CN104195266B - Detect the quadruple PCR kit for fluorescence quantitative of infantile pneumonia three kinds of pathogenic agent - Google Patents

Detect the quadruple PCR kit for fluorescence quantitative of infantile pneumonia three kinds of pathogenic agent Download PDF

Info

Publication number
CN104195266B
CN104195266B CN201410436112.1A CN201410436112A CN104195266B CN 104195266 B CN104195266 B CN 104195266B CN 201410436112 A CN201410436112 A CN 201410436112A CN 104195266 B CN104195266 B CN 104195266B
Authority
CN
China
Prior art keywords
pcr
quadruple
probe
kinds
hcmv
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201410436112.1A
Other languages
Chinese (zh)
Other versions
CN104195266A (en
Inventor
余道军
陈懿
陈岳明
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Hangzhou First Peoples Hospital
Original Assignee
Hangzhou First Peoples Hospital
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Hangzhou First Peoples Hospital filed Critical Hangzhou First Peoples Hospital
Priority to CN201410436112.1A priority Critical patent/CN104195266B/en
Publication of CN104195266A publication Critical patent/CN104195266A/en
Application granted granted Critical
Publication of CN104195266B publication Critical patent/CN104195266B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
    • C12Q1/701—Specific hybridization probes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6851—Quantitative amplification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/16—Primer sets for multiplex assays
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes

Abstract

The invention discloses the quadruple PCR kit for fluorescence quantitative detecting infantile pneumonia three kinds of pathogenic agent and internal reference, be made up of DNA extraction liquid, quadruple Fluorescence PCR liquid, internal reference solution, negative quality control product, strong positive quality control product, weak positive quality control product, five positive plasmid standards for quantitations.The present invention adopts AllGlo probe technique, devise four pairs of special primers and corresponding probe, application quadruple fluorescent quantitative PCR technique detects three kinds of pathogenic agent and internal reference simultaneously, Optimal reaction conditions, sets up a kind of method that single tube Quadruple-PCR based on AllGlo probe technique detects three kinds of pathogenic agent and internal reference simultaneously.The present invention is reasonable in design, fast simple to operate, highly sensitive, specificity, reproducible, result accurately and reliably, the early diagnosis of the pneumonia caused for children with acute respiratory infection and control, blocking-up contagium, reduces EBV, MP, HCMV and to infect and polyinfection, monitoring clinical efficacy provide possibility.

