CN110387434A - For detecting the primer sets and kit of herpes-like virus EBV - Google Patents
For detecting the primer sets and kit of herpes-like virus EBV Download PDFInfo
- Publication number
- CN110387434A CN110387434A CN201810336564.0A CN201810336564A CN110387434A CN 110387434 A CN110387434 A CN 110387434A CN 201810336564 A CN201810336564 A CN 201810336564A CN 110387434 A CN110387434 A CN 110387434A
- Authority
- CN
- China
- Prior art keywords
- ebv
- kit
- herpes
- detecting
- primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 241000700605 Viruses Species 0.000 title claims abstract description 39
- 239000000523 sample Substances 0.000 claims abstract description 49
- 238000001514 detection method Methods 0.000 claims abstract description 23
- 238000006243 chemical reaction Methods 0.000 claims abstract description 19
- 239000013642 negative control Substances 0.000 claims abstract description 12
- 239000013558 reference substance Substances 0.000 claims abstract description 12
- 239000000203 mixture Substances 0.000 claims abstract description 10
- 230000002255 enzymatic effect Effects 0.000 claims abstract description 9
- 239000000243 solution Substances 0.000 claims description 12
- 239000002773 nucleotide Substances 0.000 claims description 11
- 125000003729 nucleotide group Chemical group 0.000 claims description 11
- 238000011144 upstream manufacturing Methods 0.000 claims description 10
- 108090000790 Enzymes Proteins 0.000 claims description 6
- 102000004190 Enzymes Human genes 0.000 claims description 6
- 239000012634 fragment Substances 0.000 claims description 6
- 239000013612 plasmid Substances 0.000 claims description 5
- 239000002504 physiological saline solution Substances 0.000 claims description 4
- 230000002068 genetic effect Effects 0.000 claims description 3
- 239000007788 liquid Substances 0.000 claims description 3
- 238000002360 preparation method Methods 0.000 claims description 3
- 230000035945 sensitivity Effects 0.000 abstract description 7
- 230000008901 benefit Effects 0.000 abstract description 5
- 108090000623 proteins and genes Proteins 0.000 abstract description 3
- 230000003321 amplification Effects 0.000 description 13
- 238000003199 nucleic acid amplification method Methods 0.000 description 13
- 238000000034 method Methods 0.000 description 10
- 238000012408 PCR amplification Methods 0.000 description 9
- 238000012360 testing method Methods 0.000 description 8
- 238000003745 diagnosis Methods 0.000 description 7
- 206010015108 Epstein-Barr virus infection Diseases 0.000 description 6
- 239000000047 product Substances 0.000 description 5
- 201000010099 disease Diseases 0.000 description 4
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 description 4
- 230000014509 gene expression Effects 0.000 description 4
- 238000013461 design Methods 0.000 description 3
- 208000015181 infectious disease Diseases 0.000 description 3
- 238000007689 inspection Methods 0.000 description 3
- 108020004707 nucleic acids Proteins 0.000 description 3
- 102000039446 nucleic acids Human genes 0.000 description 3
- 208000036066 Hemophagocytic Lymphohistiocytosis Diseases 0.000 description 2
- 208000032672 Histiocytosis haematophagic Diseases 0.000 description 2
- 241000701044 Human gammaherpesvirus 4 Species 0.000 description 2
- 206010028980 Neoplasm Diseases 0.000 description 2
- 241000242583 Scyphozoa Species 0.000 description 2
- 238000004458 analytical method Methods 0.000 description 2
- 230000009286 beneficial effect Effects 0.000 description 2
- 238000005119 centrifugation Methods 0.000 description 2
- 239000000284 extract Substances 0.000 description 2
- 238000000605 extraction Methods 0.000 description 2
- 208000014752 hemophagocytic syndrome Diseases 0.000 description 2
- 239000004615 ingredient Substances 0.000 description 2
- 238000005259 measurement Methods 0.000 description 2
- 150000007523 nucleic acids Chemical class 0.000 description 2
- 230000009466 transformation Effects 0.000 description 2
- 230000003612 virological effect Effects 0.000 description 2
- 241000588807 Bordetella Species 0.000 description 1
- 229920000742 Cotton Polymers 0.000 description 1
- -1 EBV nucleic acid Chemical class 0.000 description 1
- 241000175212 Herpesvirales Species 0.000 description 1
- 208000032420 Latent Infection Diseases 0.000 description 1
- 206010025323 Lymphomas Diseases 0.000 description 1
- 208000030289 Lymphoproliferative disease Diseases 0.000 description 1
- 208000002454 Nasopharyngeal Carcinoma Diseases 0.000 description 1
- 206010061306 Nasopharyngeal cancer Diseases 0.000 description 1
- FAPWRFPIFSIZLT-UHFFFAOYSA-M Sodium chloride Chemical compound [Na+].[Cl-] FAPWRFPIFSIZLT-UHFFFAOYSA-M 0.000 description 1
- 239000002253 acid Substances 0.000 description 1
- 230000001154 acute effect Effects 0.000 description 1
- 239000012472 biological sample Substances 0.000 description 1
- 230000015572 biosynthetic process Effects 0.000 description 1
- 210000004369 blood Anatomy 0.000 description 1
- 239000008280 blood Substances 0.000 description 1
- 210000000601 blood cell Anatomy 0.000 description 1
- 230000017531 blood circulation Effects 0.000 description 1
- 210000001185 bone marrow Anatomy 0.000 description 1
