CN107460179B

CN107460179B - Polysaccharide degrading enzyme and coding gene and application thereof

Info

Publication number: CN107460179B
Application number: CN201710868822.5A
Authority: CN
Inventors: 陈师勇; 张燕娇
Original assignee: Qingdao Agricultural University
Current assignee: Qingdao Agricultural University
Priority date: 2017-09-22
Filing date: 2017-09-22
Publication date: 2021-06-29
Anticipated expiration: 2037-09-22
Also published as: CN107460179A

Abstract

A polysaccharide degrading enzyme, Chond EI, is characterized in that the polysaccharide degrading enzyme is named as Chond EI, the coding gene obtains an Edwardsiella tarda environmental isolation strain, is a protein with an amino acid residue sequence of a sequence 2 in a sequence table, or is a polysaccharide degrading enzyme prepared by substituting, deleting or adding one or more amino acid residues in the amino acid residue sequence of the sequence 2, deriving the protein from the sequence 2 with the same activity as the amino acid residue sequence of the sequence 2, cloning, expressing and purifying the Edwardsiella separated from the ocean, and has the characteristics of high product activity, good stability, short production period and low cost, and is easy to realize industrial production.

Description

Polysaccharide degrading enzyme and coding gene and application thereof

Technical Field

The invention relates to a polysaccharide degrading enzyme, a coding gene and application thereof. Belongs to the field of biotechnology and genetic engineering.

Background

Polysaccharide components such as glycosaminoglycan (GAG) and proteoglycan (proteoglycan) are ubiquitous in various tissues of animals, and play an important role in maintaining the relative stability of the environment of cells and the normal physiological function of cells. Glycosaminoglycans, also called mucopolysaccharides, mainly include Hyaluronic Acid (HA), heparin (heparin), Chondroitin Sulfate (CS), etc., and are long-chain polymers composed of repeated disaccharide units of hexosamine and uronic acid. Hyaluronic acid is formed by disaccharide unit composed of N-acetylglucosamine and D-glucuronic acid connected by beta-1, 3-glycosidic bond, and is distributed in connective tissue, vitreous body of eyeball, cornea, intercellular substance, joint fluid, malignant tumor tissue and cell wall of some bacteria; chondroitin sulfate is composed of disaccharide units formed by connecting D-glucuronic acid and N-acetylgalactosamine sulfate by beta-1, 3-glycosidic bond, is divided into chondroitin-4-sulfate (chondroitin sulfate A) and chondroitin-6-sulfate (chondroitin sulfate C) according to the position of the sulfate, is the main component of cartilage, and is also contained in connective tissue, tendon, skin, heart valve and saliva. The complex structure of glycosaminoglycan determines the functional diversity, and human and animal growth, tissue repair, cell recognition, immunoregulation, substance transport, cell aging, cancer treatment and diagnosis, etc. are closely related.

The protein and glycosaminoglycan are linked by covalent bonds to form proteoglycans. Proteoglycan is mainly present in connective tissues such as cartilage, tendon, etc., and forms intercellular substance, and has important functions of stabilizing, supporting, protecting cells, and keeping water and salt balance. Proteoglycans on the cell surface are also involved in cell adhesion, migration, proliferation and differentiation functions.

The polysaccharide degrading enzyme takes one or more polysaccharides as a substrate to crack the polysaccharides into oligosaccharides, and has very wide application prospect:

1) can be used as a tool enzyme for researching the structure and the function of the proteoglycan of the body. The polysaccharide degrading enzyme has selectivity and diversity on acting substrates, and by utilizing the characteristic, the corresponding product can be detected, and the composition structure and function research of polysaccharide components with complex structures can be carried out, for example, the specific functional region of the polysaccharide chain combined with target protein is identified by combining various separation and analysis means.