Description

Detect the quadruple PCR kit for fluorescence quantitative of infantile pneumonia three kinds of pathogenic agent
Technical field
The invention belongs to biotechnology, relate to the quadruple PCR kit for fluorescence quantitative detecting infantile pneumonia three kinds of pathogenic agent, particularly relate to and detect mycoplasma pneumoniae, human cytomegalic inclusion disease virus, Epstein-Barr virus quadruple PCR kit for fluorescence quantitative, specifically, the present invention relates to application quadruple Real-Time Fluorescent Quantitative PCR Technique in a PCR reaction tubes fast, abreast simultaneous quantitative detect the test kit of three kinds of pathogenic agent (EBV, MP, HCMV) and internal reference (GAPDH, as Quality Control).
Background technology
The pneumonia that acute respiratory infection (ARI) causes is Common Pediatric Diseases, frequently-occurring disease.In recent years along with various antibiotic widespread use, respiratory tract bacterial infection decreases, and virus, mycoplasma pneumoniae infection are in rising trend, account for 80%, the health of serious threat children.Research shows, same infant can have the infection of two or more pathogenic agent concurrently, may there is mutual activation between various pathogenic agent, easily cause another kind or multiple pathogens infects after causing a kind of pathogenic infection simultaneously, its precise mechanism waits research.In crowd, MP, EBV, cmv infection are very general.
Epstein-Barr virus is a kind of lymphotropic DNA virus, belongs to Herpesvirus.It is the common a kind of virus infectiones of children that EBV infects, and China's 3-5 years old childhood infection rates reach more than 90%, and morbidity is not by the such environmental effects such as region, season, and route of transmission is mainly mouth-oral instructions and broadcasts.Typical infectious monocytosis can be there is after morbidity, also can occur clinical manifestation or the inapparent infection of other complexity.But find clinically at present, ebv infection can involve each system of whole body, causes disease various.Have scholar even to think, current ebv infection with respiratory tract infection the most common (40.5%), is secondly just infectious monocytosis (17.9%) in children.
Mycoplasma pneumoniae (MP) pneumonia is the common respiratory tract infectious disease of school-ager, and the sickness rate in children is on the rise.MP is a kind of pleuropneumonia sample pathogenic micro-organism between bacterium and virus, and acellular wall, mainly through respiratory infectious.Can cause and to distribute or little popular, have the advantages that onset is anxious, progress is fast, the course of disease is long, at present in pediatric respiratory tract infects, mycoplasma pneumonia more and more comes into one's own, domestic statistics, its sickness rate accounts for 10% one 30%, has bibliographical information to be 50% abroad, popular year can reach 30%, and popular cycle is once popular by within 4 years, once tending to 2-6 years.
Cytomegalovirus pneumonia be by cause congenital of cytomegalovirus (CMV) or the day after tomorrow Acquired Infection occur the disease of the corresponding symptom of pneumonia, sign.CMV belongs to herpetoviridae, double-strand linear DNA virus, once infect body will be in carrier state for a long time, weakened immune system or immature time, virus constantly copies.Cmv infection is widely current in China, and how to fall ill period infant, and primary infection is mostly below 2 years old, and lungs are important target devices of infant's cmv infection.CMV is present in all body fluid (blood, saliva, milk, cervical discharge, urine etc.), propagates by the vertical approach of level one.Current CMV is one of main pathogen becoming infantile pneumonia.
In recent years, the pneumonia sickness rate that above three kinds of pathogenic infections cause increases gradually, and often shows as concurrent infection, its complicated clinical manifestation is various, easy mistaken diagnosis and failing to pinpoint a disease in diagnosis, laboratory examination is the main detection methods being applied to its concurrent infection, and has certain value.Especially mycoplasma pneumoniae merges ebv infection, research shows, it is high that mycoplasma pneumoniae merging ebv infection has extrapulmonary complication incidence, the features such as the damage of liver, cardiac muscle and blood system is serious, two kinds of infected by microbes interact, cause disease to be in progress further, thus it is more obvious that laboratory examination is changed.Therefore clinically to heating, violent cough companion lymphadenectasis, the infant of the infant that routine blood test abnormal lymphocytes increases and severe MP infection and the infant not good to macrolide antibiotics therapeutic response want highly vigilant of MP to infect caused infectious monocytosis, consider the possibility having Epstein-Barr virus polyinfection, carry out many cause of diseases joint-detection early and clarify a diagnosis.The polyinfection heavy for the state of an illness, the course of disease long, clinical protracted course of disease person will note multiple cause of disease.Documents and materials confirm that CMV pneumonia often merges other pathogenic agent polyinfections and extra-pulmonary organs infringement in addition, infect common with concurrent MP.Therefore, simultaneously significant to EBV, MP, HCMV joint-detection fast and accurately.
EBV, MP, HCMV infect that the pneumonia caused is clinical still mainly relies on laboratory examination to its etiological diagnosis.Virus (mycoplasma) cultivates the gold standard that the positive is diagnosis, but in view of its poor growth and carry out from clinical sample separation and Culture quite difficulty (fostering requirement is high, length consuming time), be not suitable for the diagnosis of such pathogenic infection, thus limit it in clinical application.The respiratory tract infection that special virus, variant viral and mycoplasma caused in recent years is being increased, and the state of an illness is special, morbidity serious, mortality ratio increases, infantile pneumonia is also in rising trend, in order to early diagnosis can be carried out to pathogenic agent, use appropriate medicine to treat as soon as possible, use reliable and the clinical diagnosis of sensitivity carries out confirming to be necessary.At present, the clinical PCR method of serum specific antibody detection or target DNA TRAP that adopts detects its infection more.Wherein serum specific antibody detects due to easy to detect, generally adopts at present in many medical institutions, but often has false positive to occur due to the limitation of method, and be non-specificity experiments, Sensitivity Specificity is all poor, and rate of missed diagnosis is higher, and person of modern times does not anticipate.And fluorescent quantitative PCR detection method has that susceptibility is high, high specificity, fast and convenient, accurately and reliably, cost is low, quantitatively can wait plurality of advantages, the first-selected diagnostic method becoming EBV, MP, HCMV in recent years and infect.But, it is more than the unrealized single tube simultaneous quantitative detection of fluorescence quantitative PCR detection of current report that 3 kinds cause pathogenic agent and the internal reference of infantile pneumonia, be difficult to meet clinically to the needs that this three kinds of pathogenic agent detect simultaneously, in order to clinical consideration whether concurrent infection, therefore the method is worth optimizing and improves thus can widespread use clinically.
Fluorescent quantitative PCR technique development is maked rapid progress, and AlleLogicBiosciences company of the U.S. is proposed latest generation fluorescent quantitation probe-AllGlo probe, and it has general T aqMan, all advantages of TaqMan-MGB and MolecularBeacon probe.This research learns detected result by the fluorescence increment detecting AllGlo specific probe, and can detect EBV, MP, HCMV and internal reference in a PCR reaction, sensitivity, specificity and repeatability all reach 97% simultaneously.The multiple real time fluorescence PCR method sensitivity that this institute sets up can reach 10 1copies/Test, reaches as high as 10 8copies/Test.
Summary of the invention
The object of the invention is to overcome the deficiencies in the prior art, a kind of quadruple PCR kit for fluorescence quantitative detecting infantile pneumonia three kinds of pathogenic agent and internal reference is provided, is made up of the positive plasmid standards for quantitation of DNA extraction liquid, quadruple Fluorescence PCR liquid, internal reference solution, 1 negative quality control product, 1 strong positive quality control product, 1 weak positive quality control product, 5 concentration.Wherein quadruple Fluorescence PCR liquid is that four groups of primers, probe and qPCR reaction buffer are (containing Mg 2+), the mixed solution that forms of the composition such as four kinds of nucleotide monomers (dNTPs), HotStartTaqDNA polysaccharases.Negative quality control product is sterilized water for injection.By force, weak positive quality control product is by the positive plasmid sample of EBV, MP, HCMV, GAPDH balanced mix, strong positive quality control product concentration 10 7copies/ μ l, weak positive quality control product concentration 10 3copies/ μ l.5 positive plasmid standards for quantitations are respectively concentration 10 3copies/ μ l, 10 4copies/ μ l, 10 5copies/ μ l, 10 6copies/ μ l, 10 7copies/ μ l by EBV(EB virus), MP(mycoplasma pneumoniae), HCMV(human cytomegalic inclusion disease virus), GAPDH(glyceraldehyde-3-phosphate dehydrogenase, Glyceraldehyde3-phosphatedehydrogenase) balanced mix Plasmid samples.Internal reference solution is GAPDH Plasmid samples.
Described primer and specific quantification PCR fluorescent probe sequence as follows:
EBV：
Upstream primer: GCTACGCCTTCCAGAATGAC
Downstream primer: TAGAGGCCTAGGTCCACAGT
Probe: MAR-CGCCCTACACTAGCCTGCTGGAG-MAR
MP：
Upstream primer: AAGCAGTTTGTGGAGAATCAGC
Downstream primer: AGACGAGGTGGTCTTGGACA
Probe: URA-AGCCAGCTTACCTCATCGCCGG-URA
HCMV：
Upstream primer: GCTCACGGTCCGCTATGT
Downstream primer: GCAGGATGATGCGAGAACG
Probe: NEP-CTCGACGTGTACTGCTGCCGCC-NEP
GAPDH：
Upstream primer: AACGGGAAACTCACTGGCAT
Downstream primer: ACAGTGGTTGTTGAGGGCAA
Probe: JUP-GTGTCCCCACTGCCAATGTGTCAGTCG-JUP
MAR, URA, NEP, JUP are four kinds of different fluoresceins of AllGlo probe,
EBV standard substance sequence:
GCTACGCCTTCCAGAATGACAAGCTGTTGCTCCAGCAGGCTAGTGTAGGGCGGCTCACCTTGGTCAACAAGACCACCATCCTGCTGCGCCCGATGAAGACCACAACTGTGGACCTAGGCCTCTA