- 238000009395 breeding Methods 0.000 description 1
- 230000001488 breeding effect Effects 0.000 description 1
- 210000004027 cell Anatomy 0.000 description 1
- 230000008859 change Effects 0.000 description 1
- 239000012295 chemical reaction liquid Substances 0.000 description 1
- 239000003153 chemical reaction reagent Substances 0.000 description 1
- 230000004087 circulation Effects 0.000 description 1
- 238000003759 clinical diagnosis Methods 0.000 description 1
- 108091036078 conserved sequence Proteins 0.000 description 1
- 125000004122 cyclic group Chemical group 0.000 description 1
- 230000007812 deficiency Effects 0.000 description 1
- 238000011161 development Methods 0.000 description 1
- 238000012631 diagnostic technique Methods 0.000 description 1
- 238000010586 diagram Methods 0.000 description 1
- 230000000694 effects Effects 0.000 description 1
- 210000002919 epithelial cell Anatomy 0.000 description 1
- 230000005284 excitation Effects 0.000 description 1
- 238000001917 fluorescence detection Methods 0.000 description 1
- 230000036737 immune function Effects 0.000 description 1
- 201000006747 infectious mononucleosis Diseases 0.000 description 1
- 230000005764 inhibitory process Effects 0.000 description 1
- 210000004698 lymphocyte Anatomy 0.000 description 1
- 125000002496 methyl group Chemical group [H]C([H])([H])* 0.000 description 1
- 201000011216 nasopharynx carcinoma Diseases 0.000 description 1
- 239000002777 nucleoside Substances 0.000 description 1
- 125000003835 nucleoside group Chemical group 0.000 description 1
- 238000011017 operating method Methods 0.000 description 1
- 230000003287 optical effect Effects 0.000 description 1
- 210000003300 oropharynx Anatomy 0.000 description 1
- 230000010355 oscillation Effects 0.000 description 1
- 210000002381 plasma Anatomy 0.000 description 1
- 238000010837 poor prognosis Methods 0.000 description 1
- 230000001376 precipitating effect Effects 0.000 description 1
- 230000008569 process Effects 0.000 description 1
- 238000003908 quality control method Methods 0.000 description 1
- 238000003753 real-time PCR Methods 0.000 description 1
- 230000004044 response Effects 0.000 description 1
- 210000003296 saliva Anatomy 0.000 description 1
- 230000028327 secretion Effects 0.000 description 1
- 235000015170 shellfish Nutrition 0.000 description 1
- 239000011780 sodium chloride Substances 0.000 description 1
- 239000006228 supernatant Substances 0.000 description 1
- 208000024891 symptom Diseases 0.000 description 1
- 238000003786 synthesis reaction Methods 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
- C12Q1/705—Specific hybridization probes for herpetoviridae, e.g. herpes simplex, varicella zoster
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
Abstract
The present invention relates to a kind of for detecting the primer sets of herpes-like virus EBV.The primer sets include respectively for EBV gene and interior target specific primer and probe.The invention further relates to a kind of for detecting the kit of herpes-like virus EBV.The kit includes PCR reaction solution, enzymatic mixture, negative controls, positive reference substance and standard items, and the PCR reaction solution includes detection EBV gene and interior target specific primer and probe.Kit provided by the invention and its detection method have many advantages, such as that easy to operate, detection time is short, detection sensitivity is high and specific good, are particularly suitable for the popularization and application in clinical examination work.
Description
Technical field
The present invention relates to vitro diagnostic techniques fields more particularly to a kind of for detecting the primer sets of herpes-like virus EBV
And kit.
Background technique
Epstein-Barr virus (Epstein-Barr virus, EBV) was found in 1964, with the name of the finder of the virus
Epstein and Barr name.It belongs to herpesviral γ subfamily, also referred to as 4 type herpesvirals.EBV genome is double-strand
DNA, complete sequence length are about 172kb.
EBV is mainly invaded by modes such as saliva, droplets, enters blood circulation after breeding in nasopharyngeal epithelial cell,
After invading the blood cells such as bone-marrow-derived lymphocyte, viral genome is more stable cyclic structure by linear transformation, and fractionated viral may be used also
It is integrated into human gene group DNA.EBV infects extensively in crowd, and 90% the above are latent infections.
Disease is related to EBV infection there are many having been demonstrated that, wherein it is thin to common are infectiousness monokaryon for disease in the blood system
Born of the same parents' increase disease, EBV correlation Hemophagocytic syndrome.There are about 50% after the normal people's primary infection EBV of immune function to show as allusion quotation
The infectious mononucleosis of type.And the poor prognosis of Hemophagocytic syndrome, more than 50% death.Immune deficiency person
Lymphoproliferative disease's even malignant lymphoma easily occurs after infection EBV.EBV infection is also drenched with kinds of tumors such as Hugh Burkitt
Bar tumor, the development of nasopharyngeal carcinoma etc. are related.