2) Polysaccharide fractions of low molecular weight can be produced for use in functional products and pharmaceutical additives. Polysaccharides have wide applications in functional products and medicine, but due to the heterogeneity of polysaccharide structures, there are great differences in the activity of the same product from different sources and in different batches. However, researches show that the biological function of the glycosaminoglycan is realized by the specific interaction between the functional regions with special structures in the polysaccharide chain and specific proteins, and the functional regions with different structures exist in the same polysaccharide chain, and can perform different functions by interacting with different proteins, so that the oligosaccharide with uniform or relatively uniform structure in the specific functional regions can be prepared by an enzymatic hydrolysis method, and can be widely applied to foods, beverages, tonics, high-grade health products, high-grade cosmetics and medical supplies as an additive. For example, the low molecular weight chondroitin sulfate can be widely used as an additive in foods, beverages, tonics, high-grade health products and high-grade cosmetics, and the preparation of the low molecular weight chondroitin sulfate by an enzymatic hydrolysis method is one of the hot spots of the current domestic and foreign researches.

3) Polysaccharide degrading enzymes are novel pharmaceutical enzymes. Glycosaminoglycan is used as the main component of extracellular matrix, protects body cells from being damaged, and plays a role in protecting barriers. However, in disease treatment, the dense extracellular matrix inhibits the permeability and effective diffusion of drugs (especially for some macromolecular drugs, such as protein drugs like insulin and antibody) in tissues, thereby reducing the onset time and curative effect of the drugs. The hyaluronidase can be used as an auxiliary agent to promote the absorption and diffusion of other medicines clinically; for subcutaneous infusion of liquids; the degradation elimination of hyaluronic acid in the accident of hyaluronic acid filling plastic surgery; can be used for treating intractable dermatoses related to glycosaminoglycan metabolism disorder accumulation, such as diabetic scleredema, scleroderma, keloid, etc.; chondroitinase (CSase) is clinically used for degrading Chondroitin Sulfate Proteoglycan (CSPGs), which is an important component of glial scar after Central Nervous System (CNS) injury and can inhibit axon regeneration. Removal of GAG by polysaccharidase or interference with its synthesis can regenerate axons, promote regeneration of neural axes, nerve regeneration and functional repair after spinal cord injury (Nicole J et al: Chondronitinase ABC improves basic and skeletal coordination in spinal cord injured places: Experimental Neurology,2008,209(2):483 496).

In conclusion, the glycosaminoglycan degrading enzyme is not only an essential tool for the structural function research of glycosaminoglycan, but also has important application value in the preparation of glycosaminoglycan active oligosaccharide and the treatment of diseases. In foreign countries, research on chondroitinase has been relatively early, and commercial CSase ABC, CSase AC, and the like are mostly produced by two strains of protein vulgaris and Flavobacterium heptanum, which are expensive and patented in production. The production strain grows slowly, the CSase AC expression level is low, the separation and purification process is complex and the like, which directly increases the cost of the production enzyme and is difficult to realize industrial application, so the development of a new high-efficiency recombinant expression technology has important significance.

Summary of the invention

In order to overcome the defects of the existing polysaccharide degrading enzyme production technology, the invention provides a polysaccharide degrading enzyme, a coding gene and application thereof, and a whole set of fusion expression and purification obtaining method, so that a large amount of high-purity soluble recombinase protein is obtained.

The polysaccharide degrading enzyme provided by the invention is named as Chond EI, and the coded gene acquisition Edwardsiella tarda (E.tarda) environment separation strain is a protein with an amino acid residue sequence of a sequence 2 in a sequence table, or a protein which is derived from the sequence 2 and has the same activity as the amino acid residue sequence of the sequence 2 by substituting, deleting or adding one or more amino acid residues in the amino acid residue sequence of the sequence 2.

The amino acid residue sequence of the sequence 2 in the sequence table is a protein consisting of 1023 amino acid residues.

The gene coding Chond EI of polysaccharide-degrading enzyme is named Chond EI and is one of the following nucleotides:

1) a DNA sequence of a sequence 1 in a sequence table;

2) a polynucleotide encoding a protein sequence of sequence 2 in the sequence table;

3) DNA sequence which has more than 95% of homology with the DNA sequence limited by the sequence 1 in the sequence table and codes the protein with the same function.

The DNA sequence in SEQ ID No. 1 consists of 3072 bases.

The expression vector and cell line containing the gene of the invention are both in the protection scope of the invention.