MP standard substance sequence:
AAGCAGTTTGTGGAGAATCAGCTTGGTTTTAAAGATGACTCAAATTCTTCCTTGACAAACTTCAAGAGTCAAGGCTTAACTCAGCCAGCTTACCTCATCGCCGGCCTTGACGTTGTCCAAGACCACCTCGTCT
HCMV standard substance sequence:
GCTCACGGTCCGCTATGTCCGCTCGTGTTCCAGGGTTGGGCGTACGCCGTGTACCACCAAGGCGACATGGTCCTCATGACGCTCGACGTGTACTGCTGCCGCCAGACCTCCAGCAACACCGTCGTCGCGTTCTCGCATCATCCTGC
GAPDH standard substance sequence:
AACGGGAAACTCACTGGCATGGCCTTCTGTGTCCCCACTGCCAATGTGTCAGTCGTGGACCTGATCTACCATCTGGAAAAACCTACCAAATATCATGGCATCAAGAAGGTGGTGAAGGAGGCATCAGAGGGCTCCCTCTAGGGCATCCTGGGCTACAACACCGAGCACCAGGTTGTCTCCTTCGACTTCAACAGCGACATCCATTCTTCCACCTTTGATGTTGGGGCTGGCATTGCCCTCAACAACCACTGT252。
Mycoplasma pneumoniae of the present invention, human cytomegalic inclusion disease virus, Epstein-Barr virus quadruple quantitative fluorescent PCR associating kit test method following steps:
(1) design of primers: retrieval obtains Epstein-Barr virus, mycoplasma pneumoniae, human cytomegalic inclusion disease virus and internal reference in gene pool, the i.e. specific conservative gene of EBV, MP, HCMV, GAPDH, by online sequence alignment, determine the highly conserved sequence district of EBV, MP, HCMV, GAPDH, as target gene specific nucleotide sequence design special primer to be checked;
(2) fluorescent probe design: the target gene specific nucleotide sequence to be checked according to three kinds of pathogenic agent in step (1) and internal reference designs fluorescent probe;
(3) structure of standard molecule: the special primer determined according to step (1), utilizes gene clone technology to build four kinds of standard plasmid molecules respectively containing EBV, MP, HCMV, GAPDH highly conserved sequence district;
(4) quadruple Fluorescence PCR liquid composition: use the primer in step (1) and the probe in step (2) and qPCR reaction buffer (containing Mg 2+), the composition such as four kinds of nucleotide monomers (dNTPs), HotStartTaqDNA polysaccharases forms quadruple Fluorescence PCR liquid;
(5) optimization of quadruple Fluorescence PCR and foundation: by the primer of each concentration within the scope of 100-400nM and the combination of probe, form different quadruple quantitative fluorescent PCR reaction systems, determine final PCR reaction system according to reaction efficiency and curve;
(6) typical curve preparation: use the quadruple Fluorescence PCR system in step (5), by the continuous 10 times of doubling dilutions of recombinant plasmid containing EBV, MP, HCMV, GAPDH object amplified fragments of known copy number, join in quantitative fluorescent PCR main reaction liquid, every data that composite analyser provides, set rational threshold value (Threshold) and baseline (Baseline), carry out interpretation of result, preparation standard curve;
(7) clinical samples detects: with the clinical samples pathogenic agent DNA extraction liquid of known EBV, MP, HCMV tri-kinds of pathogenic agent and gene carrying capacity as template, use the method for step (5) and (6) and condition to carry out quadruple fluorescent quantitative PCR further;
Described specific conservative gene, refers to the adventitia glycoprotein gene of EBV, the ORF6 gene of MP, the GAPDHP72 gene on the HAN22 gene of HCMV and the people of GAPDH No. 6 karyomit(e)s;
Described specificity fluorescent quantification PCR primer, refers to the oligonucleotide chain that length is 20 ± 3Nt, identical or complementary with mycoplasma pneumoniae, human cytomegalic inclusion disease virus, Epstein-Barr virus and internal reference target gene specific to be checked nucleotide sequence;
Described specificity fluorescent quantitative PCR fluorescent probe, refer to the oligonucleotide chain that length is 24 ± 3Nt, identical or complementary with mycoplasma pneumoniae, human cytomegalic inclusion disease virus, Epstein-Barr virus and internal reference target gene specific to be checked nucleotide sequence, 5 ' end of all probes and 3 ' end all use AllGlo probe mark, often kind of dyestuff of AllGlo probe is reporter group and essence is gone out group;
Described test kit comprises following composition: 1. DNA extraction liquid; 2. quality control product (feminine gender, strong positive, the weak positive) and positive plasmid standards for quantitation; 3. internal reference solution; 4. quadruple Fluorescence PCR liquid.
Step (1), primer described in (2) and specific quantification PCR fluorescent probe sequence thereof are as follows:
EBV：
Upstream primer: GCTACGCCTTCCAGAATGAC
Downstream primer: TAGAGGCCTAGGTCCACAGT
Probe: MAR-CGCCCTACACTAGCCTGCTGGAG-MAR
MP：
Upstream primer: AAGCAGTTTGTGGAGAATCAGC
Downstream primer: AGACGAGGTGGTCTTGGACA
Probe: URA-AGCCAGCTTACCTCATCGCCGG-URA
HCMV：
Upstream primer: GCTCACGGTCCGCTATGT
Downstream primer: GCAGGATGATGCGAGAACG
Probe: NEP-CTCGACGTGTACTGCTGCCGCC-NEP
GAPDH：
Upstream primer: AACGGGAAACTCACTGGCAT
Downstream primer: ACAGTGGTTGTTGAGGGCAA
Probe: JUP-GTGTCCCCACTGCCAATGTGTCAGTCG-JUP
MAR, URA, NEP, JUP are four kinds of different fluoresceins of AllGlo probe,
EBV standard substance sequence:
GCTACGCCTTCCAGAATGACAAGCTGTTGCTCCAGCAGGCTAGTGTAGGGCGGCTCACCTTGGTCAACAAGACCACCATCCTGCTGCGCCCGATGAAGACCACAACTGTGGACCTAGGCCTCTA
MP standard substance sequence:
AAGCAGTTTGTGGAGAATCAGCTTGGTTTTAAAGATGACTCAAATTCTTCCTTGACAAACTTCAAGAGTCAAGGCTTAACTCAGCCAGCTTACCTCATCGCCGGCCTTGACGTTGTCCAAGACCACCTCGTCT
HCMV standard substance sequence:
GCTCACGGTCCGCTATGTCCGCTCGTGTTCCAGGGTTGGGCGTACGCCGTGTACCACCAAGGCGACATGGTCCTCATGACGCTCGACGTGTACTGCTGCCGCCAGACCTCCAGCAACACCGTCGTCGCGTTCTCGCATCATCCTGC
GAPDH standard substance sequence:
AACGGGAAACTCACTGGCATGGCCTTCTGTGTCCCCACTGCCAATGTGTCAGTCGTGGACCTGATCTACCATCTGGAAAAACCTACCAAATATCATGGCATCAAGAAGGTGGTGAAGGAGGCATCAGAGGGCTCCCTCTAGGGCATCCTGGGCTACAACACCGAGCACCAGGTTGTCTCCTTCGACTTCAACAGCGACATCCATTCTTCCACCTTTGATGTTGGGGCTGGCATTGCCCTCAACAACCACTGT252。
Described target gene specific nucleotide sequence to be checked, refers to for a fragment gene sequence specific to each pathogenic agent and reference gene.
Described quadruple quantitative fluorescent PCR reaction system, refers to by four groups of primers, probe and qPCR reaction buffer (containing Mg 2+), the mixed solution that forms of the composition such as four kinds of nucleotide monomers (dNTPs), HotStartTaqDNA polysaccharases.
Described standard molecule, refers to the artificial recombination plasmid utilizing gene clone technology to build, and often kind of plasmid is only recombinated a kind of special target-gene sequence to be checked.
Described quadruple quantitative fluorescent PCR reaction normal curve, refers to different extent of dilution standard plasmid molecule quadruple fluorescence quantitative PCR reaction solution and carries out detection gained, the r of typical curve 2all be greater than 0.99, amplification efficiency, between 1.02-1.06, meets the requirement of quantitative fluorescent PCR typical curve.
The present invention is according to mycoplasma pneumoniae, human cytomegalic inclusion disease virus, the conservative gene of Epstein-Barr virus and internal reference specific gene, log in GeneBank and obtain correlated series, application Clustalw software is to all sequences compare of analysis, select the most conservative gene order PrimerPremiers5.0 software design primer, log in NCBI by blast program compare of analysis, three kinds of pathogenic agent and internal reference respectively filter out the strongest primer of a pair specificity and corresponding specific probe, with the standard molecule (EBV of homemade different concns, MP, HCMV, GAPDH target gene plasmid cloning vector) as template, in ABI7500 quantitative real time PCR Instrument, (5 kinds of fluorescence can be detected) simultaneously carry out list, quadruple fluorescent quantitative PCR experiment, optimize quadruple quantitative fluorescent PCR reaction system, determine the sensitivity of the method, specificity, repeatability etc., preparation standard curve, finally detect 25 parts of clinical samples by the method, simultaneously with clinical labororatory substance TaqMan method detected result compare, analyze the reliability of quadruple fluorescence quantifying PCR method.
The present invention a kind ofly clinically commonly causes the early stage of infantile pneumonia three kinds of pathogenic agent, fast, simple and effective quadruple real-time fluorescence quantitative PCR detection method, the pathogenic agent related to and internal reference comprise EBV, MP, HCMV and GAPDH, owing to adopting the fluorescein-labelled probe of AllGlo, its detection sensitivity is improved greatly, reach the pathogenic agent molecule of 10-100 copy, 1 hour is about for the single detection pattern detection time, easy and simple to handle, and specially can carry out large batch of sample analysis detection, more existing substance fluorescent quantitative PCR technique has had very big raising in detection flux, comparatively serum specific antibody detects in detection sensitivity, specificity, quantitatively etc. aspect all improves a lot or improves, to the popular monitoring of the infection and co-infection that cause infantile pneumonia clinical Three Common pathogenic agent, Rapid identification, the aspect tools such as Outcome measure have very great help, its application prospect is had an optimistic view of.
The present invention can easy rapidly in a reaction tubes simultaneously, detect the clinical common infection causing infantile pneumonia three kinds of pathogenic agent rapidly, to early diagnosis and control, the blocking-up contagium of the pneumonia that children with acute respiratory infection causes, reduce EBV, MP, HCMV and to infect and concurrent infection, monitoring clinical efficacy all have very large clinical value.Adopt method provided by the invention, solve existing cause the detection method of infantile pneumonia clinical Three Common pathogenic agent can not detect multiple infection can not many defects such as quantitatively or specificity is poor or cost is high, complex operation, achieve single tube PCR and detect three kinds of pathogenic agent and internal reference simultaneously, and can detection by quantitative, fast simple to operate, highly sensitive, specificity is good, reproducible, result accurately and reliably.