Its symptoms of varying severity when due to EBV infection, can be involved the multiple systems of whole body, and clinical manifestation is also in diversity, is held
It easily causes and fails to pinpoint a disease in diagnosis and mistaken diagnosis.So the diagnosis of EBV needs the auxiliary of laboratory testing method.Serologic detection and EBV nucleic acid
It is detected as the routine inspection method of EBV infection.In Serologic detection, it is now recognized that the anti-EB-VCA-IgM positive is acute infection
Reliable markers, and mistaken diagnosis and rate of missed diagnosis can be substantially reduced in conjunction with EBV-EA-IgG antibody determination.And in blood plasma and throat swab
Middle detection EBV-DNA can effectively assist the clinical diagnosis of early stage.
Real-Time Fluorescent Quantitative PCR Technique is a kind of nucleic acid detection technique quickly grown in recent years, using one kind with glimmering
The amplification instrument of optical detection device, fluorescence detection device can issue the excitation of specific wavelength according to certain routines periodically
Light collects detection fluorescence signal, the level of amplification for each circulation that the dynamic change by detecting fluorescence signal reflects in real time, examination
Acquisition amplification curve can be automatically analyzed after testing by software, according to intersection point, that is, critical value of amplification curve and fluorescence threshold line
And the shape of amplification curve, it can be determined that yin and yang attribute is as a result, and learn the definite value result of concentration of specimens.Real-time fluorescence PCR method
Because of high sensitivity and high specificity, short time consumption is short and in wide clinical application.
Summary of the invention
The object of the present invention is to provide a kind of for detecting the primer sets and kit of herpes-like virus EBV, has operation
Quickly, the advantage that method is simple, detection sensitivity is high, specificity is strong and accuracy is good.
The present invention provides a kind of for detecting the primer sets of herpes-like virus EBV, and the primer sets include such as following nucleosides
Primer and probe shown in acid sequence:
EBV upstream primer:
5’-GCAGCTATTTCTGGTCGCAT-3’
EBV downstream primer:
5’-GAGGGCTAGGGAGAGGTAGA-3’
EBV probe:
5’-FAM-AGAGCGCCAGGAGTCCACACA-TAMRA-3’
Internal standard upstream primer:
5’-GGCATGTGGAGGAAGGTGGT-3’
Internal standard downstream primer:
5’-CCATGGACTGGCTCTCCGTT-3’
Internal standard probe:
5’-HEX-ACGCAGCCCTGCTTCGTTCGCCG-TAMRA-3’。
The present invention also provides a kind of for detecting the kit of herpes-like virus EBV, and the kit includes PCR reaction
Liquid, the PCR reaction solution include the primer as shown in following nucleotide sequence and probe:
EBV upstream primer:
5’-GCAGCTATTTCTGGTCGCAT-3’
EBV downstream primer:
5’-GAGGGCTAGGGAGAGGTAGA-3’
EBV probe:
5’-FAM-AGAGCGCCAGGAGTCCACACA-TAMRA-3’
Internal standard upstream primer:
5’-GGCATGTGGAGGAAGGTGGT-3’
Internal standard downstream primer:
5’-CCATGGACTGGCTCTCCGTT-3’
Internal standard probe:
5’-HEX-ACGCAGCCCTGCTTCGTTCGCCG-TAMRA-3’。
In one preferred embodiment of kit provided by the present invention for detecting herpes-like virus EBV, the PCR reaction
Final concentration of 0.4 μm of ol/L of each primer in liquid, final concentration of 0.125 μm of ol/L of each probe.
In one preferred embodiment of kit provided by the present invention for detecting herpes-like virus EBV, the kit
It further include enzymatic mixture, the enzymatic mixture is the mixed liquor of thermal starting enzyme and UNG enzyme.
In one preferred embodiment of kit provided by the present invention for detecting herpes-like virus EBV, the kit
It further include positive reference substance and negative controls.
In one preferred embodiment of kit provided by the present invention for detecting herpes-like virus EBV, the positive is right
It is using pUC57 as the target fragment recombinant plasmid of carrier according to product, the nucleotide sequence of the purpose segment is as follows:
ACAGCTGTCCAGCAAGAAGAGGAGGTGGTAAGCGGTTCACCTTCAGGGGTAAGTAACCTGACCTCTCCAGGGCTCAC
ATAAAGGGAGGCTTAGTATACATGCTTCTTGCTTTTCACAGGAACCTGGGGGCTAGTCTGGGTGGGTTTAGGCCCTC
TTGGCCACGCAGCAGCTATTTCTGGTCGCATCAGAGCGCCAGGAGTCCACACAAATGTAAGAGGGGGTCTTCTACCT
CTCCCTAGCCCTCATGGCC。
In one preferred embodiment of kit provided by the present invention for detecting herpes-like virus EBV, the feminine gender is right
It is physiological saline according to product.
In one preferred embodiment of kit provided by the present invention for detecting herpes-like virus EBV, the kit
It further include containing using pUC57 as the standard items of the genetic fragment recombinant plasmid of the EBV of carrier, the concentration gradient of the standard items is divided
It Wei 1 × 104Copy/ml, 1 × 105Copy/ml, 1 × 106Copy/ml, 1 × 107Copy/ml.