Primer pairs for amplifying any fragment of the gene encoding the protein are also within the scope of the invention.

The invention has the advantages that the polysaccharide degrading enzyme Chond EI prepared by cloning, expressing and purifying the Edwardsiella isolated from the sea has the characteristics of high product activity, good stability, short production period and low cost, and is easy to realize industrial production.

Description of the drawings:

FIG. 1: cloning of Chond EI Gene

FIG. 2: inducible expression of recombinase in escherichia coli

FIG. 3: western blot verification of protein accuracy

FIG. 4: purified recombinant proteins

FIG. 5: influence of temperature on enzyme Activity

FIG. 6: influence of pH on enzyme Activity

FIG. 7: effect of NaCl concentration on enzyme Activity

The specific implementation mode is as follows:

the invention is further illustrated by the following figures and examples. The examples are intended to illustrate the invention, but not to limit it in any way.

Example 1 obtaining of Chond EI Gene and recombinase

1. Acquisition of Edwardsiella tarda Chond EI gene and construction of expression plasmid

Selecting a base sequence of the chond E1 gene on the Edwardsiella tarda genome, and designing primers chond E1-fwd: ACCTGCATATGTTATCCATGCATCGCACC, chond E1-rev: ATCAGAAGCTTAGGCATTTTTTTCAGCGCAATC are provided. Using Edwardsiella tarda genome as a template, and carrying out PCR amplification on chond E1 gene. The amplification system is as follows: pre-denaturation at 95 ℃ for 2 min; denaturation at 95 ℃ for 20 s; annealing at 55 ℃ for 10 s; extension at 72 ℃ for 1min30s and finally extension at 72 ℃ for 10min, 30 cycles were performed. The obtained PCR product had HindIII and NdeI restriction sites at both ends, and the results of DNA electrophoresis are shown in FIG. 1. The gene sequence synthesized by PCR was ligated into the high expression plasmid pET30a using HindIII and NdeI restriction endonuclease sites according to a conventional method to obtain the recombinant plasmid pET30a-Chond EI. The constructed recombinant plasmid expresses Chond E1 mature protein from 1 st site of the sequence 2 to the tail end of the sequence.

2. Expression of recombinase Chond EI

The recombinant plasmid pET30a-Chond EI is introduced into an Escherichia coli DH5a strain by a transformation competent cell mode and is screened and sequenced by a conventional method. Culturing single colony with successful sequencing, extracting plasmid, transferring into expression vector Escherichia coli BL21 strain by transformation competent cell mode, and screening kanamycin (Kan) resistant strain 30 μ g/ml. The obtained monoclonal bacteria were inoculated into 5ml of LB medium, activated overnight at 37 ℃, cultured until OD600 became 0.4-0.6, and induced for 5 hours by adding IPTG at a final concentration of 1 mM. The medium was discarded by centrifugation. SDS-PAGE detection, Coomassie blue staining. The results are shown in FIG. 2, where the expressed protein is at position 115 KD. Western blot verifies the accuracy of the protein and the feasibility of purification by Histag, and the result is shown in FIG. 3. This shows that the strain accurately expresses the introduced recombinant Chond EI gene under IPTG induction.

3. Purification of expressed proteins

Escherichia coli BL21 containing the objective gene chond E1 in the seed-retaining tube was picked, cultured overnight in 5ml of LB medium (containing Kan), then expanded to 200ml of LB medium (containing Kan), and OD was measured₆₀₀IPTG induction (final concentration of 0.1mM) was performed for 1h at 0.4-0.6, and the resulting bacterial solution was centrifuged at 4 deg.C (5000 r. min)^-115min) for 3 times, resuspending the precipitate with 20mM Tris-HCl Buffer (pH7.4-7.6), adding 4ml non-denatured Wash Buffer to resuspend the precipitate, and performing ultrasonic disruption until the bacterial solution is clear and transparent. (power 10%; work 1s, interval 3s, work time 30 min). Crushing bacteria at 4 deg.C for 5000r min^-1Centrifugation was carried out for 15min, and the supernatant was taken and subjected to Thermo HisPur Cobalt Resin affinity chromatography.