A valuable feature of the present invention is using people's house-keeping gene GAPDH as internal reference, and complete monitoring Detection job comprises sample disposal, nucleic acid extraction and PCR reaction, interpretation of result etc.The present invention adopts AllGlo probe technique, devise four pairs of special primers and corresponding probe, application quadruple fluorescent quantitative PCR technique detects three kinds of pathogenic agent and internal reference simultaneously, and this technology reaction conditions is optimized, establish a kind of method that single tube quadruple quantitative fluorescent PCR based on AllGlo probe technique detects three kinds of pathogenic agent and internal reference simultaneously, be suitable for quick early diagnosis and the control of the pneumonia that children with acute respiratory infection causes, guidance is provided for causing the monitoring of the course of disease of the infection of the clinical Three Common pathogenic agent of infantile pneumonia and concurrent infection and Outcome measure, have a extensive future.
Accompanying drawing explanation
Fig. 1 a is the typical curve amplification figure of Epstein-Barr virus in quadruple quantitative fluorescent PCR.
Fig. 1 b is that (slope is-3.183 to corresponding typical curve, and intercept is 37.781, R 2be 0.998).
Fig. 2 a is the typical curve amplification figure of mycoplasma pneumoniae in quadruple quantitative fluorescent PCR.
Fig. 2 b is that (slope is-3.285 to corresponding typical curve, and intercept is 39.003, R 2be 0.992).
Fig. 3 a is the typical curve amplification figure of human cytomegalic inclusion disease virus in quadruple quantitative fluorescent PCR.
Fig. 3 b is that (slope is-3.236 to corresponding typical curve, and intercept is 38.050, R 2be 0.998).
Fig. 4 a is the typical curve amplification figure of internal reference in quadruple quantitative fluorescent PCR.
Fig. 4 b is that (slope is-3.178 to corresponding typical curve, and intercept is 37.831, R 2be 0.995).
Note: above-mentioned template is EBV, MP, HCMV, internal reference balanced mix plasmid, concentration (Copies/ μ l) is 10 7, 10 6, 10 5, 10 4, 10 3, parallel 3 pipes.(wherein internal reference is 10 in concentration 3copies/ μ l is parallel 2 pipes)
Fig. 5 is the sensitivity experiments amplification figure of Epstein-Barr virus in quadruple quantitative fluorescent PCR.
Fig. 6 is the sensitivity experiments amplification figure of mycoplasma pneumoniae in quadruple quantitative fluorescent PCR.
Fig. 7 is the sensitivity experiments amplification figure of human cytomegalic inclusion disease virus in quadruple quantitative fluorescent PCR.
Fig. 8 is the sensitivity experiments amplification figure of internal reference in quadruple quantitative fluorescent PCR.
Note: above-mentioned template is EBV, MP, HCMV, internal reference balanced mix plasmid, concentration (Copies/ μ l) is 10 8, 10 7, 10 6, 10 5, 10 4, 10 3, 10 2, 10 1, parallel 3 pipes.(wherein internal reference is 10 in concentration 8, 10 3copies/ μ l is parallel 2 pipes)
Fig. 9 is Epstein-Barr virus (EBV), (EBV, MP, HCMV, internal reference balanced mix plasmid template concentration are 10 to mycoplasma pneumoniae (MP), Human cytomegalic inclusion disease virus (HCMV) and the internal reference specificity experiments amplification figure in quadruple quantitative fluorescent PCR 7copies/ μ l, parallel 2 pipes).
Figure 10 is Epstein-Barr virus (EBV), (EBV, MP, HCMV, internal reference balanced mix plasmid template concentration are 10 to mycoplasma pneumoniae (MP), Human cytomegalic inclusion disease virus (HCMV) and the internal reference specificity experiments amplification figure in quadruple quantitative fluorescent PCR 4copies/ μ l, parallel 2 pipes).
Embodiment
The present invention is further described in conjunction with the accompanying drawings and embodiments.
embodiment 1
A kind of quadruple PCR kit for fluorescence quantitative detecting infantile pneumonia three kinds of pathogenic agent and internal reference, be made up of DNA extraction liquid, quadruple Fluorescence PCR liquid, internal reference solution, 1 negative quality control product, 1 strong positive quality control product, 1 weak positive quality control product, 5 positive plasmid standards for quantitations, wherein quadruple Fluorescence PCR liquid is that four groups of primers, probe and qPCR reaction buffer are (containing Mg 2+), the mixed solution that forms of the composition such as four kinds of nucleotide monomers (dNTPs), HotStartTaqDNA polysaccharases.Negative quality control product is sterilized water for injection.By force, weak positive quality control product is by the positive plasmid sample of EBV, MP, HCMV, GAPDH balanced mix, strong positive quality control product concentration 10 7copies/ μ l, weak positive quality control product concentration 10 3copies/ μ l.Positive plasmid standards for quantitation is respectively concentration 10 3copies/ μ l, 10 4copies/ μ l, 10 5copies/ μ l, 10 6copies/ μ l, 10 7copies/ μ l by EBV(EB virus), MP(mycoplasma pneumoniae), HCMV(human cytomegalic inclusion disease virus), GAPDH(glyceraldehyde-3-phosphate dehydrogenase, Glyceraldehyde3-phosphatedehydrogenase) balanced mix Plasmid samples.Internal reference solution is GAPDH Plasmid samples.
Described primer and specific quantification PCR fluorescent probe sequence as follows:
EBV：
Upstream primer: GCTACGCCTTCCAGAATGAC
Downstream primer: TAGAGGCCTAGGTCCACAGT
Probe: MAR-CGCCCTACACTAGCCTGCTGGAG-MAR
MP：
Upstream primer: AAGCAGTTTGTGGAGAATCAGC
Downstream primer: AGACGAGGTGGTCTTGGACA
Probe: URA-AGCCAGCTTACCTCATCGCCGG-URA
HCMV：
Upstream primer: GCTCACGGTCCGCTATGT
Downstream primer: GCAGGATGATGCGAGAACG
Probe: NEP-CTCGACGTGTACTGCTGCCGCC-NEP
GAPDH：
Upstream primer: AACGGGAAACTCACTGGCAT
Downstream primer: ACAGTGGTTGTTGAGGGCAA
Probe: JUP-GTGTCCCCACTGCCAATGTGTCAGTCG-JUP
MAR, URA, NEP, JUP are four kinds of different fluoresceins of AllGlo probe.
Standard substance sequence:
EBV：
GCTACGCCTTCCAGAATGACAAGCTGTTGCTCCAGCAGGCTAGTGTAGGGCGGCTCACCTTGGTCAACAAGACCACCATCCTGCTGCGCCCGATGAAGACCACAACTGTGGACCTAGGCCTCTA
MP：
AAGCAGTTTGTGGAGAATCAGCTTGGTTTTAAAGATGACTCAAATTCTTCCTTGACAAACTTCAAGAGTCAAGGCTTAACTCAGCCAGCTTACCTCATCGCCGGCCTTGACGTTGTCCAAGACCACCTCGTCT
HCMV：
GCTCACGGTCCGCTATGTCCGCTCGTGTTCCAGGGTTGGGCGTACGCCGTGTACCACCAAGGCGACATGGTCCTCATGACGCTCGACGTGTACTGCTGCCGCCAGACCTCCAGCAACACCGTCGTCGCGTTCTCGCATCATCCTGC
GAPDH standard substance sequence:
AACGGGAAACTCACTGGCATGGCCTTCTGTGTCCCCACTGCCAATGTGTCAGTCGTGGACCTGATCTACCATCTGGAAAAACCTACCAAATATCATGGCATCAAGAAGGTGGTGAAGGAGGCATCAGAGGGCTCCCTCTAGGGCATCCTGGGCTACAACACCGAGCACCAGGTTGTCTCCTTCGACTTCAACAGCGACATCCATTCTTCCACCTTTGATGTTGGGGCTGGCATTGCCCTCAACAACCACTGT252。
embodiment 2
Mycoplasma pneumoniae, human cytomegalic inclusion disease virus, Epstein-Barr virus quadruple quantitative fluorescent PCR associated detecting method and test kit thereof comprise the steps:
(1) design of primers: retrieval obtains Epstein-Barr virus, mycoplasma pneumoniae, human cytomegalic inclusion disease virus and internal reference in gene pool, the i.e. specific conservative gene of EBV, MP, HCMV, GAPDH, by online sequence alignment, determine the highly conserved sequence district of EBV, MP, HCMV, GAPDH, as target gene specific nucleotide sequence design special primer to be checked;
(2) fluorescent probe design: the target gene specific nucleotide sequence to be checked according to three kinds of pathogenic agent in step (1) and internal reference designs fluorescent probe;
(3) structure of standard molecule: the special primer determined according to step (1), utilizes gene clone technology to build four kinds of standard plasmid molecules respectively containing EBV, MP, HCMV, GAPDH highly conserved sequence district;
(4) quadruple Fluorescence PCR liquid composition: use the primer in step (1) and the probe in step (2) and qPCR reaction buffer (containing Mg 2+), the composition such as four kinds of nucleotide monomers (dNTPs), HotStartTaqDNA polysaccharases forms quadruple Fluorescence PCR liquid;
(5) optimization of quadruple Fluorescence PCR and foundation: by the primer of each concentration within the scope of 100-400nM and the combination of probe, form different quadruple quantitative fluorescent PCR reaction systems, determine final PCR reaction system according to reaction efficiency and curve;
(6) typical curve preparation: use the quadruple Fluorescence PCR system in step (5), by the continuous 10 times of doubling dilutions of recombinant plasmid containing EBV, MP, HCMV, GAPDH object amplified fragments of known copy number, join in quantitative fluorescent PCR main reaction liquid, every data that composite analyser provides, set rational threshold value (Threshold) and baseline (Baseline), carry out interpretation of result, preparation standard curve;
(7) clinical samples detects: with the clinical samples pathogenic agent DNA extraction liquid of known EBV, MP, HCMV tri-kinds of pathogenic agent and gene carrying capacity as template, use the method for step (5) and (6) and condition to carry out quadruple fluorescent quantitative PCR further;
Described specific conservative gene, refers to the adventitia glycoprotein gene of EBV, the ORF6 gene of MP, the GAPDHP72 gene on the HAN22 gene of HCMV and the people of GAPDH No. 6 karyomit(e)s;
Described specificity fluorescent quantification PCR primer, refers to the oligonucleotide chain that length is 20 ± 3Nt, identical or complementary with mycoplasma pneumoniae, human cytomegalic inclusion disease virus, Epstein-Barr virus and internal reference target gene specific to be checked nucleotide sequence;
Described specificity fluorescent quantitative PCR fluorescent probe, refer to the oligonucleotide chain that length is 24 ± 3Nt, identical or complementary with mycoplasma pneumoniae, human cytomegalic inclusion disease virus, Epstein-Barr virus and internal reference target gene specific to be checked nucleotide sequence, 5 ' end of all probes and 3 ' end all use AllGlo probe mark, often kind of dyestuff of AllGlo probe is reporter group and essence is gone out group;
Described test kit comprises following composition: 1. DNA extraction liquid; 2. quality control product (feminine gender, strong positive, the weak positive) and positive plasmid standards for quantitation; 3. internal reference solution; 4. quadruple Fluorescence PCR liquid.
Step (1), primer described in (2) and specific quantification PCR fluorescent probe sequence thereof and standard substance sequence are with embodiment 1.
Described target gene specific nucleotide sequence to be checked, refers to for a fragment gene sequence specific to each pathogenic agent and reference gene.
Described quadruple quantitative fluorescent PCR reaction system, refers to by four groups of primers, probe and qPCR reaction buffer (containing Mg 2+), the mixed solution that forms of the composition such as four kinds of nucleotide monomers (dNTPs), HotStartTaqDNA polysaccharases.
Described standard molecule, refers to the artificial recombination plasmid utilizing gene clone technology to build, and often kind of plasmid is only recombinated a kind of special target-gene sequence to be checked.
