ l getting post liquefaction (avoids the obvious solid impurity of sucking-off) in 1.5ml centrifuge tube, adenovirus hominis concentrated solution 100 μ l is added, the centrifugal 5min of 12,000rpm after vibration mixing in centrifuge tube, abandon supernatant, add 50 μ l nucleic acid releasing agents in precipitation, concussion or liquid-transfering gun are inhaled and are played mixing, for subsequent use as sample to be tested.
2. throat swab sample: add 1ml stroke-physiological saline solution in the sample collection tube of collecting throat swab, abundant vibration mixing, then whole liquid is poured into (cotton swab abandons after extracting by centrifugal tube wall) in 1.5ml sterile centrifugation tube, adenovirus hominis concentrated solution 100 μ l is added, the centrifugal 5min of 12,000rpm after vibration mixing in centrifuge tube, abandon supernatant, add 50 μ l nucleic acid releasing agents in precipitation, concussion or liquid-transfering gun are inhaled and are played mixing, for subsequent use as sample to be tested.
3. adenovirus negative control, adenovirus positive control, adenovirus qualitative reference product: adenovirus negative control, adenovirus positive control, adenovirus qualitative reference product A ~ D get 10 μ l respectively and 10 μ l nucleic acid releasing agents mix stand-by.
Three, to application of sample in PCR reaction tubes
The each 10 μ l of sample to be tested, adenovirus negative control, adenovirus positive control and adenovirus qualitative reference product A ~ D after process in above-mentioned second step are added in each PCR reaction tubes; Leave standstill after 10 minutes, often pipe adds the PCR-mix40 μ l in step one, inhales and plays mixing 2-3 time, removes bubble bonnet upper tube cap, centrifugal 30 seconds of 2000rpm.
Four, Fluorescence PCR and interpretation of result (carrying out on fluorescent quantitative PCR instrument)
1) PCR reaction tubes is put into amplification instrument sample cell, sample to be tested title and qualitative reference product concentration are set by correspondence order.
2) fluorescence detection channel is selected: select FAM passage (Reporter:FAM, Quencher:None) to detect adenovirus; HEX or VIC passage (Reporter:VIC, Quencher:None) is selected to detect interior mark; Reference fluorescent (Passive Reference) is set to none.
3) quantitative fluorescent PCR reaction conditions is in table 1:
Table 1
4) interpretation of result
After reaction terminates, the automatic saving result of instrument, the software that instrument can be utilized to carry carries out automatic analysis, also the starting value of manual regulation baseline, end value and threshold value can analyze, then records sample Ct value and result.The intersection point of amplification curve and threshold line, is called Ct value (i.e. cycle threshold, the cycling numerical value experienced when the fluorescent signal referring in PCR reaction tubes reaches the threshold value of setting); Instrument software is according to each sample Ct value size, and the typical curve drawn by 4 concentration gradient qualitative reference product, can try to achieve the detection by quantitative result of each sample automatically.For measuring Ct value≤39(Ct value > 0) sample, be reported as the HAdV-DNA positive, now the amplification curve of sample to be tested is S-type; For measuring the sample of display without Ct value, mark test positive (Ct value≤39) simultaneously, be reported as HAdV-DNA feminine gender, now sample to be tested amplification curve is straight; For the sample measuring Ct value >39, simultaneously, mark test positive (Ct value≤39), is reported as lower than Monitoring lower-cut.If interior mark Ct value >39 or the display of interior mark are without Ct value, then the detected result of this sample is invalid, should search and get rid of reason, and carries out revision test to this sample.
The homology that first the present invention finds out 51 serotypes of HAdV-DNA guards section, then designs its primer and probe at its conservative region, can detect that HAdV infects, but can not detect non-HAdV pathogenic agent, illustrates that test kit of the present invention has good specificity.Its specific test is shown: with common causative as all no cross reactions such as UU, MP, CP, TB, EBV and influenza virus.
The detection sensitivity of test kit of the present invention can reach 400copies/ml, and quantitative linearity scope is 400copies/ml ~ 4.00E+09copies/ml.Use test kit of the present invention to detect enterprise work reference material, its yin and yang attribute reference material coincidence rate is 100%, and the detected result of sensitivity reference material meets quality standard.Use the precision test of test kit of the present invention to show, batch in and batch between reproducible, the variation coefficient <10% of detected result Ct value, concentration variation coefficient <50%.

Claims (5)

1. an adenovirus hominis HAdV detection kit, described test kit comprises nucleic acid releasing agent and PCR reaction solution, described nucleic acid releasing agent comprises Sha graceful 0.01 ~ 0.5mM/L, Repone K 20 ~ 300mM/L of ancient India, sodium laurylsulfonate 0.01 ~ 2% and ethanol 0.05 ~ 1%; Comprise in described PCR reaction solution for HAdV detect primer and probe sequence as follows,
HAdV upstream primer: AGTGTAACATGACCAAAGACTGGTTC,
HAdV downstream primer: AAGAAGGAGTACATGCGRTCCTT,
HAdV probe: ACTACAACATTGGCTACCAGGGCTTCTA.
2. detection kit according to claim 1, is characterized in that, also comprises interior mark in described test kit, and also comprises for detecting interior target primer and probe sequence in described PCR reaction solution,
Interior mark: CACCACTTAAATCCTAAGGTTCCAGCTCTGTCATCCAGTTTTGCTGACTCACGTAT TCGTAGCCAATCTTCTGGAGGTGCAATCTCAATTATGTCATCAG;
Interior mark upstream primer: CACCACTTAAATCCTAAGGTTCCAG,
Interior mark downstream primer: CTGATGACATAATTGAGATTGCACC,
Interior mark probe: TTTTGCTGACTCACGTATTCGTAGCCAA.
3. detection kit according to claim 1, it is characterized in that, also comprise enzyme mixation in described test kit, in described enzyme mixation, comprise the uracil dna glycosylase of hot resistant DNA polymerase and 0.5 ~ 2U/ μ l, in described PCR reaction solution, also comprise dUTP simultaneously.
4. according to the test kit in claim 1-3 described in any one, it is characterized in that, described test kit comprises nucleic acid releasing agent, interior mark, PCR reaction solution, enzyme mixation, adenovirus hominis qualitative reference product, adenovirus hominis positive control, adenovirus hominis negative control and adenovirus hominis concentrated solution.
5. an adenovirus hominis HAdV detection kit, described test kit comprises PCR reaction solution, comprise in described PCR reaction solution for HAdV detect primer and probe sequence as follows,
HAdV upstream primer: AGTGTAACATGACCAAAGACTGGTTC,
HAdV downstream primer: AAGAAGGAGTACATGCGRTCCTT,
HAdV probe: ACTACAACATTGGCTACCAGGGCTTCTA.
CN201410017219.2A 2014-01-15 2014-01-15 Human adenovirus detection kit Active CN103725800B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201410017219.2A CN103725800B (en) 2014-01-15 2014-01-15 Human adenovirus detection kit

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201410017219.2A CN103725800B (en) 2014-01-15 2014-01-15 Human adenovirus detection kit

Publications (2)

Publication Number Publication Date
CN103725800A CN103725800A (en) 2014-04-16
CN103725800B true CN103725800B (en) 2015-03-11

Family

ID=50450090

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201410017219.2A Active CN103725800B (en) 2014-01-15 2014-01-15 Human adenovirus detection kit

Country Status (1)

Country Link
CN (1) CN103725800B (en)

Families Citing this family (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105586439B (en) * 2016-01-27 2020-12-18 中国人民解放军军事医学科学院基础医学研究所 Kit for detecting B, E type human adenovirus nucleic acid and detection method thereof
CN109504804A (en) * 2018-11-22 2019-03-22 李越希 A kind of RPA method, its primer special and probe and purposes detecting 3 type adenovirus hominis
LU101073B1 (en) * 2018-12-21 2020-06-24 Luxembourg Inst Science & Tech List Dna aptamers specific of adenovirus types
CN110387439B (en) * 2019-07-12 2023-04-25 圣湘生物科技股份有限公司 Primers, probes, kit and method for adenovirus detection and typing
CN111549178A (en) * 2020-04-30 2020-08-18 嘉兴实践医学科技有限公司 Universal nucleic acid detection kit and method for human adenovirus

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1406285A (en) * 2000-02-08 2003-03-26 阿文蒂斯药物股份有限公司 Method for detecting and quantifying adenovirus
CN101107366A (en) * 2004-12-24 2008-01-16 卡洛斯Ⅲ世健康研究所 Probes and methods for the simultaneous detection and identification of multiple viruses that cause respiratory infections in humans
CN103122396A (en) * 2013-01-10 2013-05-29 湖南圣湘生物科技有限公司 Kit for detecting human cytomegalovirus (HCMV)

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1406285A (en) * 2000-02-08 2003-03-26 阿文蒂斯药物股份有限公司 Method for detecting and quantifying adenovirus
CN101107366A (en) * 2004-12-24 2008-01-16 卡洛斯Ⅲ世健康研究所 Probes and methods for the simultaneous detection and identification of multiple viruses that cause respiratory infections in humans
CN103122396A (en) * 2013-01-10 2013-05-29 湖南圣湘生物科技有限公司 Kit for detecting human cytomegalovirus (HCMV)

Also Published As

Publication number Publication date
CN103725800A (en) 2014-04-16

Similar Documents

Publication Publication Date Title
CN103060451B (en) A kind of mycoplasma pneumoniae MP detection kit
CN102174660B (en) HBV (hepatitis B virus) fluorescent quantitative PCR (polymerase chain reaction) detection kit
CN103060473B (en) Herpes virus EBV (Epstein-Barr Virus) detection kit
CN103725800B (en) Human adenovirus detection kit
CN103509877B (en) A kind of PCR kit for fluorescence quantitative for detecting PRV and application thereof
CN103740832B (en) A kind of Cryptococcus neoformans detection kit
CN103614494B (en) Two-color fluorogenic quantitative PCR (Polymerase Chain Reaction) detection kit for CDV (canine distemper viruses) and CPV (canine parvo viruses)
CN102337351B (en) Typing detection kit for influenza virus
CN101886138A (en) Three-color fluorescent RT-PCR (Reverse Transcription-Polymerase Chain Reaction) combined detection method of enterovirus 71, Coxsackie virus A16 and other subtypes of enterovirus as well as kit thereof
CN106244725B (en) Taqman real-time fluorescence PCR kit for diagnosing wild strain of porcine umbilical cord blood pseudorabies virus and application thereof
CN103122396B (en) Kit for detecting human cytomegalovirus (HCMV)
CN103060452B (en) Kit for detecting chlamydia trachomatis (CT)
CN106520984A (en) Pseudomonas aeruginosa nucleic acid fluorescent PCR (polymerase chain reaction) detection kit and detection method
CN101550452B (en) Human bocavirus real-time fluorescence PCR detection reagent kit
CN101550455B (en) Human parainfluenza virus distinguishing and quantitative detection regent kit
CN105779644B (en) The real-time fluorescence nucleic acid isothermal amplification detection kit of human cytomegalovirus
CN105368946A (en) Group B streptococcus nucleic acid assay kit based on PCR (polymerase chain reaction) fluorescent probe method
CN105734172B (en) A kind of Rapid Detection of Classical Swine Fever Virus/porcine reproductive and respiratory syndrome virus/porcine pseudorabies virus/pig parvoviral kit
CN103074428B (en) A kind of mycobacterium tuberculosis TB detection kits
CN103074429B (en) UU (ureaplasma urealyticum) detection kit
CN105349661A (en) Chlamydia trachomatis and gonococcus nucleic acid detection kit
CN103060453A (en) Kit for detecting neisseria gonorrheae (NG)
CN103131797B (en) A kind of bocavirus real-time fluorescence PCR detection reagent kit and application thereof
CN103773884B (en) For detecting the primer sets of Chlamydia pneumoniae 98KDa MOMP gene and probe and application thereof
CN103740834A (en) Candida albicans detection kit

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant
ASS Succession or assignment of patent right

Owner name: HUNAN SHENGXIANG BIOLOGICAL TECHNOLOGY CO., LTD.

Free format text: FORMER OWNER: HUNAN SHENGWEIER MEDICAL INSPECTION CO., LTD.

Effective date: 20150512

C41 Transfer of patent application or patent right or utility model
TR01 Transfer of patent right

Effective date of registration: 20150512

Address after: 410012, No. 680, Lu Song Road, hi tech Development Zone, Hunan, Changsha

Patentee after: Sansure Biotech Inc.

Address before: 410012 No. 680, Lu Song Road, hi tech Industrial Development Zone, Hunan, Changsha

Patentee before: Hunan company limited of Sheng Weier medical test institute

PE01 Entry into force of the registration of the contract for pledge of patent right

Denomination of invention: Human adenovirus detection kit

Effective date of registration: 20170711

Granted publication date: 20150311

Pledgee: Ningbo free trade zone Terry with equity investment partnership (limited partnership)|Suzhou equity equity investment center (limited partnership)|Ningbo Meishan Bonded Port District, Jun and equity investment partnership (limited partnership)|Chen Bang

Pledgor: Hunan Gene Technology Co.|Hunan San Xiang Biological Technology Co. Ltd.

Registration number: 2017430000042

PE01 Entry into force of the registration of the contract for pledge of patent right
CP03 Change of name, title or address

Address after: 410012 No. 680, Lu Song Road, hi tech Industrial Development Zone, Hunan, Changsha

Patentee after: Shengxiang Biotechnology Co., Ltd

Address before: 410012, No. 680, Lu Song Road, hi tech Development Zone, Hunan, Changsha

Patentee before: Sansure Biotech Inc.

CP03 Change of name, title or address
PC01 Cancellation of the registration of the contract for pledge of patent right

Date of cancellation: 20200217

Granted publication date: 20150311

Pledgee: Suzhou Lirui equity investment center (limited partnership)|Triton equity investment partnership (limited partnership)|JUNHE Tongrui equity investment partnership (limited partnership)|Chenbang

Pledgor: SANSURE BIOTECH Inc.

Registration number: 2017430000042