In one preferred embodiment of kit provided by the present invention for detecting herpes-like virus EBV, the kit
Further include internal standard, the interior target nucleotide sequence is as follows:
TCACAAGCAGGAGTGTGCCAGGAGAAGGCCAAACCATCCAGTGCCGGTGGTTTGACCACGAGGAGTGCATCCTGCAC
GGAGTCACTGAGCTCGTGACCTCCACGCTGCTCGTCCCCTGCGCTATCGAGAGGGCACTCTCTGTGTCTCAG
CTGGTGCCGCTGGCGCAGAGTGTTTTGGGCCCCTTAAAGCTCAGCATGGCTGGTTCTGGAGAGATGGAAAAGAGAAA
GGATTTCCCCCATTTGGGTGCCTCGGGCATGTGGAGGAAGGTGGTCCGGCGAACGAAGCAGGGCTGCGTGAAGGGGA
TCTGATAACCCACGTCAACGGAGAGCCAGTCCATGG。
The present invention also provides a kind of primer sets described above in the kit that preparation detects detection herpes-like virus EBV
Purposes.
Compared to the prior art, beneficial provided by the present invention for the primer sets and kit that detect herpes-like virus EBV
Effect is:
One, kit provided by the invention operation is quickly, method is simple, detection sensitivity is up to 99.2%, specificity
100%, the EBV-DNA in unknown sample can fast and accurately be detected using the kit, be provided for diagnosis EBV infection
Reliable experimental basis is particularly suitable for the popularization and application in clinical examination work.
Two, in PCR reaction solution include the specific primer for herpes-like virus EBV design, probe and for interior target
Specific primer and probe have the advantages that expression is stable based on internal standard, it is possible to prevente effectively from the generation of false negative, and can also be compared with
Destination gene expression amount is corrected well, so that the sensitivity and repeatability of the method for the present invention are improved, so that testing result
It is more accurate and reliable.
Detailed description of the invention
Fig. 1 is the PCR amplification curve provided by the present invention for negative controls in detection herpes-like virus EBV kit
Figure；
Fig. 2 is the PCR amplification curve provided by the present invention for positive reference substance in detection herpes-like virus EBV kit
Figure；
Fig. 3 is the PCR amplification curve graph of clinical sample 1；
Fig. 4 is the PCR amplification curve graph of clinical sample 2；
Amplification curve diagram of the Fig. 5 provided by the present invention for detection herpes-like virus EBV kit Plays product, wherein
1.~concentration 4. is respectively 1 × 107Copy/ml, 1 × 106Copy/ml, 1 × 105Copy/ml and 1 × 104Copy/ml；
Fig. 6 is the canonical plotting for expanding standard items and establishing.
Specific embodiment
In order to make the objectives, technical solutions, and advantages of the present invention clearer, with reference to the accompanying drawings and embodiments, right
The present invention is described in further detail.It should be appreciated that described herein, specific examples are only used to explain the present invention, and
It is not used in the restriction present invention.
Embodiment 1: the design and synthesis of primer and probe
Bordetella is downloaded in internal authority database GenBank nucleic acid database (Nucleotide)
The canonical sequence (GenBank:NC_018828.1, sequence 4887379bp) of parapertussis, and use free open source
Kers tool Jellyfish (https: //github.com/gmarcais/Jellyfish) to whole genome sequence carry out
Continuous cutting, the nucleotide sequence library that the sequence length that base stroke obtains in turn is 250 therefrom preferably repeat more (>=5)
Sequence compare to the library NR of NCBI, finally obtain highly conserved sequence EBpcise_1072.Using this aim sequence as template,
Using Primer Premier 3.0 and Methyl Primer Express v1.0 software, specific primer and spy are separately designed
Needle, EBV probe are marked using 5'-FAM and 3'-TRAMA, and internal standard probe is marked using 5'-HEX and 3'-TRAMA.
Specific primer and probe sequence:
The preparation of embodiment two, kit
The present invention provides a kind of for detecting the kit of herpes-like virus EBV, and the kit includes containing embodiment
One specific primer provided and the PCR reaction solution of probe, enzymatic mixture, positive reference substance, negative controls, standard items and interior
Mark, in which:
PCR reaction solution: the final concentration of each ingredient and each ingredient is respectively as follows: the EBV of 0.4 μm of ol/L in the PCR reaction solution
Upstream primer, the EBV downstream primer of 0.4 μm of ol/L, the EBV probe of 0.125 μm of ol/L, 0.4 μm of ol/L internal standard upstream primer,
The internal standard downstream primer of 0.4 μm of ol/L, the internal standard probe of 0.125 μm of ol/L.