Described quadruple quantitative fluorescent PCR reaction normal curve, refers to different extent of dilution standard plasmid molecule quadruple fluorescence quantitative PCR reaction solution and carries out detection gained, the r of typical curve 2all be greater than 0.99, amplification efficiency, between 1.02-1.06, meets the requirement of quantitative fluorescent PCR typical curve.
embodiment 3
1. the structure of three kinds of pathogenic agent (EBV, MP, HCMV) and internal reference goal gene plasmid cloning vector:
Adopt T-A carrier cloning scheme, four kinds of goal gene PCR primer are confirmed after amplified fragments molecular weight through electrophoresis, amplified fragments reclaims purifying through 2% sepharose, be cloned in pMD-19T plasmid, 16 DEG C connect 30 minutes, product conversion will be connected in competence escherichia coli DH5 α, get and coat LB/Amp/X-Gal/IPTG flat board in right amount, 37 DEG C of overnight incubation, screen positive bacterium colony, be seeded to LB broth culture, 37 DEG C of 220rpm shaking culture are spent the night, through reclaiming, extracting, purifying, recombinant plasmid, and in English fine horse (Shanghai) biotech firm sequence verification, after sequence right-on object plasmid ultraviolet spectrophotometer after BLAST comparison is quantitative, with 1 × TE(pH8.0) damping fluid is diluted to 10 9copy/μ l saves backup as storage liquid ， – 20 DEG C.
2. sample requires:
2.1 are suitable for specimen types: sputum, secretory product swab etc.
2.2 collections of specimens:
2.2.1 sputum: use disposable sputum aspirator, infant is got and is faced upward a horizontal position, and sputum aspirator tube is slowly inserted bottleneck throat, regulate negative pressure, tracheae deep secretory product (effect is better after Neulized inhalation) is slowly sucked in liquid storage bottle, repeatedly for several times, in liquid storage bottle, secretory product is sample, sealing censorship; The secretory product also censorship as early as possible of drawing, in order to avoid drying cannot analytical test.Or patient get up morning after gargle with clear water, do not brush teeth, the fresh sputum of expectoration censorship in special plastic phlegm box of exerting oneself from respiratory tract deep.
2.2.2 secretory product swab: adopt sterile cotton swab, comprise nose, pharyngeal, throat's sample.Patient should gargle by clear water, with spatula by tongue downwardly towards external pressure, sterile cotton swab crosses on rear side of root of the tongue arrival pharynx rear wall or uvula or bottleneck throat is rubescent, the suspicious pseudomembrane position of canescence, repeatedly smears for several times and carefully exits, be placed in the censorship of sterile test tube chock off stopper.
2.3 Saving specimen and transport: sample can immediately for test, also can be stored in-20 DEG C to be measured, preservation period is 6 months.Sample should adopt 0 DEG C of curling stone when transporting.
3.DNA template extraction:
3.1 negative quality control product process: add equivalent DNA extraction liquid and 5 μ l internal reference solution fully mix in negative Quality Control QC, 100 DEG C of constant temperature process 10 minutes, centrifugal 5 minutes of 12000rpm, for subsequent use.
3.2 sample disposal
3.2.1 sputum: the physiological saline adding 4 times of volumes in sputum, repeatedly blows and beats rearmounted 4 DEG C of refrigerator overnight with the rifle head of 1ml, sputum is fully liquefied.With drawing in 1ml to 1.5ml centrifuge tube after rifle head or suction pipe mixing, centrifugal 5 minutes of 12000rpm.Remove supernatant, add 50 μ lDNA extracting solutions in precipitation and 5 μ l internal reference solution fully mix, 100 DEG C of constant temperature process 10 minutes, centrifugal 5 minutes of 12000rpm, for subsequent use.
3.2.2 secretory product swab: add sterile saline 1.5ml to sterile glass tube, fully shake mixing, extract cotton swab, is all transferred to liquid in 1.5ml centrifuge tube immediately, centrifugal 5 minutes of 12000rpm.Remove supernatant, precipitation adds sterile saline 1ml and mixes, centrifugal 5 minutes of 12000rpm.Remove supernatant, add 50 μ lDNA extracting solutions in precipitation and 5 μ l internal reference solution fully mix, 100 DEG C of constant temperature process 10 minutes, centrifugal 5 minutes of 12000rpm, for subsequent use.
3.3EBV, MP, HCMV, GAPDH weak positive quality control product process (with negative quality control product)
3.4EBV, MP, HCMV, GAPDH strong positive quality control product process (with negative quality control product)
The positive plasmid standards for quantitation process of 3.5EBV, MP, HCMV, GAPDH: the 8000rpm centrifugal several seconds, for subsequent use.
Note: DNA extraction liquid---50mmol/LNaOH, 10mmol/LTris-HCl, pH8.0, volume fraction is 1%TritonX-100, and volume fraction is 1%NP-40,0.5mmol/LEDTApH8.0.
4.AllGlo probe quadruple quantitative fluorescent PCR:
4.1 primers and probe
Consult relevant technical literature, EBV, MP, HCMV and internal reference specific conservative gene is obtained according to bibliographical information, log in GeneBank and obtain correlated series, application Clustalw software is to all sequences compare of analysis, select the most conservative gene order PrimerPremiers5.0 software design primer, log in NCBI by blast program compare of analysis, often kind of pathogenic agent and internal reference filter out the strongest primer of a pair specificity and corresponding specific probe (see table 1).
EBV, MP, HCMV and internal reference single tube multiple fluorescence quantitative PCR primer and corresponding AllGlo probe are synthesized by Shanghai Ying Jun Bioisystech Co., Ltd and Hui Rui bio tech ltd, Shanghai respectively.In order to ensure specificity and the sensitivity of multiple fluorescence quantitative PCR, all primers and probe all carry out BLAST with the amplified target sequence in GenBank, and all primers are almost consistent with the Tm value of probe.In order to increase the specificity with corresponding pathogenic agent and internal reference amplified target sequence hybridization, every bar probe and Non-specific hybridization sequence have 9 bases not complementary pairing at least.ABI7500 quantitative real time PCR Instrument (simultaneously can detect 5 kinds of fluorescence) is adopted to carry out multiple fluorescence quantitative PCR experiment.
The latest generation fluorescent quantitation probe that probe adopts AlleLogicBiosciences company of the U.S. to release-
AllGlo probe.
MAR, URA, NEP, JUP are the AllGlo probe mark fluorescein of different wave length.
4.2 substance quantitative fluorescent PCR condition optimizings
Adopt four primed probe ratios to be optimized quantitative fluorescent PCR: 50 μ lPCR reaction systems, [qPCR reaction buffer is (containing Mg to comprise self-control qPCR reaction solution 25 μ l 2+) 20 μ l, 4 kinds of dNTP mixed solution 4 μ l, 10U/ μ lHotStartTaqDNA polysaccharase 1 μ l], 10 4copies/ μ l plasmid template 4 μ l, primer (upstream and downstream) and correspondent probe add 1 μ l, 2 μ l(200nM ﹕ 400nM respectively), 0.5 μ l, 1 μ l(100nM ﹕ 200nM), 1 μ l, 1 μ l(200nM ﹕ 200nM), 1 μ l, 0.5 μ l(200nM ﹕ 100nM), mend to 50 μ l with distilled water, all primed probe application concentration is 10 μMs, often kind of primed probe ratio is all parallel does three pipes, contrasts with sterilized water for injection simultaneously.In the amplification of ABI7500 quantitative real time PCR Instrument, cycling condition: 95 DEG C of 30s, 95 DEG C of 5s, 60 DEG C of 34s(40cycles).The collection of fluorescent signal is decided to be FAM(EB virus), ROX(mycoplasma pneumoniae), CY5(human cytomegalic inclusion disease virus), VIC(internal reference).Real-time analysis computed in software amplification Ct value, with the Ct Data-Statistics experimental result that increases.With primed probe concentration ratio when obtaining minimum Ct value and higher fluorescence intensity increased value for the best.
4.3 quadruple quantitative fluorescent PCR condition optimizings
According to substance quantitative fluorescent PCR condition optimizing experiment acquired results, primed probe concentration ratio is selected to be that 200nM ﹕ 200nM and 200nM ﹕ 100nM two kinds of ratios carry out Quadruple-PCR, PCR reaction system and amplification condition the same, add in same pipe by four kinds of primers and probe, then each pipe adds a kind of 10 respectively 4the plasmid template 4 μ l of Copies/ μ l, negative control adds sterilized water for injection and carries out single goal gene multiplexed PCR amplification, and mend to 50 μ l with distilled water, each reaction is parallel does 3 pipes.In addition, a kind of 10 are added 4the plasmid template 4 μ l that EBV, MP, HCMV of Copies/ μ l and internal reference 1:1:1:1 mix, negative control adds sterilized water for injection and carries out many goal gene multiplexed PCR amplification, and mend to 50 μ l with distilled water, each reaction is parallel does 3 pipes.Using primed probe concentration ratio when obtaining minimum Ct value and higher fluorescence intensity increased value as Quadruple-PCR standard curve making and other final amplification conditions of testing.
The specificity of 4.4 quadruple quantitative fluorescent PCRs, sensitivity test
By the recombinant plasmid containing EBV, MP, HCMV and internal reference object amplified fragments of known copy number, during use continuous 10 times of doubling dilutions to concentration 10 1copies/ μ l ~ 10 8as the standard substance of single-gene multiple fluorescence quantitative PCR between Copies/ μ l; Meanwhile, carry out 10 times of doubling dilutions after EBV, MP, HCMV being mixed with internal reference recombinant plasmid 1:1:1:1 and become 10 1copies/ μ l ~ 10 8between Copies/ μ l, as the standard substance of polygene multiple fluorescence quantitative PCR.Get the template of standard substance 4 μ l as quadruple quantitative fluorescent PCR of different carrying capacity, do control experiment with sterilized water for injection simultaneously, the reaction system of establishing according to step (4.3) each extent of dilution template and amplification condition carry out fluorescent PCR detection simultaneously, all detection samples at least detect three times, the software automatic analysis result that the rear instrument that increased carries, thus determine the minimum detectability of the method, the detection sensitivity of assessment mycoplasma pneumoniae, human cytomegalic inclusion disease virus, Epstein-Barr virus quadruple quantitative fluorescent PCR associated detecting method and test kit thereof.
4.5 quadruple quantitative fluorescent PCR typical curve preparations