Affinity chromatography (the whole procedure was performed at 4 ℃):

(1) adding a proper amount of resin into a centrifuge tube, centrifuging for 2min at 700g, and removing supernatant;

(2) adding Wash Buffer with three times volume of resin, and fully and uniformly mixing;

(3) centrifuging at 700g for 2min, discarding the supernatant, and repeating twice;

(4) and (3) uniformly mixing the crushed supernatant sample with resin, uniformly mixing for 2h at room temperature, and centrifuging for 2min at 700 g. Discarding the supernatant, leaving the resin;

(5) then washing the resin for three times by using Wash Buffer with 3 times of volume to remove impurity proteins;

(6) eluting proteins with Elution Buffer containing 20mM,40mM,80mM,120mM and 200mM imidazole respectively, collecting the protein samples respectively, storing in a centrifuge tube at 4 ℃,

after a high-purity Chond EI protein solution is obtained by using HisPur Cobalt Resin purification, an ultrafiltration tube centrifugation method is adopted, PBS buffer solution is used for washing salt and concentrating to a small volume, and then SDS-PAGE electrophoresis detection of purified recombinant protein is carried out. The results are shown in FIG. 4, which shows that the recombinant protein was purified without errors.

Example 2 detection of recombinant Chond EI enzyme Activity

1 protein function exploration

The definition and determination of the enzyme activity of the present invention are described below: the enzyme activity is detected by adopting a light absorption method of 232nm, and one enzyme activity unit (U) is the enzyme amount required by degrading a substrate at 30 ℃ per min to generate 1 mu M unsaturated double bonds. Sodium hyaluronate (Sodium hyaluronate), Sodium alginate (Sodium alginate from brown), Heparin Sodium (Heparin Sodium from Sodium intestinate), agarose (agarose), chondroitin sulfate A (chondroitin sulfate A) were dissolved in water to prepare a mother liquor with a concentration of 10mg/ml, and the following experiments were performed: the total volume is 100 ul. Substrate 20ul, 250mM NaH was added₂PO₄-Na₂HPO₄(pH 7.0)20ul, purified water 30ul, purified recombinant Chond EI protein 30 ul. Performing digestion reaction at 30 deg.C for 12h, boiling in boiling water for 10min to terminate the reaction, ice-water bathing for 10min, centrifuging at 15000g rotation speed for 15min, and collecting supernatant. And (3) detecting the absorbance change at 232nm in unit time, and calculating the mole number of unsaturated double bonds in the system after the reaction is finished according to the molar extinction coefficient. The protein concentration was measured by the conventional Bradford method and the specific enzyme activity (in U/mg protein) was calculated, which is defined as the ratio of the enzyme activity to the protein concentration (in mg/ml). The experimental result shows that the recombinant Chond EI enzyme can specifically degrade two polysaccharides, namely chondroitin sulfate A and hyaluronic acid.

2 optimal conditions for enzymatic decomposition of polysaccharides

Chondroitin sulfate polysaccharide substrate with a molar weight of 300 pmoL/. mu.L, enzyme solution, buffer solutions with different pH values (pH range of 5.0-10.0) and water were mixed in a ratio of 2: 1: 3: 4 (volume ratio), reacting at 30 ℃ for 10min, and finally detecting the absorbance at 232 nm. The results are shown in FIG. 5, which shows that the recombinase reaches maximum activity at pH8.0, indicating that the recombinase has an optimum reaction pH of 8.0.

At the optimum pH, a chondroitin sulfate polysaccharide substrate, an enzyme solution and 150mM NaH were mixed in a molar amount of 300 pmoL/. mu.L₂PO4-Na₂HPO4 buffer (pH8.0) and water in a volume ratio of 2: 1: 3: 4 (volume ratio), reacting at different temperatures (0-70 ℃) for 10min, and finally detecting the absorbance at 232 nm. The results are shown in FIG. 6, which shows that the recombinant enzyme reached maximum activity at 30 ℃ indicating that it is heavyThe optimal reaction temperature for the group enzymes was 30 ℃.

At the optimum pH, a chondroitin sulfate polysaccharide substrate in a molar amount of 300 pmoL/. mu.L, an enzyme solution, and 150mM NaH were added₂PO4-Na₂HPO4 buffer (pH8.0) and NaCl solutions of various final concentrations (0M, 0.2M, 0.4M, 0.6M, 0.8M, 1M) were mixed in a ratio of 2: 1: 3: 4 (volume ratio), reacting for 10min at the optimum pH and temperature, and detecting the absorbance at 232 nm. The results are shown in FIG. 7, which shows that the recombinant enzyme has higher enzyme activity in 0.2M NaCl solution.

The optimum reaction conditions are used for enzymatic reaction, and the enzyme activity can reach 4100U/L fermentation liquor when chondroitin sulfate A is taken as a substrate through calculation, and the specific enzyme activity of purified recombinase protein can reach 25U/mg.

The recombinant Chond EI enzyme produced by the recombinant Chond EI enzyme can be used as a substitute of chondroitinase sulfate AC in various fields of chondroitinase sulfate AC. The method is used for preparing homogeneous or relatively homogeneous chondroitin sulfate/hyaluronic acid polysaccharide and oligosaccharide, determining the structure and function of the chondroitin sulfate/hyaluronic acid, and relevant fields including food, clinic, medicine, scientific research and the like.

Sequence listing

<110> Qingdao agricultural university

<120> polysaccharide degrading enzyme, and coding gene and application thereof

<130> 2

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 3072

<212> DNA

<213> polysaccharide degrading enzyme (Chond EI)

<400> 1

atgttatcca tgcatcgcac cctgctggcg gcctcgattg ccgccctgct actcaacgcc 60

ccgctctacg cggcgccgaa cgacgccgcc gccaagaaac gtgccgagat catgcgcgcg 120

cagatctaca gcttcgatca gcccgccgat ctcgctgaca tcaccacgac ccccggctcc 180

catgtcgcgc tgagcgataa acgcgccatc atgggcgaac gcgcactggt ctgggattgg 240

caacgtggcg ccagcctatt gctgcgccac gacatggaga tcccgtcgga tgctcaggtc 300

tccaaagcct ggggacgctc cgccacgccg gtgctctcct tctggatcta caacgagaag 360

ccgatcgacg atgtgcttat cgtcgatctc ggtaacggcc ttaatgctaa caatgaggcc 420

gacgcgggca ctcaggtcaa actgaacttc cagggctggc gcgccgtcgg cgtctcgctc 480

aacaacgatc tggccaatcg ggagatgagc ggcgtcggtg tacgcagcga cgaagatgcc 540

ggcgaaccca gcgtcagccg ctcactcggt aagcatatcg ataccatccg cttccgtgcc 600

ccctccgggg agaagtccgg ccgcctgttc atcgatcgcg tgatgatctc ggtcgatgat 660

gcgcgttatc aatggtcgga ctaccatgtc aagacgcgct acgacgaacc ggagatcgcc 720

tttcatcacg ccgagccaac gctggcgctg acggcggcga accaggctgg cgtcgatctg 780

atccgccaac gactgatcga tgagttcgtc aatggaccac aagacagcaa cctgaaggcc 840

gaagccgatc tcaataagct acgcgccgcc ttccaggcgt tgcagatccg cgtggcggcc 900

gatggcacgc tgagtggacg ccatctgatc accgacaaac agaaggtgct ctatcaaccg 960

gagtatctga gcgcgcaaga taaggcgaaa ttcgatcgtt atgtcatcct gggcgactac 1020

accacactga tgtacaacat cagccatgcc tacctccaga gtcacgacgc agcgacccgg 1080

aaaacgttgg ccgacatgta tctgctgatg acccgtcacc tgctcgatca aggttttgcc 1140

aaaggcagcg gcctggtcac gacccaccac tggggatata gcgcccgctg gtggtacatc 1200

tcggcactgt tgatgaatcc ggtgctggat caggccaaat tgacacagca ggtctacgat 1260

gcgctgctgt ggtattcgcg tgagtttaaa gctagcttcg acatgaaggt cggcccgcag 1320

agcagtaacc tagattactt caataccctg tcgcgccagc atctcgccct actgctgctg 1380

gagcctaacc cgcaacagcg tatcgacttg ctgaacacct tcagccatta catcagcgga 1440

gctctggctc agacgccgcc gggcagtaac gatggcctgc gcccagatgg caccgcctgg 1500

cgccatgagg ggaactaccc aggctactcc ttcccggcct ttaagaacgc cgctcagctc 1560

gcctacctgt tgcgcgatac gcctttcgcc ctacagcgcg cggggctgga caagctcaag 1620

caggcgatgg tcgccgcctg gatctacagc aacccgcaga ccgggatctc gctggccggg 1680

cgccacccct tcaactcgcc gtcgctcgcc agcctgacca acgcctacta ctggctggcc 1740

atggcctacg gtaaaaagcc cgatccgacc ctggcggcca tctacctccg cctggcgggg 1800

aagagcgagg ccgatgccaa ggcgctattc ggtagcgcca tcccgccggc agccttaccg 1860

caaggcttct acgcctttaa tggcggcgcc ttcggcatcc accgttggca cgacaagatg 1920

gtgacgttga aagcctttaa cagcaacgtc tggtcctccg agatctacca gaaagataac 1980

cgctatggtc gctaccagag ccatggcgtg gtgcagatca tcaaccaggg ctcgcaagag 2040

gatcagggct atcgccaggc gggttgggac tggaaccgga tgcccggagc caccaccctg 2100

catctgccgt tggaagcact caacagcccc aatcgtcata ccctgatgca gcgcgggagt 2160

caccccttca gcggcacctc atcgctggat ggccgctatg gcatgctggc cttcgatctg 2220

cgcccaatgc gtgatcagcc cagtttcgat caggcattga gcgcgctgaa aagcgtcctg 2280

gccgtcgatg atcgcctgat catggtcggc agcaatctca agagcagcga cagcaagcac 2340

gacttggaga ccaccctgtt ccaactggcc aatcaaccgg gacgcgacag cgccatctgg 2400

gtcaacggac agcgcattga tgccgcctcc tggcagggta gcctgcacaa cggggactgg 2460

ctgatcgatg ccaacggcaa cggctatctg ctggtgaagg ggccgacggc ggaggtccgc 2520

cgccagttac aacactcggc cgacaataag agcatggcgc cgacggaggg ggaattcagc 2580

gtcgcctggc tcaatcatgg caaggcggtc aagaatggcg cctatcagta tctggtggtg 2640

ctcgacgcca ccccgcaacg catgaaccaa ttggcgcaac agctgaagca gggtaaagcc 2700

cccttcaccg tcctgcgcag taacgacggg gttcatgtca tccgcgacaa cctcagccag 2760

gtgacggggt atgtcttcta tcgcacgcaa cgcctcaacg agggcgaggt gatcggcgtc 2820

aaccgcccgg ctatcgtgat gacccgtccg caagagggtg gcctggtgct cagcgcggta 2880

accccggatc tcaacatgac acgtcagaag gcggcgaaac cggtcaccat cgacgtcacc 2940

ctacgaggac gttggcaacc ggccacgccg gagcagggca tcgactgctc aaccagcggc 3000

gacgagacgc gactccgttt ccgcatcgac ttcggcattc cccaacagat tgcgctgaaa 3060

aaaatgcctt ga 3072

<210> 2

<211> 1023

<212> PRT

<213> polysaccharide degrading enzyme (Chond EI)

<400> 2

Met Leu Ser Met His Arg Thr Leu Leu Ala Ala Ser Ile Ala Ala Leu

1 5 10 15

Leu Leu Asn Ala Pro Leu Tyr Ala Ala Pro Asn Asp Ala Ala Ala Lys

20 25 30

Lys Arg Ala Glu Ile Met Arg Ala Gln Ile Tyr Ser Phe Asp Gln Pro

35 40 45

Ala Asp Leu Ala Asp Ile Thr Thr Thr Pro Gly Ser His Val Ala Leu

50 55 60

Ser Asp Lys Arg Ala Ile Met Gly Glu Arg Ala Leu Val Trp Asp Trp

65 70 75 80

Gln Arg Gly Ala Ser Leu Leu Leu Arg His Asp Met Glu Ile Pro Ser

85 90 95

Asp Ala Gln Val Ser Lys Ala Trp Gly Arg Ser Ala Thr Pro Val Leu

100 105 110

Ser Phe Trp Ile Tyr Asn Glu Lys Pro Ile Asp Asp Val Leu Ile Val

115 120 125

Asp Leu Gly Asn Gly Leu Asn Ala Asn Asn Glu Ala Asp Ala Gly Thr

130 135 140

Gln Val Lys Leu Asn Phe Gln Gly Trp Arg Ala Val Gly Val Ser Leu

145 150 155 160

Asn Asn Asp Leu Ala Asn Arg Glu Met Ser Gly Val Gly Val Arg Ser

165 170 175

Asp Glu Asp Ala Gly Glu Pro Ser Val Ser Arg Ser Leu Gly Lys His

180 185 190

Ile Asp Thr Ile Arg Phe Arg Ala Pro Ser Gly Glu Lys Ser Gly Arg

195 200 205

Leu Phe Ile Asp Arg Val Met Ile Ser Val Asp Asp Ala Arg Tyr Gln

210 215 220

Trp Ser Asp Tyr His Val Lys Thr Arg Tyr Asp Glu Pro Glu Ile Ala

225 230 235 240

Phe His His Ala Glu Pro Thr Leu Ala Leu Thr Ala Ala Asn Gln Ala

245 250 255

Gly Val Asp Leu Ile Arg Gln Arg Leu Ile Asp Glu Phe Val Asn Gly

260 265 270

Pro Gln Asp Ser Asn Leu Lys Ala Glu Ala Asp Leu Asn Lys Leu Arg

275 280 285

Ala Ala Phe Gln Ala Leu Gln Ile Arg Val Ala Ala Asp Gly Thr Leu

290 295 300

Ser Gly Arg His Leu Ile Thr Asp Lys Gln Lys Val Leu Tyr Gln Pro

305 310 315 320

Glu Tyr Leu Ser Ala Gln Asp Lys Ala Lys Phe Asp Arg Tyr Val Ile

325 330 335

Leu Gly Asp Tyr Thr Thr Leu Met Tyr Asn Ile Ser His Ala Tyr Leu

340 345 350

Gln Ser His Asp Ala Ala Thr Arg Lys Thr Leu Ala Asp Met Tyr Leu

355 360 365

Leu Met Thr Arg His Leu Leu Asp Gln Gly Phe Ala Lys Gly Ser Gly

370 375 380

Leu Val Thr Thr His His Trp Gly Tyr Ser Ala Arg Trp Trp Tyr Ile

385 390 395 400

Ser Ala Leu Leu Met Asn Pro Val Leu Asp Gln Ala Lys Leu Thr Gln

405 410 415

Gln Val Tyr Asp Ala Leu Leu Trp Tyr Ser Arg Glu Phe Lys Ala Ser

420 425 430

Phe Asp Met Lys Val Gly Pro Gln Ser Ser Asn Leu Asp Tyr Phe Asn

435 440 445

Thr Leu Ser Arg Gln His Leu Ala Leu Leu Leu Leu Glu Pro Asn Pro

450 455 460

Gln Gln Arg Ile Asp Leu Leu Asn Thr Phe Ser His Tyr Ile Ser Gly

465 470 475 480

Ala Leu Ala Gln Thr Pro Pro Gly Ser Asn Asp Gly Leu Arg Pro Asp

485 490 495

Gly Thr Ala Trp Arg His Glu Gly Asn Tyr Pro Gly Tyr Ser Phe Pro

500 505 510

Ala Phe Lys Asn Ala Ala Gln Leu Ala Tyr Leu Leu Arg Asp Thr Pro

515 520 525

Phe Ala Leu Gln Arg Ala Gly Leu Asp Lys Leu Lys Gln Ala Met Val

530 535 540

Ala Ala Trp Ile Tyr Ser Asn Pro Gln Thr Gly Ile Ser Leu Ala Gly

545 550 555 560

Arg His Pro Phe Asn Ser Pro Ser Leu Ala Ser Leu Thr Asn Ala Tyr

565 570 575

Tyr Trp Leu Ala Met Ala Tyr Gly Lys Lys Pro Asp Pro Thr Leu Ala

580 585 590

Ala Ile Tyr Leu Arg Leu Ala Gly Lys Ser Glu Ala Asp Ala Lys Ala

595 600 605

Leu Phe Gly Ser Ala Ile Pro Pro Ala Ala Leu Pro Gln Gly Phe Tyr

610 615 620

Ala Phe Asn Gly Gly Ala Phe Gly Ile His Arg Trp His Asp Lys Met

625 630 635 640

Val Thr Leu Lys Ala Phe Asn Ser Asn Val Trp Ser Ser Glu Ile Tyr

645 650 655

Gln Lys Asp Asn Arg Tyr Gly Arg Tyr Gln Ser His Gly Val Val Gln

660 665 670

Ile Ile Asn Gln Gly Ser Gln Glu Asp Gln Gly Tyr Arg Gln Ala Gly

675 680 685

Trp Asp Trp Asn Arg Met Pro Gly Ala Thr Thr Leu His Leu Pro Leu

690 695 700

Glu Ala Leu Asn Ser Pro Asn Arg His Thr Leu Met Gln Arg Gly Ser

705 710 715 720

His Pro Phe Ser Gly Thr Ser Ser Leu Asp Gly Arg Tyr Gly Met Leu

725 730 735

Ala Phe Asp Leu Arg Pro Met Arg Asp Gln Pro Ser Phe Asp Gln Ala

740 745 750

Leu Ser Ala Leu Lys Ser Val Leu Ala Val Asp Asp Arg Leu Ile Met

755 760 765

Val Gly Ser Asn Leu Lys Ser Ser Asp Ser Lys His Asp Leu Glu Thr

770 775 780

Thr Leu Phe Gln Leu Ala Asn Gln Pro Gly Arg Asp Ser Ala Ile Trp

785 790 795 800

Val Asn Gly Gln Arg Ile Asp Ala Ala Ser Trp Gln Gly Ser Leu His

805 810 815

Asn Gly Asp Trp Leu Ile Asp Ala Asn Gly Asn Gly Tyr Leu Leu Val

820 825 830

Lys Gly Pro Thr Ala Glu Val Arg Arg Gln Leu Gln His Ser Ala Asp

835 840 845

Asn Lys Ser Met Ala Pro Thr Glu Gly Glu Phe Ser Val Ala Trp Leu

850 855 860

Asn His Gly Lys Ala Val Lys Asn Gly Ala Tyr Gln Tyr Leu Val Val

865 870 875 880

Leu Asp Ala Thr Pro Gln Arg Met Asn Gln Leu Ala Gln Gln Leu Lys

885 890 895

Gln Gly Lys Ala Pro Phe Thr Val Leu Arg Ser Asn Asp Gly Val His

900 905 910

Val Ile Arg Asp Asn Leu Ser Gln Val Thr Gly Tyr Val Phe Tyr Arg

915 920 925

Thr Gln Arg Leu Asn Glu Gly Glu Val Ile Gly Val Asn Arg Pro Ala

930 935 940

Ile Val Met Thr Arg Pro Gln Glu Gly Gly Leu Val Leu Ser Ala Val

945 950 955 960

Thr Pro Asp Leu Asn Met Thr Arg Gln Lys Ala Ala Lys Pro Val Thr

965 970 975

Ile Asp Val Thr Leu Arg Gly Arg Trp Gln Pro Ala Thr Pro Glu Gln

980 985 990

Gly Ile Asp Cys Ser Thr Ser Gly Asp Glu Thr Arg Leu Arg Phe Arg

995 1000 1005

Ile Asp Phe Gly Ile Pro Gln Gln Ile Ala Leu Lys Lys Met Pro

1010 1015 1020

Claims

1. A polysaccharide degrading enzyme named ChondEI, characterized by the amino acid sequence shown in SEQ ID No. 2.