Enzymatic mixture: the enzymatic mixture is the mixed liquor of thermal starting enzyme (0.01U/ μ L) and UNG enzyme (0.03U/ μ L)；
Positive reference substance: the positive reference substance is the purpose piece using pUC57 as the target fragment recombinant plasmid of carrier
Disconnected nucleotide sequence is as shown in SEQ ID NO.7:
SEQ ID NO.7:
ACAGCTGTCCAGCAAGAAGAGGAGGTGGTAAGCGGTTCACCTTCAGGGGTAAGTAACCTGACCTCTCCA
GGGCTCACATAAAGGGAGGCTTAGTATACATGCTTCTTGCTTTTCACAGGAACCTGGGGGCTAGTCTGGGTGGGTTT
AGGCCCTCTTGGCCACGCAGCAGCTATTTCTGGTCGCATCAGAGCGCCAGGAGTCCACACAAATGTAAGAGGGGGTC
TTCTACCTCTCCCTAGCCCTCATGGCC
Negative controls: the negative controls are physiological saline；
Standard items: the concentration gradient of the standard items is respectively 1 × 104Copy/ml, 1 × 105Copy/ml, 1 × 106It copies
Shellfish/ml, 1 × 107Copy/ml, specifically, the standard items, which contain, recombinates matter by the genetic fragment of the EBV of carrier of pUC57
Grain；
Internal standard: the interior target nucleotide sequence is as shown in SEQ ID NO.8:
SEQ ID NO.8:
TCACAAGCAGGAGTGTGCCAGGAGAAGGCCAAACCATCCAGTGCCGGTGGTTTGACCACGAGGAGTGCATCCTGCAC
GGAGTCACTGAGCTCGTGACCTCCACGCTGCTCGTCCCCTGCGCTATCGAGAGGGCACTCTCTGTGTCTCAGCTGGT
GCCGCTGGCGCAGAGTGTTTTGGGCCCCTTAAAGCTCAGCATGGCTGGTTCTGGAGAGATGGAAAAGAGAAAGGATT
TCCCCCATTTGGGTGCCTCGGGCATGTGGAGGAAGGTGGTCCGGCGAACGAAGCAGGGCTGCGTGAAGGGGATCTGA
TAACCCACGTCAACGGAGAGCCAGTCCATGG。
Embodiment 3
The present embodiment provides the operating procedures that kit described in above-described embodiment 2 is used to detect EBV-DNA in sample:
One, biological sample
Oropharynx secretions are taken with cotton swab, merging seals inspection equipped in physiological saline test tube.Collect clinical sample
231.All clinical samples derive from Shenzhen Children's Hospital.
Two, sample extraction:
1) internal standard is taken to be added in sample treatment solution, additional proportion 1:50；
2) to addition 1ml sterile saline in the pipe of dress swab, sufficiently oscillation is shaken up, and extracts swab head；
3) it draws whole liquid to go in 1.5ml centrifuge tube, 12,000g centrifugations 5 minutes；
4) supernatant is removed, 50 μ l sample treatment solutions are added in precipitating, mix well, 100 DEG C of constant temperature are handled 10 minutes；
5) 4 DEG C or ice bath placement 2 minutes, 12,000g centrifugations 5 minutes are spare.
In the present embodiment, 2 have been selected to be detected from clinical sample altogether, respectively sample 1 and sample 2
Three, it is loaded into PCR reaction tube
The sample, positive reference substance, negative controls and each of step 2 extraction are separately added into each PCR reaction tube
Each 3.5 μ L of the standard items of concentration, 15.7 μ L of PCR reaction solution, 0.8 μ L of enzymatic mixture, total volume are 20 μ L, pay attention to avoiding generating gas
Bubble, mixes well after covering pipe lid, is transferred to amplification region.
Four, Fluorescence PCR
1) PCR reaction tube is sequenced and is put into amplification instrument sample cell, the title of each PCR reaction tube is set by corresponding sequence；
By table 1, PCR response parameter is set；
2) PCR reaction condition is as shown in table 1
Table 1
Five, fluorescence channel selects
FAM Air conduct measurement sample is selected, HEX Air conduct measurement internal standard is selected.
Six, interpretation of result and testing result are explained
After reaction, result is saved.According to PCR instrument specification and fluorescence curve automatic or manual adjustment baseline and threshold
Value.Highest point of the threshold value setting principle with threshold value just above negative control detection fluorescence.After setting, analysis " analysis is clicked
(Analyze) " key can obtain the Ct value of each sample from report (Reports) window.
Under conditions of meeting quality control, sample to be tested inspection result is likely to occur following several situations:
1) if the channel FAM and the channel HEX do not occur S type amplification curve, testing result is invalid, in fact it could happen that pipe
Interior inhibition should extract pattern detection again.
If 2) S type amplification curve occurs in the channel FAM, sample to be detected is the positive；
3) if obvious S type amplification curve does not occur in the channel FAM, and the Ct value in the channel HEX is less than or equal to 35, then for
It is negative.
It is specific as shown in table 2:
Table 2
By detecting to fixed positive reference substance with negative controls, obtained PCR amplification curve is detected
Fig. 1, Fig. 2, table 3 and table 4 are please referred to, Fig. 1 is provided by the present invention for negative control in detection herpes-like virus EBV kit
The PCR amplification curve graph of product；Fig. 2 is provided by the present invention for positive reference substance in detection herpes-like virus EBV kit
PCR amplification curve graph；The corresponding FAM and HEX channel C t value of Fig. 1 is as shown in table 3；The corresponding FAM and HEX channel C t value of Fig. 2 is such as
Shown in table 4.From Fig. 1 and table 3 as can be seen that when detecting negative controls, there is not S type amplification curve in the channel FAM, and HEX is logical
The Ct in road is less than 35, and from Fig. 2 and table 4 as can be seen that when detecting positive reference substance, it is bent that apparent S type amplification occurs in the channel FAM
Line, reagent yin and yang attribute reference substance coincidence rate 100%.
Table 3
| Ct | |
| FAM | - |
| HEX | 32.15 |
Table 4
| Ct | |
| FAM | 26.01 |
| HEX | 32.32 |
The testing result of sample 1 and 2 is detailed in Fig. 3, Fig. 4, table 5 and table 6, and Fig. 3 is the PCR amplification curve graph of clinical sample 1；
Fig. 4 is the PCR amplification curve graph of clinical sample 2, and the corresponding FAM and HEX channel C t value of Fig. 3 is as shown in table 5, the corresponding FAM of Fig. 4
It is as shown in table 6 with HEX channel C t value.