By 10 9copies/ μ lEBV, MP, HCMV and internal reference recombinant plasmid balanced mix evenly, are diluted to containing above four kinds of plasmids (Copies/ μ l) 10 3, 10 4, 10 5, 10 6, 10 7as the standard substance of preparation standard curve, the reaction system of establishing according to step (4.3) and amplification condition carry out fluorescent PCR detection simultaneously, and all detection samples at least detect three times, and the rear instrument that increased carries software analysis result, preparation standard curve.
The replica test of 4.6 quadruple quantitative fluorescent PCRs
By EBV, MP, HCMV of known copy number and internal reference recombinant plasmid mixed solution (10 4copies/ μ l) be divided into 10 parts,-20 DEG C of freezen protective are as template, increase by the reaction system of the quadruple quantitative fluorescent PCR of preparation standard curve and amplification condition, simultaneously according to step (4.5) preparation standard curve, detect weekly once, according to the automatic quantitative detected result of typical curve instrument, continuous 5 weeks, last statistical software analyzed the repeatability (CV%) of 5 detected results.
4.7 results judge
4.7.1 analysis condition setting: be with analysis software automatic analysis result according to instrument, threshold setting principle
With threshold line just cover negative controls amplification line and instrument noise adjust.
4.7.2 quality control standard: negative quality control product without amplification curve and Ct value, has increased logarithmic phase at VIC sense channel amplification curve at FAM, ROX, CY5 sense channel; Positive qualitative reference product are the positive, Ct value≤37, and 0.97≤| r|≤1; Positive quality control product total positives, Ct value should be corresponding with the Ct value of the respective standard product of typical curve, and occur typical amplification curve, if strong positive quality control product qualitative reference value is 10 6~ 10 8copies/ μ l scope, weak positive quality control product qualitative reference value is 10 3~ 10 5copies/ μ l scope; Above requirement need meet with in once experiment simultaneously, otherwise experiment is considered as invalid, need re-start.
4.7.3 result describes and judges
A. negative: to equal 40 at FAM, ROX, CY5 sense channel amplification curve without obvious increased logarithmic phase or Ct value, have increased logarithmic phase at VIC sense channel amplification curve.
B. positive and rational judgment: occur typical amplification curve and Ct value≤37 are judged to be the positive at FAM, ROX, CY5 sense channel, and according to typical curve automatic acquisition quantitative values, there is EBV, MP, HCMV pathogenic agent particle in expression sample.
C. effective principle: the sample amounts result of Ct value >37 is unreliable, experiment of need reforming.Be negative without Ct value, have Ct value but still this check of label taking again of >37 need.
4.8 embodiment 2 detected result
4.8.1 quadruple quantitative fluorescent PCR condition optimizing result: EBV, MP, HCMV and internal reference standard molecule (10 4copies/ μ l) increase in quadruple quantitative fluorescent PCR system after, when primed probe ratio is (nM)) 200:200 time, the Ct value of EBV, MP, HCMV, internal reference is respectively 25-26,25-26,25-26,24-26; When primed probe ratio is (nM) 200:100, the Ct value of EBV, MP, HCMV, internal reference is respectively 24-25,25-26,24-25,25-26.
4.8.2 specificity, the sensitivity test result of quadruple quantitative fluorescent PCR: after EBV, MP, HCMV and internal reference standard molecule increase in quadruple quantitative fluorescent PCR system, its specificity is 100%(and sees accompanying drawing 9,10).EBV, MP, HCMV and internal reference detection sensitivity in quadruple quantitative fluorescent PCR system is 10 1copies/ μ l(is shown in accompanying drawing 5-8).
4.8.3 quadruple quantitative fluorescent PCR typical curve prepares result: the typical curve of EBV, MP, HCMV and internal reference standard molecule is prepared in the quadruple quantitative fluorescent PCR reaction system through optimizing, the r of their typical curve 2be respectively 0.998,0.992,0.998,0.995, amplification efficiency (Efficiency) be respectively 1.06,1.02,1.04,1.06(is shown in accompanying drawing 1-4).
4.8.4 the replica test result of quadruple quantitative fluorescent PCR: identical EBV, MP, HCMV and internal reference standard molecule mixed solution (10 4copies/ μ l) detect 5 times in quadruple quantitative fluorescent PCR system, detect data after Logarithm conversion, the CV that EBV, MP, HCMV and internal reference detect for 5 times is all less than 3%, refers to table 2.
embodiment 4
1. clinical samples detects
1.1 test kits detect
Get 25 parts of positive clinical and negative (EBV, MP, HCMV) sample.If this part of sample only has a kind of positive pathogen, then every part of DNA extraction sample mean is divided into 3 parts, 1 part of sample AllGlo probe substance quantitative fluorescent PCR detects EBV, MP, HCMV respectively, and 1 part of sample AllGlo probe multiple fluorescence quantitative PCR single tube detects EBV, MP, HCMV simultaneously; If this part of sample is clinical two or three positive pathogen mixture, then every part of DNA extraction sample mean is divided into 2 parts, 1 part of sample AllGlo probe multiple fluorescence quantitative PCR single tube detects EBV, MP, HCMV simultaneously, and remaining sample puts-70 DEG C of freezen protective (in order to checking use if desired).The specificity of further checking quadruple fluorescence quantifying PCR method.In each detection experiment, adopt the DNA profiling of same pipe equivalent, parallel two pipes, only have when all parallel test results are consistent, just determine the detected result of this part of DNA sample, otherwise need re-start detection.
1.2 existing diagnostic reagents detect:
Above-mentioned sample and clinical at present EBV, MP, HCMVTaqMan Single probe substance quantitative fluorescent PCR (reaching dutiful sub-diagnostic companies) technology for detection result compare (table 3).
1.3 clinical samples detected results: 25 parts of clinical samples adopt three kinds of methods to detect, and it the results are shown in Table 3.
<110> No.1 People's Hospital, Hangzhou City
<120> detects the quadruple PCR kit for fluorescence quantitative of infantile pneumonia three kinds of pathogenic agent
<160>16
<210>1
<211>20
<212>DNA
<213> artificial sequence
<220>
The PCR that <223> designs according to Epstein-Barr virus (EBV) adventitia glycoprotein gene detects upstream primer sequence
<400>1
GCTACGCCTTCCAGAATGAC20
<210>2
<211>20
<212>DNA
<213> artificial sequence
<220>
The PCR that <223> designs according to Epstein-Barr virus (EBV) adventitia glycoprotein gene detects downstream primer sequence
<400>2
TAGAGGCCTAGGTCCACAGT20
<210>3
<211>23
<212>DNA
<213> artificial sequence
<220>
The AllGlo fluorescent quantitation detection probes sequence that <223> designs according to Epstein-Barr virus (EBV) adventitia glycoprotein gene
<400>3
CGCCCTACACTAGCCTGCTGGAG23
<210>4
<211>124
<212>DNA
<213> artificial sequence
<220>
The fluorescent quantitation examination criteria product sequence that <223> designs according to Epstein-Barr virus (EBV) adventitia glycoprotein gene
<400>4
GCTACGCCTTCCAGAATGACAAGCTGTTGCTCCAGCAGGCTAGTGTAGGGCGGCTCACCTTGGTCAACAAGACCACCATCCTGCTGCGCCCGATGAAGACCACAACTGTGGACCTAGGCCTCTA124
<210>5
<211>22
<212>DNA
<213> artificial sequence
<220>
<223> detects upstream primer sequence according to the PCR of mycoplasma pneumoniae (MP) ORF6 gene design
<400>5
AAGCAGTTTGTGGAGAATCAGC22
<210>6
<211>20
<212>DNA
<213> artificial sequence
<220>
<223> detects downstream primer sequence according to the PCR of mycoplasma pneumoniae (MP) ORF6 gene design
<400>6
AGACGAGGTGGTCTTGGACA20
<210>7
<211>22
<212>DNA
<213> artificial sequence
<220>
<223> is according to the AllGlo fluorescent quantitation detection probes sequence of mycoplasma pneumoniae (MP) ORF6 gene design
<400>7
AGCCAGCTTACCTCATCGCCGG22
<210>8
<211>133
<212>DNA
<213> artificial sequence
<220>
<223> is according to the fluorescent quantitation examination criteria product sequence of mycoplasma pneumoniae (MP) ORF6 gene design
<400>8
AAGCAGTTTGTGGAGAATCAGCTTGGTTTTAAAGATGACTCAAATTCTTCCTTGACAAACTTCAAGAGTCAAGGCTTAACTCAGCCAGCTTACCTCATCGCCGGCCTTGACGTTGTCCAAGACCACCTCGTCT133
<210>9
<211>18
<212>DNA
<213> artificial sequence
<220>
<223> detects upstream primer sequence according to the PCR of Human cytomegalic inclusion disease virus (HCMV) HAN22 gene design
<400>9
GCTCACGGTCCGCTATGT18
<210>10
<211>19
<212>DNA
<213> artificial sequence
<220>
<223> detects downstream primer sequence according to the PCR of Human cytomegalic inclusion disease virus (HCMV) HAN22 gene design
<400>10
GCAGGATGATGCGAGAACG19
<210>11
<211>22
<212>DNA
<213> artificial sequence
<220>
<223> is according to the AllGlo fluorescent quantitation detection probes sequence of Human cytomegalic inclusion disease virus (HCMV) HAN22 gene design
<400>11
CTCGACGTGTACTGCTGCCGCC22
<210>12
<211>146
<212>DNA
<213> artificial sequence
<220>
<223> is according to the fluorescent quantitation examination criteria product sequence of Human cytomegalic inclusion disease virus (HCMV) HAN22 gene design
<400>12
GCTCACGGTCCGCTATGTCCGCTCGTGTTCCAGGGTTGGGCGTACGCCGTGTACCACCAAGGCGACATGGTCCTCATGACGCTCGACGTGTACTGCTGCCGCCAGACCTCCAGCAACACCGTCGTCGCGTTCTCGCATCATCCTGC146
<210>13
<211>20
<212>DNA
<213> artificial sequence
<220>
<223> detects upstream primer sequence according to the PCR of the GAPDHP72 gene design on internal reference (GAPDH) people No. 6 karyomit(e)s
<400>13
AACGGGAAACTCACTGGCAT20
<210>14
<211>20
<212>DNA
<213> artificial sequence
<220>
<223> detects downstream primer sequence according to the PCR of the GAPDHP72 gene design on internal reference (GAPDH) people No. 6 karyomit(e)s
<400>14
ACAGTGGTTGTTGAGGGCAA20
<210>15
<211>27
<212>DNA
<213> artificial sequence
<220>
<223> is according to the AllGlo fluorescent quantitation detection probes sequence of the GAPDHP72 gene design on internal reference (GAPDH) people No. 6 karyomit(e)s
<400>15
GTGTCCCCACTGCCAATGTGTCAGTCG27
<210>16
<211>252
<212>DNA
<213> artificial sequence
<220>
<223> is according to the fluorescent quantitation examination criteria product sequence of the GAPDHP72 gene design on internal reference (GAPDH) people No. 6 karyomit(e)s
<400>16
AACGGGAAACTCACTGGCATGGCCTTCTGTGTCCCCACTGCCAATGTGTCAGTCGTGGACCTGATCTACCATCTGGAAAAACCTACCAAATATCATGGCATCAAGAAGGTGGTGAAGGAGGCATCAGAGGGCTCCCTCTAGGGCATCCTGGGCTACAACACCGAGCACCAGGTTGTCTCCTTCGACTTCAACAGCGACATCCATTCTTCCACCTTTGATGTTGGGGCTGGCATTGCCCTCAACAACCACTGT252