Table 5
Table 6
Please refer to Fig. 5 and Fig. 6, expansion of the Fig. 5 provided by the present invention for detection herpes-like virus EBV kit Plays product
Increase curve graph, wherein 1.~concentration 4. is respectively 1 × 107Copy/ml, 1 × 106Copy/ml, 1 × 105Copy/ml and 1 ×
104Copy/ml；Fig. 6 is the canonical plotting for expanding standard items and establishing, and the copy number of sample to be tested can be acquired from Fig. 6.
It is provided by the present invention for the primer sets and kit beneficial effect for detecting herpes-like virus EBV:
One, kit provided by the invention operation is quickly, method is simple, detection sensitivity is up to 99.2%, specificity
100%, the EBV-DNA in unknown sample can fast and accurately be detected using the kit, be provided for diagnosis EBV infection
Reliable experimental basis is particularly suitable for the popularization and application in clinical examination work.
Two, in PCR reaction solution include the specific primer for herpes-like virus EBV design, probe and for interior target
Specific primer and probe have the advantages that expression is stable based on internal standard, it is possible to prevente effectively from the generation of false negative, and can also be compared with
Destination gene expression amount is corrected well, so that the sensitivity and repeatability of the method for the present invention are improved, so that testing result
It is more accurate and reliable.
The above description is only an embodiment of the present invention, is not intended to limit the scope of the invention, all to utilize this hair
Equivalent process transformation made by bright description is applied directly or indirectly in other relevant technical fields, similarly wraps
It includes in scope of patent protection of the invention.
SEQUENCE LISTING
<110>Shenzhen Children's Hospital
<120>for detecting the primer sets and kit of herpes-like virus EBV
<130> 2018
<160> 8
<170> PatentIn version 3.5
<210> 1
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 1
gcagctattt ctggtcgcat 20
<210> 2
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 2
gagggctagg gagaggtaga 20
<210> 3
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 3
agagcgccag gagtccacac a 21
<210> 4
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 4
ggcatgtgga ggaaggtggt 20
<210> 5
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 5
ccatggactg gctctccgtt 20
<210> 6
<211> 23
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 6
acgcagccct gcttcgttcg ccg 23
<210> 7
<211> 250
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 7
acagctgtcc agcaagaaga ggaggtggta agcggttcac cttcaggggt aagtaacctg 60
acctctccag ggctcacata aagggaggct tagtatacat gcttcttgct tttcacagga 120
acctgggggc tagtctgggt gggtttaggc cctcttggcc acgcagcagc tatttctggt 180
cgcatcagag cgccaggagt ccacacaaat gtaagagggg gtcttctacc tctccctagc 240
cctcatggcc 250
<210> 8
<211> 339
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 8
tcacaagcag gagtgtgcca ggagaaggcc aaaccatcca gtgccggtgg tttgaccacg 60
aggagtgcat cctgcacgga gtcactgagc tcgtgacctc cacgctgctc gtcccctgcg 120
ctatcgagag ggcactctct gtgtctcagc tggtgccgct ggcgcagagt gttttgggcc 180
ccttaaagct cagcatggct ggttctggag agatggaaaa gagaaaggat ttcccccatt 240
tgggtgcctc gggcatgtgg aggaaggtgg tccggcgaac gaagcagggc tgcgtgaagg 300
ggatctgata acccacgtca acggagagcc agtccatgg 339
Claims (10)
1. a kind of for detecting the primer sets of herpes-like virus EBV, which is characterized in that including as shown in following nucleotide sequence
Primer and probe:
EBV upstream primer:
5’-GCAGCTATTTCTGGTCGCAT-3’
EBV downstream primer:
5’-GAGGGCTAGGGAGAGGTAGA-3’
EBV probe:
5’-FAM-AGAGCGCCAGGAGTCCACACA-TAMRA-3’
Internal standard upstream primer:
5’-GGCATGTGGAGGAAGGTGGT-3’
Internal standard downstream primer:
5’-CCATGGACTGGCTCTCCGTT-3’
Internal standard probe:
5’-HEX-ACGCAGCCCTGCTTCGTTCGCCG-TAMRA-3’。
2. a kind of for detecting the kit of herpes-like virus EBV, which is characterized in that the kit includes PCR reaction solution, institute
Stating PCR reaction solution includes the primer as shown in following nucleotide sequence and probe:
EBV upstream primer:
5’-GCAGCTATTTCTGGTCGCAT-3’
EBV downstream primer:
5’-GAGGGCTAGGGAGAGGTAGA-3’
EBV probe:
5’-FAM-AGAGCGCCAGGAGTCCACACA-TAMRA-3’
Internal standard upstream primer:
5’-GGCATGTGGAGGAAGGTGGT-3’
Internal standard downstream primer:
5’-CCATGGACTGGCTCTCCGTT-3’
Internal standard probe:
5’-HEX-ACGCAGCCCTGCTTCGTTCGCCG-TAMRA-3’。
3. according to claim 2 for detecting the kit of herpes-like virus EBV, which is characterized in that the PCR reaction
Final concentration of 0.4 μm of ol/L of each primer in liquid, final concentration of 0.125 μm of ol/L of each probe.
4. according to claim 2 for detecting the kit of herpes-like virus EBV, which is characterized in that the kit
It further include enzymatic mixture, the enzymatic mixture is the mixed liquor of thermal starting enzyme and UNG enzyme.
5. according to claim 2 for detecting the kit of herpes-like virus EBV, which is characterized in that the kit
It further include positive reference substance and negative controls.
6. according to claim 5 for detecting the kit of herpes-like virus EBV, which is characterized in that the positive is right
It is using pUC57 as the target fragment recombinant plasmid of carrier according to product, the nucleotide sequence of the purpose segment is as follows:
ACAGCTGTCCAGCAAGAAGAGGAGGTGGTAAGCGGTTCACCTTCAGGGGTAAGTAACCTGACCTCTCCAGGGC
TCACATAAAGGGAGGCTTAGTATACATGCTTCTTGCTTTTCACAGGAACCTGGGGGCTAGTCTGGGTGGGTTTAGGC
CCTCTTGGCCACGCAGCAGCTATTTCTGGTCGCATCAGAGCGCCAGGAGTCCACACAAATGTAAGAGGGGGTCTTCT
ACCTCTCCCTAGCCCTCATGGCC。
7. according to claim 5 for detecting the kit of herpes-like virus EBV, which is characterized in that the feminine gender is right
It is physiological saline according to product.
8. according to claim 2 for detecting the kit of herpes-like virus EBV, which is characterized in that the kit
It further include containing using pUC57 as the standard items of the genetic fragment recombinant plasmid of the EBV of carrier, the concentration gradient of the standard items is divided
It Wei 1 × 104Copy/ml, 1 × 105Copy/ml, 1 × 106Copy/ml, 1 × 107Copy/ml.
9. according to claim 2 for detecting the kit of herpes-like virus EBV, which is characterized in that the kit
Further include internal standard, the interior target nucleotide sequence is as follows:
TCACAAGCAGGAGTGTGCCAGGAGAAGGCCAAACCATCCAGTGCCGGTGGTTTGACCACGAGGAGTGCATCCT
GCACGGAGTCACTGAGCTCGTGACCTCCACGCTGCTCGTCCCCTGCGCTATCGAGAGGGCACTCTCTGTGTCTCAGC
TGGTGCCGCTGGCGCAGAGTGTTTTGGGCCCCTTAAAGCTCAGCATGGCTGGTTCTGGAGAGATGGAAAAGAGAAAG
GATTTCCCCCATTTGGGTGCCTCGGGCATGTG
GAGGAAGGTGGTCCGGCGAACGAAGCAGGGCTGCGTGAAGGGGATCTGATAACCCACGTCAACGGAGAGCCAGTCCA
TGG。
10. a kind of purposes of primer sets as described in claim 1 in the kit of preparation detection herpes-like virus EBV.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810336564.0A CN110387434A (en) | 2018-04-16 | 2018-04-16 | For detecting the primer sets and kit of herpes-like virus EBV |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810336564.0A CN110387434A (en) | 2018-04-16 | 2018-04-16 | For detecting the primer sets and kit of herpes-like virus EBV |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN110387434A true CN110387434A (en) | 2019-10-29 |
Family
ID=68282657
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810336564.0A Pending CN110387434A (en) | 2018-04-16 | 2018-04-16 | For detecting the primer sets and kit of herpes-like virus EBV |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110387434A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111041131A (en) * | 2020-03-16 | 2020-04-21 | 广东永诺医疗科技有限公司 | EB virus detection kit based on droplet type digital PCR |
Citations (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20080206749A1 (en) * | 2007-02-26 | 2008-08-28 | The Chinese University Of Hong Kong | Methods and kits for diagnosis, prognosis or monitoring of Epstein-Barr virus (EBV)-associated cancer |
| CN101899528A (en) * | 2009-05-27 | 2010-12-01 | 广州达健生物科技有限公司 | Hypersensitivity Epstein-Barr (EB) virus fluorescence quantitative polymerase chain reaction (PCR) kit for locked nucleotide acid (LNA) and detection method and application thereof |
| KR20130122227A (en) * | 2012-04-30 | 2013-11-07 | (주)바이오니아 | Oligonucleotide kit for detecting epstein-bar virus and ebv detecting methods using the same |
| CN106381344A (en) * | 2016-09-07 | 2017-02-08 | 林勤 | High-sensitivity EBV DNA quantitative detection kit based on ddPCR and using method thereof |
| WO2017105353A1 (en) * | 2015-12-18 | 2017-06-22 | Agency For Science, Technology And Research | Detection and quantification of target nucleic acid sequence of a microorganism |
| CN107190072A (en) * | 2017-06-22 | 2017-09-22 | 深圳市泰尔迪恩生物信息科技有限公司 | Primer combination of probe, kit and application for detecting pertussis Bao Te Salmonellas |
| CN107338286A (en) * | 2017-06-05 | 2017-11-10 | 深圳市儿童医院 | Primer combination of probe, PCR reaction solutions, kit and its application |
| CN107475389A (en) * | 2017-08-23 | 2017-12-15 | 深圳市儿童医院 | For detecting primer sets, kit and the method for mycoplasma pneumoniae |
-
2018
- 2018-04-16 CN CN201810336564.0A patent/CN110387434A/en active Pending
Patent Citations (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20080206749A1 (en) * | 2007-02-26 | 2008-08-28 | The Chinese University Of Hong Kong | Methods and kits for diagnosis, prognosis or monitoring of Epstein-Barr virus (EBV)-associated cancer |
| CN101899528A (en) * | 2009-05-27 | 2010-12-01 | 广州达健生物科技有限公司 | Hypersensitivity Epstein-Barr (EB) virus fluorescence quantitative polymerase chain reaction (PCR) kit for locked nucleotide acid (LNA) and detection method and application thereof |
| KR20130122227A (en) * | 2012-04-30 | 2013-11-07 | (주)바이오니아 | Oligonucleotide kit for detecting epstein-bar virus and ebv detecting methods using the same |
| WO2017105353A1 (en) * | 2015-12-18 | 2017-06-22 | Agency For Science, Technology And Research | Detection and quantification of target nucleic acid sequence of a microorganism |
| CN106381344A (en) * | 2016-09-07 | 2017-02-08 | 林勤 | High-sensitivity EBV DNA quantitative detection kit based on ddPCR and using method thereof |
| CN107338286A (en) * | 2017-06-05 | 2017-11-10 | 深圳市儿童医院 | Primer combination of probe, PCR reaction solutions, kit and its application |
| CN107190072A (en) * | 2017-06-22 | 2017-09-22 | 深圳市泰尔迪恩生物信息科技有限公司 | Primer combination of probe, kit and application for detecting pertussis Bao Te Salmonellas |
| CN107475389A (en) * | 2017-08-23 | 2017-12-15 | 深圳市儿童医院 | For detecting primer sets, kit and the method for mycoplasma pneumoniae |
Non-Patent Citations (3)
| Title |
|---|
| ARMEN SANOSYAN 等: "The impact of targeting repetitive BamHI-W sequences on the sensitivity and precision of EBV DNA quantification", 《PLOS ONE》 * |
| BERGER 等: "Dynamics of Epstein-Barr Virus DNA Levels in Serum During EBV-Associated Disease", 《JOURNAL OF MEDICAL VIROLOGY》 * |
| 中国食品药品检定研究院, 北京：中国医药科技出版社 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111041131A (en) * | 2020-03-16 | 2020-04-21 | 广东永诺医疗科技有限公司 | EB virus detection kit based on droplet type digital PCR |
| CN111041131B (en) * | 2020-03-16 | 2020-07-10 | 广东永诺医疗科技有限公司 | EB virus detection kit based on droplet type digital PCR |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111057797B (en) | Novel coronavirus 2019-nCoV real-time fluorescent quantitative PCR detection primer, probe, kit and method | |
| CN103642945B (en) | A kind of highly sensitive Epstein-Barr FLuorescent quantitative PCR kit containing internal reference | |
| CN108676920B (en) | Primer and kit for rapidly detecting mouse norovirus and RT-RPA method thereof | |
| CN105441595B (en) | It is a kind of for detecting the digital pcr absolute quantitation parting detecting reagent of HBV-B/C | |
| CN110273027B (en) | Nucleic acid typing detection kit and detection method for norovirus GII, GII and GIV | |
| CN109777893A (en) | The invisible hepatitis B detection kit of droplet type digital pcr | |
| CN105624329B (en) | Herpes simplex virus type 1 real-time fluorescence nucleic acid isothermal amplification detection kit | |
| WO2016082691A1 (en) | Kit for rt-pcr detection of chikungunya and test method thereof | |
| CN110317902A (en) | I/II/III/V type nucleic acid parting detecting reagent of herpes virus hominis and detection method | |
| CN101760560A (en) | Fluorescent PCR detection method for human cytomegalovirus (HCMV) | |
| CN102634572B (en) | Reagent kit for detecting mRNA (messenger ribonucleic acid) expression of fused gene E2A-PBX1 via fluorescent quantitative RT-PCR (reverse transcription-polymerase chain reaction) | |
| CN103122396B (en) | Kit for detecting human cytomegalovirus (HCMV) | |
| CN106701957A (en) | Kit for detecting fusion gene BCR-ABL (P210) mRNA expression | |
| CN106399536B (en) | Body fluid circulatory DNA quantitative detecting method and kit | |
| CN105779644B (en) | The real-time fluorescence nucleic acid isothermal amplification detection kit of human cytomegalovirus | |
| CN105132584A (en) | Kit for genotyping VZV, production method of kit and application of kit | |
| CN106676198A (en) | High-sensitivity quantitative detection kit for herpes virus 4 and herpes virus 5 | |
| CN110387434A (en) | For detecting the primer sets and kit of herpes-like virus EBV | |
| CN113046483A (en) | Novel real-time fluorescent RT-RAA primer, probe and detection kit for coronavirus | |
| CN112813195A (en) | Novel quantitative detection kit for coronavirus nucleic acid based on micro-droplet digital analysis | |
| CN103820574A (en) | Real-time fluorescent quantitation PCR (polymerase chain reaction) parting detection kit for human herpesvirus-6 | |
| CN102618665B (en) | Kit for fluorescence PCR detection of herpes simplex virus I | |
| CN111719017A (en) | Novel loop-mediated isothermal amplification detection method and kit for coronary viruses | |
| CN109913589A (en) | It is a kind of for detecting primer combination of probe object, kit and the method for herpes zoster virus | |
| CN110760596A (en) | Clonorchis sinensis liquid drop type digital PCR detection kit and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20191029 |