Claims (2)

1. one kind is detected the quadruple PCR kit for fluorescence quantitative of infantile pneumonia three kinds of pathogenic agent, this test kit is made up of the positive plasmid standards for quantitation of DNA extraction liquid, quadruple Fluorescence PCR liquid, internal reference solution, negative quality control product, strong positive quality control product, weak positive quality control product, five concentration, it is characterized in that, wherein quadruple Fluorescence PCR liquid is four groups of primers, probe and containing Mg 2+the mixed solution that forms of qPCR reaction buffer, four kinds of nucleotide monomers, HotStartTaqDNA polysaccharase, negative quality control product is sterilized water for injection, by force, weak positive quality control product is the positive plasmid sample of EBV, MP, HCMV, GAPDH balanced mix, five positive plasmid standards for quantitations of concentration are that concentration is respectively 10 by the Plasmid samples of lEBV, MP, HCMV, GAPDH balanced mix 3copies/ μ l, 10 4copies/ μ l, 10 5copies/ μ l, 10 6copies/ μ l, 10 7copies/ μ l, internal reference solution is GAPDH Plasmid samples,
Described primer and specific quantification PCR fluorescent probe sequence as follows:
EBV：
Upstream primer: GCTACGCCTTCCAGAATGAC
Downstream primer: TAGAGGCCTAGGTCCACAGT
Probe: MAR-CGCCCTACACTAGCCTGCTGGAG-MAR
MP：
Upstream primer: AAGCAGTTTGTGGAGAATCAGC
Downstream primer: AGACGAGGTGGTCTTGGACA
Probe: URA-AGCCAGCTTACCTCATCGCCGG-URA
HCMV：
Upstream primer: GCTCACGGTCCGCTATGT
Downstream primer: GCAGGATGATGCGAGAACG
Probe: NEP-CTCGACGTGTACTGCTGCCGCC-NEP
GAPDH：
Upstream primer: AACGGGAAACTCACTGGCAT
Downstream primer: ACAGTGGTTGTTGAGGGCAA
Probe: JUP-GTGTCCCCACTGCCAATGTGTCAGTCG-JUP
MAR, URA, NEP, JUP are four kinds of different fluoresceins of AllGlo probe
EBV standard substance sequence:
GCTACGCCTTCCAGAATGACAAGCTGTTGCTCCAGCAGGCTAGTGTAGGGCGGCTCACCTTGGTCAACAAGACCACCATCCTGCTGCGCCCGATGAAGACCACAACTGTGGACCTAGGCCTCTA
MP standard substance sequence:
AAGCAGTTTGTGGAGAATCAGCTTGGTTTTAAAGATGACTCAAATTCTTCCTTGACAAACTTCAAGAGTCAAGGCTTAACTCAGCCAGCTTACCTCATCGCCGGCCTTGACGTTGTCCAAGACCACCTCGTCT
HCMV standard substance sequence:
GCTCACGGTCCGCTATGTCCGCTCGTGTTCCAGGGTTGGGCGTACGCCGTGTACCACCAAGGCGACATGGTCCTCATGACGCTCGACGTGTACTGCTGCCGCCAGACCTCCAGCAACACCGTCGTCGCGTTCTCGCATCATCCTGC
GAPDH standard substance sequence:
AACGGGAAACTCACTGGCATGGCCTTCTGTGTCCCCACTGCCAATGTGTCAGTCGTGGACCTGATCTACCATCTGGAAAAACCTACCAAATATCATGGCATCAAGAAGGTGGTGAAGGAGGCATCAGAGGGCTCCCTCTAGGGCATCCTGGGCTACAACACCGAGCACCAGGTTGTCTCCTTCGACTTCAACAGCGACATCCATTCTTCCACCTTTGATGTTGGGGCTGGCATTGCCCTCAACAACCACTGT；
Wherein strong positive quality control product concentration 10 7copies/ μ l, weak positive quality control product concentration 10 3copies/ μ l.
2. a kind of quadruple PCR kit for fluorescence quantitative detecting infantile pneumonia three kinds of pathogenic agent according to claim 1, it is characterized in that, described test kit is stored in-20 DEG C.
CN201410436112.1A 2014-08-30 2014-08-30 Detect the quadruple PCR kit for fluorescence quantitative of infantile pneumonia three kinds of pathogenic agent Active CN104195266B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201410436112.1A CN104195266B (en) 2014-08-30 2014-08-30 Detect the quadruple PCR kit for fluorescence quantitative of infantile pneumonia three kinds of pathogenic agent

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201410436112.1A CN104195266B (en) 2014-08-30 2014-08-30 Detect the quadruple PCR kit for fluorescence quantitative of infantile pneumonia three kinds of pathogenic agent

Publications (2)

Publication Number Publication Date
CN104195266A CN104195266A (en) 2014-12-10
CN104195266B true CN104195266B (en) 2016-03-23

Family

ID=52080628

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201410436112.1A Active CN104195266B (en) 2014-08-30 2014-08-30 Detect the quadruple PCR kit for fluorescence quantitative of infantile pneumonia three kinds of pathogenic agent

Country Status (1)

Country Link
CN (1) CN104195266B (en)

Families Citing this family (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105063218B (en) * 2015-08-20 2018-06-29 杭州市第一人民医院 The multiple quantitative PCR reagent kit of the difficult culture identification bacterium of four kinds of fast joint inspection
CN105936944B (en) * 2016-04-22 2019-12-20 浙江省检验检疫科学技术研究院 Triple fluorescent RT-PCR detection kit, primer and probe for CSFV, PRRSV and SIV H1 subtypes
CN105950785B (en) * 2016-05-20 2020-01-14 浙江省检验检疫科学技术研究院 Triple fluorescence RT-PCR detection kit, primer and probe for avian influenza virus, newcastle disease virus and infectious bronchitis virus
CN106399469A (en) * 2016-06-15 2017-02-15 武汉市农业科学技术研究院畜牧兽医科学研究所 Dairy cow early-gestation diagnosis primer pairs, probes and method based on duplex quantitative PCR
CN105936945B (en) * 2016-06-20 2019-08-06 杭州市第一人民医院 A kind of multiple reverse transcription quantitative PCR kit of four kinds of Respirovirus of joint inspection
CN110241256B (en) * 2019-05-27 2023-07-07 江苏达伯药业有限公司 Kit for multiplex quantitative detection of EB virus and cytomegalovirus
CN114292958A (en) * 2021-12-28 2022-04-08 无锡科智达科技有限公司 Respiratory tract pathogen multi-connection detection kit and application thereof

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103642945A (en) * 2013-12-30 2014-03-19 上海星耀医学科技发展有限公司 Reference-containing high-sensitivity fluorescent quantitative polymerase chain reaction (PCR) kit for Epstein-Barr virus

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103642945A (en) * 2013-12-30 2014-03-19 上海星耀医学科技发展有限公司 Reference-containing high-sensitivity fluorescent quantitative polymerase chain reaction (PCR) kit for Epstein-Barr virus

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
Detection of the four major human herpesviruses simultaneously in whole blood and cerebrospinal fluid samples by the fluorescence polarization assay;Wu Zhongliang et al;《International Journal of Infectious Diseases》;20101031;第14卷(第10期);第e893-e897页 *
Epidemiology of Epstein-Barr Virus,Cytomegalovirus, and Kaposi"s Sarcoma-Associated Herpesvirus Infections in Peripheral Blood Leukocytes Revealed by a Multiplex PCR Assay;Morie Nishiwaki et al;《Journal of Medical Virology》;20061130;第78卷(第12期);第1635-1642页 *
城市与农村小儿肺炎中医证型及病原体的临床特点;吴士明;《中国优秀硕士学位论文全文数据库》;20091115;第E056-775页 *
浅析小儿肺炎的病原体及有诊断意义的辅助检查和病因治疗;张大鹏;《中国卫生产业》;20131231(第6期);第114页 *

Also Published As

Publication number Publication date
CN104195266A (en) 2014-12-10

Similar Documents

Publication Publication Date Title
CN104195266B (en) Detect the quadruple PCR kit for fluorescence quantitative of infantile pneumonia three kinds of pathogenic agent
CN110791590B (en) Dual real-time fluorescence detection primer probe set, kit and method for genes VP72 and CD2V of African swine fever virus
CN109487013B (en) Herpes simplex virus type I and type II detection marker, primer probe pair, kit and detection method
CN103484565B (en) The test kit of a kind of real-time fluorescence RT-PCR detection coronavirus and application thereof
CN101709335B (en) Quadruple fluorescence quantitive PCR typing detection method for common human papillomavirus
CN105063218B (en) The multiple quantitative PCR reagent kit of the difficult culture identification bacterium of four kinds of fast joint inspection
CN110699489B (en) Real-time fluorescence PCR detection primer probe set, kit and method for African swine fever virus CD2V gene
CN103131798A (en) Norovirus real-time fluorescent RT-PCR detection kit and application thereof
CN101550455B (en) Human parainfluenza virus distinguishing and quantitative detection regent kit
CN104131006A (en) Rapid detection kit for human adenoviruses
CN101760560A (en) Fluorescent PCR detection method for human cytomegalovirus (HCMV)
CN105543414A (en) Respiratory syncytial virus A/B subtype multiplex fluorescence quantitative PCR detection primer set and probe set and reagent kit and preparation method thereof
CN107475389B (en) Primer group, kit and method for detecting mycoplasma pneumoniae
CN113846191B (en) Primer and probe for detecting novel coronavirus and application of primer and probe
CN108411014A (en) Differentiate the primer and probe and detection method of A types and the dual real-time fluorescence quantitative PCR of Type B ox pasteurella multocida
CN104946753A (en) Specificity primer pair for cow mycoplasma detection, detection kit, as well as using method and application of detection kit
CN101580883B (en) Respiratory syncytial virus real-time fluorescence PCR detection kit
CN103131797B (en) A kind of bocavirus real-time fluorescence PCR detection reagent kit and application thereof
CN105671209A (en) Primers, probe, kit and method for detecting bovine coronavirus
CN110241184A (en) A kind of RPA kit and application thereof of quick detection riemerella anatipestifer
CN105316428A (en) Method for detecting human cytomegalovirns PP65 genes and kit
CN103114154A (en) Rhinovirus real-time fluorescent RT-PCR (reverse transcription-polymerase chain reaction) detection kit and application thereof
CN103757137A (en) Common primer nucleic acid amplification method for detecting three pig viruses synchronously and kit
CN107699638A (en) A kind of method for detecting feline calicivirus
CN110157836B (en) Primer, probe and method for detecting IBRV and BVDV

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant