CN101126098B - Small disturbance RNA molecule expression carrier for differentially inhibiting GFAP protein expression and its construction method and use thereof - Google Patents
Small disturbance RNA molecule expression carrier for differentially inhibiting GFAP protein expression and its construction method and use thereof Download PDFInfo
- Publication number
- CN101126098B CN101126098B CN 200710075824 CN200710075824A CN101126098B CN 101126098 B CN101126098 B CN 101126098B CN 200710075824 CN200710075824 CN 200710075824 CN 200710075824 A CN200710075824 A CN 200710075824A CN 101126098 B CN101126098 B CN 101126098B
- Authority
- CN
- China
- Prior art keywords
- gfap
- expression vector
- sequence
- small molecules
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
The invention discloses a small interfering RNA molecule expression vector and a construction method and use thereof expressed by a specifically inhibited GFAP protein. The target of the invention is to provide a small interfering RNA molecule expression vector pressed by a specifically inhibited GFAP protein and the applications thereof for clinical treatment drug. The small interfering RNA is a double-chain RNA sequence with a sense strain of SEQ ID No.1 in the sequence list and an anti-sense strain of SEQ ID No.2 of the sequence list, or other nucleotide sequence originates from GFAP gene code region and designed according the statement of the instruction book. The constructed small molecular interfering RNA expression vector can be used for the treatment of relevant symptoms caused by abnormal GFAP gene expression. The invention has comparatively greater application value and prospect in medicine and bio-pharmacy fields.
Description
Technical field
The present invention relates to utilize siRNA molecule to suppress the method and the purposes of GFAP protein expression, method and the siRNA molecule that utilizes this method to express of particularly expressing the small molecules interference RNA of target GFAP gene with carrier for expression of eukaryon such as adenovirus are used for the related indication treatment of GFAP albumen.
Background technology
The central nervous tissue injury repairing is the difficult point of neuroscience area research always; And the factor of the local obstruction of damage neurotization is extremely complicated; In central nervous system injury reparation process; Active astrocyte (astrocyte, Ast) hyperplasia forms glial scar (glial scar), constitutes to hinder the space barrier that unfavorable nervus centralis such as axon elongation and the effective disperse of nutritional factor is repaired; Along with becoming gradually of environment in the damage is steady, astrocyte is expressed a large amount of protein-polysaccharide molecules that hinder neurotization, is the aplastic main chemical barrier of nervus centralis.Therefore, how controlling disadvantageous effect that the star gelationus produced, alleviated glial scar just becomes present stage and promotes one of research strategy of nervus centralis Regeneration and Repair.
(glial fibrillary acidic protein is the specific expressed endochylema cytoskeletal protein of astrocyte GFAP) to glial fibrillary acidic protein, is that astrocyte is loose, outgrowth physiological foundation.Damaging the active and propagation of local astrocyte is the basic mode of cns reply damage and self-regeneration; But the hyper-proliferative of the local spongiocyte in damage back, the glial scar formation that hypertrophy causes are the major obstacles that axon regeneration, neural precursor are migrated reparation; And astrocyte is expressed the chondroitin sulfate proteoglycan (Chondroitinsulphate proteoglycans CS-PGs) of justacrine in extracellular matrix: versican; Phosphocan, neurocan, brevican, NG2 etc. are the one of the main reasons that suppresses axon regeneration, therefore control the important thinking of removing inhibition axon regeneration molecule for people that is proliferated into of astrocyte; LD Moon [LD Moon; JE Brecknell, RJ Franklin, SB Dunnett; And JW Fawcett.Robustregeneration of CNS axons through a track depleted of CNS glia [J] .ExpNeurol, 2000; 161:49-66.] etc. once after removing brain injury, enlivened outgrowth astrocyte with the ethidium bromide local injection; Find that nigrostriatal bundle aixs cylinder and the regeneration of dopaminergic neuron cytoplasmic process cut off after 4 days reach peak value, and subsequently because the hyperplasia once more of spongiocyte suppresses axon regeneration again; Subsequently; It is again successively with chondrosulphatase ABC degraded CHS mucopolysaccharide side chain; And with Unidasa enzymolysis chondroitin sulfate proteoglycan molecular weight hyaluronic acid mucopolysaccharide chain; With the degraded mucinase and make CS-PGs free in extracellular matrix; 11 days immunohistochemical methodss show that enzymolysis district axon regeneration is vigorous after tractotomy is led in the long pass of dopaminergic black substance neurone, and the regeneration aixs cylinder can't get into the non-enzymolysis district of CS-PGs molecules such as being rich in neurocan, versican after passing the enzymolysis district.Investigator [KE Rhodes is arranged; LD Moon; And JW Fawcett.Inhibiting cell proliferationduring format ion of the glial scar:effects on axon regeneration inthe CNS [J] .Neuroscience; 2003; 120:41-56.] use heavy dose of x ray and topical application 2% cytosine arabinoside to reach the purpose of the star spongiocyte that kills and wounds local multiplication, after both results of study all confirmed to remove the interference of outgrowth astrocyte, local remaining axon regeneration was active; These researchs all prove removes active astrocyte; Or degrade that it secretes the chondroitin sulfate proteoglycan outside born of the same parents; Be the effective means of short axon regeneration, but the toxicity of these chemicalses makes its using value only rest on laboratory level, and since in behind central nervous system injury the effect of the stable middle astrocyte of environment most important; So how to learn the balance of holding between star glial cells hyperplasia and the inhibition, become the important point of penetration of the short regeneration strategy in damage back.
Previously existing Chinese scholars is applied to antisense technology the inhibition of glial scar; But experimental cost is high, experimental period is long, natural unfavorable factors such as link is many, inhibition inefficiency are disturbed in research owing to traditional Antisense RNA Technique, ribozyme etc. exist, so people place hope on the appearance of new antisense technology.In February, 1998 Fire [A Fire, S Xu, MK Montgomery; SA Kostas; SE Driver, and CC Mello.Potent and specific genetic interferenceby double-stranded RNA in Caenorhabditis elegans [J] .Nature, 1998; 391:806-11.] etc. on Nature, delivered first in the works at beautiful nematode (Caenorhabditiselegans) genome research; Low dose of double-stranded RNA (doublestranded RNA; DsRNA) can specificity and optionally obviously suppress the expression of goal gene; And this gene expression regulation mode is referred to as RNA disturbs (RNA interference; RNAi), The experimental results confirms subsequently: RNAi not only extensively exists in the gene regulating of fruit bat, trypanosome, turbellarian worm and vegetable cell, and in mammalian cell, has the RNAi phenomenon equally.Recently research shows; The dsRNA of different lengths can make the target gene expression level of dissimilar cells obviously reduce, and in Mammals and human cell, imports 21-23 Nucleotide (nucleot ide, (the small interfering RNA of little interferential RNA nt); SiRNA) molecule; Can make the destination gene expression of sequence homology produce the extremely strong expression inhibiting effect of specificity, compare with traditional antisense technology, the effect of RNA interferential is more powerful.Also deepening continuously in the application aspect the cell differentiation of nerve cord regulation and control at present, showing the using value that it is unique in the Neuroscience Research field.
RNA disturbs as the antisense technology that using value is arranged at present most, had been widely used in over the past two years in tumour, the antiviral and range gene functional study, but in neuroscience; Especially axoneure gene function regulation and control, signal conducting path, and the application of aspects such as neurocyte metabolism just at the early-stage, wang C, [Wang C such as Kang CS; Xia C; Bian W, Liu L, Lin W; Chen YG; Ang SL, Jing N.Cell aggregation-induced FGF8 elevation isessential for P19 cell neural differentiation [J] .Mol BiolCell.2006,17 (7): 307-84.] use in the RNAi technical study neural precursor atomization such as the effect in cell proliferation, differentiation such as FGF8 and EGFR; And recently; [Kwak YD such as Kwak YD; Choumkina E; Sugaya K.Amyloid precursor protein is involvedin staurosporine induced glial differentiation of neural progenitorcells [J] .Biochem Biophys Res Commun.2006; 344 (1): 431-7.] people uses the expression that the RNA perturbation technique suppresses amyloid precursor protein (APP), makes neuroblastoma cell system (NT-2/D1) expression amount of GFAP in atomization obviously reduce, and makes the RNAi technology deepen continuously aspect the stem cell study on regulation.RNAi molecular designing and effect screening are the keys of target gene interference effect research; Compare with RNAi molecule construction such as external synthetic, the expression cassette structure of other rnai molecule; Bob folder appearance RNA (short hairpin RNA; ShRNA) can be directly at external structure RNAi dna profiling expression vector, more synthetic siRNA tool is stability better, in mammalian cell, can not only stablize the blocking-up target gene expression; Can also arrive daughter cell by genetic stability, can substitute traditional gene knockout technology at present and set up transgenic cell line and transgenic animal.Specificity shRNA developed by molecule carrier transfectional cell after transcribe, rna plymerase iii guiding is synthetic; Directly produce 21-23nt specific effector siRNA molecule; In the RNAi effective stage; Thereby siRNA is double-stranded combine a ribozyme mixture form RNA induce reticent mixture (RNA-induced silencing complex, RISC).Activated RISC navigates on the homologous mRNA transcript through base pairing, and at the position cutting mRNA apart from 12 bases of siRNA3 ' end.Thereby make expression of target gene reticent, because directly siRNA transfection, its effect is more stable, efficient, therefore uses more extensive.Therefore, make up the shRNA expression vector and become the main means that present RNAi technology is applied to the mammalian genes functional study.
RNA disturbs the realization of inhibition of gene expression function; Depend on the selection of siRNA sequence and the structure of efficient expression vector; The inventor is on the basis of research for many years; Filter out the Optimal Jamming fragment that efficient inhibition GFAP expresses, made up the siRNA carrier for expression of eukaryon that efficient inhibition GFAP expresses, successfully accomplished the present invention.
Summary of the invention
An object of the present invention is to provide the expression vector of the small molecules interference RNA of the selectively targeted inhibition of a kind of ability GFAP genetic expression, and described expression vector can be applied to the relevant disease of GFAP expression and the treatment of symptom.
The objective of the invention is to realize like this: the small molecules interference RNA template of (1) structure or synthetic specificity GFAP gene target; (2) utilize described small molecules interference RNA template to make up small molecular interfering RNA expression vector, described expression vector can be transfected in the eukaryotic cell or in the mammalian body; (3) described expression vector be transfected in the eukaryotic cell or mammalian body in, can the expression specificity small molecules interference RNA, suppress the GFAP protein expression.
According to a preferred embodiment of the invention, wherein said small molecules interference RNA sequence is from the nucleotide sequence of GFAP gene coding region, and the GFAP gene is the proteic gene of coding GFAP.
According to a preferred embodiment of the invention; Wherein said small molecules interference RNA sequence is from the nucleotide sequence of GFAP gene coding region, and positive-sense strand sequence and antisense strand sequence are respectively 5 '-GATCCGTCAATGCCGGCTTCAAAGATTCAAGACGTCTTTGAAGCCGGCATTGATTT TTTGAATTCA-3 ' (SEQ ID NO:1) and 3 '-GCAGTTACGGCCGAAGTTTCTAAGTTCTGCAGAAACTTCGGCCGTAACTAAAAAAC TTAAGTTCGA-5 (SEQ ID NO:2); Or the nucleotide sequence that derives from the GFAP gene coding region of other principle of narrating to specifications design.
According to a preferred embodiment of the invention; Wherein said preferred small molecules interference RNA template is a synthetic Nucleotide, and positive-sense strand sequence and antisense strand sequence are respectively 5 '-GATCCGTCAATGCCGGCTTCAAAGATTCAAGACGTCTTTGAAGCCGGCATTGATTT TTTGAATTCA-3 ' (SEQ ID NO:1) and 3 '-GCAGTTACGGCCGAAGTTTCTAAGTTCTGCAGAAACTTCGGCCGTAACTAAAAAAC TTAAGTTCGA-5 (SEQ ID NO:2); Or the nucleotide sequence that derives from the GFAP gene coding region of other principle of narrating to specifications design; Wherein said nucleotide sequence can be designed to bob folder appearance shRNA molecule, and its loop-stem structure length is 9 bases.
According to a preferred embodiment of the invention, a kind of small molecular interfering RNA expression vector of GFAP gene target property, small molecules interference RNA can be expressed by expression vector and produced, also can be through the small molecules interference RNA of the synthetic corresponding sequence of instrument.
According to a preferred embodiment of the invention; Technique means such as wherein said one section oligonucleotide template can be cut through enzyme, connection are cloned into expression vector; Expression vector can be that adenovirus carrier or other can be used for the carrier that small molecules interference RNA is expressed, and carrier can be expressed small molecules interference RNA in cell.
According to a preferred embodiment of the invention; Described expression vector is to can be used for the carrier that small molecules interference RNA is expressed, and this expression vector is an adenovirus carrier; Or other can be transfected in eukaryotic cell or the human body, and in eukaryotic cell or human body, expresses other carrier of purpose Nucleotide.
According to a preferred embodiment of the invention; Wherein said expression vector can be that adenovirus carrier or other can be used for the carrier that small molecules interference RNA is expressed; Expression vector can be transfected in the eukaryotic cell or mammalian body in, and in eukaryotic cell or the corresponding small molecules interference RNA of Mammals expression in vivo.
Another object of the present invention provides a kind of RNA of utilization perturbation technique and is applied to that glial scar suppresses behind the Mammals central nervous system injury, the treatment means of short neurotization; It is characterized in that: small molecules interference RNA is through the differentially inhibiting GFAP expression of gene; Thereby suppress the proteic expression of GFAP, can be used for the related indication treatment that the GFAP protein abnormal expression causes.
According to a preferred embodiment of the invention; The small molecular interfering RNA expression vector of the GFAP gene specific that makes up can be transfected in the eukaryotic cell or in the mammalian body; The differentially inhibiting GFAP expression of gene can be used in the related indication treatment that the GFAP protein abnormal expression causes.
According to a preferred embodiment of the invention; The small molecular interfering RNA expression vector of the GFAP gene specific that makes up can be transfected in the eukaryotic cell or in the mammalian body; The differentially inhibiting GFAP expression of gene; Can be used in the treatment that relevant symptoms or treatment of diseases, especially central nervous system disease that the GFAP protein abnormal expression causes comprise the symptoms such as glial scar hyperplasia that various impairment factors cause.
Description of drawings
Fig. 1 be recombinant plasmid pGFAP-1,2,3 and negative control HK enzyme cut the evaluation collection of illustrative plates;
Fig. 2 is that interference group and control group western blot detect.
Embodiment
The detailed content of invention is described below in conjunction with embodiment; Embodiment is carried out in rat cell; The use the same method small molecular interfering RNA expression vector of constructed selectively targeted people GFAP gene of profit; And the application in the related indication treatment of people GFAP abnormal expression, also should be regarded as the protection domain of this patent.
Embodiment 1:GFAP specificity shRNA transcribes template sequence design and synthetic
Land Genebank; Retrieval GFAP gene mRNA whole coding sequence; Gene order number is GI:8393430, uses the siRNA Target Finder tool of Ambion company (www.ambion.com), and with reference to the siRNA principle of design; After 75 to the 100 base positions, target gene ORFs initiator codon " ATG " downstream or before the terminator before the 100bp, seek " AA " two and connect 19 base sequences after sequences as potential siRNA target site.Design to the non-coding region of GFAP gene mRNA 5 ' with 3 ' end, is analyzed the sequence that obtains during siRNA, selects GC content between 40% ~ 55%, and in Genebank the BLAST software retrieval to get rid of and other encoding sox homologous sequence; And introduce loop-stem structure and the transcription termination sequence of BamH I, HindIII restriction enzyme site, 9bp; To form short hairpin shRNA molecule; By the Sense+Loop+Antisense dna profiling pattern special siRNA molecular dna of the GFAP template that to have designed and synthesized three pairs of effect sequences be 19bp for screening (synthetic) by Shanghai Bo Ya company; Three couples of shRNA, called after pGFAP-1,2,3 temporarily; Its sequence is seen table 1 respectively:
Table 1pGFAP-1,2,3DNA template sequence
In the square frame is restriction enzyme site, and the loop-stem structure sequence for
formed siRNA effect of negative control double chain oligonucleotide transcription product sequence is: 5 '-GACTTCATAAGGCGCATGC-3 '.
Embodiment 2:GFAP special siRNA molecule construction of eukaryon expression plasmid for expressing and evaluation
In the design of pGFAP shRNA fragment; In pGFAP-1,2,3 templates, inserted the restriction enzyme site of EcoRl, SacI and SalI (available from Promega company) respectively; Be inserted between the HindIII and BamHI of plasmid pGenesil (, carrying the red fluorescent protein expression system) MCS available from Wuhan brilliant match biotechnology company.And EcoRI, Sacl restriction enzyme site are arranged behind the BamHl.If directed cloning is correct, pGFAP-1,2 just can be respectively cut out the little band of DNA of a treaty 400bp by EcoRI and SalI enzyme; PGFAP-3 then only can be by SalI linearizing (accompanying drawing 1 as a result); Cut identification and analysis through enzyme, recombinant plasmid pGFAP-1,2,3 and negative control HK all adhere to specification.Four groups of recombinant plasmid transformed bacterium adhere to specification through order-checking fully, no base sudden change.ShRNA encoding sequence and design template are in full accord, show that successfully making up GFAP expresses interference shRNA eucaryon plasmid expression vector.
Embodiment 3: astrocyte former being commissioned to train in spinal cord source supported and transfection
Take out and give birth to back 2-3d Wister rat, get suckling mouse myeloid tissue under the aseptic condition, divest spinal meninges and blood vessel under the dissecting microscope; Adopt twice differential adherent method to pollute after 0.125% trysinization, with the DMEM/F12 substratum that contains 20% foetal calf serum, at 37 ℃ to remove inoblast; Cultivate 8--9d under the 5%CO2 condition; After adopting succusion to remove the oligodendrocyte pollution, immunohistochemical methods confirms that cell purity is 95%, can carry out cell transfecting.Transfection previous day is by 1 * 10
6/ ml adds six orifice plates (preset in the hole and scribble the poly-lysine slide); Hatch 24h, treat that cytogamy reaches at 90% o'clock, with reference to the Invitrogen description of product; Getting 4u g pGFAP-shRNA and Control-shRNA plasmid mixes with 8-12ul Lipofectamin 2000 respectively; Behind the transfection 24h, use fresh culture instead: fluorescent microscope is observed red fluorescence-expression down after continue cultivating 48h, in substratum, adds G418 (500u g/ml) on the 5th day; Continue to cultivate: screening to be maintained is gone down to posterity after 2 times, and the G418 decrement is that 200u g/ml keeps screening pressure.The 3rd week of screening and culturing can obtain the volume positive colony; Obtain expressing the transfection spinal cord source astrocyte crowd of pGFAP shRNA and Control-shRNA, difference called after GFAP/silence1, GFAP/silence2; GFAP/silence 3, Control/silence.Every group 12 porocyte carries out follow-up expression and identifies behind the selected by flow cytometry apoptosis.
Astrocyte goes down to posterity after immunohistochemical methods identifies that purity reaches more than 90% basically through double, the star-shaped projection of cellular form, and karyon is a side relatively, and one-level branch is thicker, and projection is abundanter, and branch is more elongated.Cell transfecting 48 hours was that the transfection positive cell is expressed red fluorescent protein in the visible visual field, prove the success of pGFAPshRNA carrier eukaryotic expression, and transfection efficiency was higher.
The best shRNA molecular sequences screening of embodiment 4:GFAP-RNA interference effect
4.1 Semiquantitative reverse transcription polymerase chain reaction (RT-PCR) identifies that GFAP suppresses effect
1 selected by flow cytometry apoptosis is collected positive cell line
Get control group and transfectional cell series clone; Every group of cell is with 0.02%EDTA, 37 ℃ of 30min of 0.25% trysinization, and 400 eye mesh screens filter, with the excitated red fluorescence of 650nm wavelength laser; The overflow-type cell instrument is got RFP positive cell 2 * 10 respectively for every group to expressing RFP fluorocyte sorting counting
6, totally 4 groups, every group of 6 samples.
2 fluorescence real-time quantitative PCRs identify that GFAP suppresses effect
2.1 design of primers: GFAP, GAPDH (confidential reference items) gene test primer (Bo Ya company in Shanghai is synthetic) and pcr amplification product length are seen table 2.
Table 2GFAP, GAPDH gene PCR primer sequence
2.2Real-time quantitative PCR reaction:
Extracting four groups of total RNA of RNA disturbed specimen by the explanation of invitrogen Company products respectively with Trizol, get total RNA 2ug, is synthetic cDNA first chain of primer rt with oligo dT; With this cDNA chain 2ul is that template is carried out pcr amplification, and the outer standard substance of the quantitative fluorescent PCR of at first going make up, and reaction system is 40ul:GFAP Sense Primer, each 0.15uM of Antisense Primer, 10X PCR reaction mixture 4ul, 2.5mM MgCl
2, 200nM dNTP, 2.0U Taq archaeal dna polymerase, cDNA template strand 2ul.Reaction conditions: 94 ℃ of preparatory sex change 5min, 94 ℃ of sex change 30s, 57 ℃ of annealing 30s, 72 ℃ are extended 45s, 35 circulations, 72 ℃ are extended 5min after the loop ends.Pcr amplification product 2% agarose gel electrophoresis is cut glue and is reclaimed and to obtain target gene standard substance DNA, with ultraviolet spectrophotometer quantitatively and make purity check.
GFAP DNA amplification standard substance are by 10 times of gradient dilutions; Set up outer standard strain row; Adopt LightCycler quantitative real time PCR Instrument (Roche Holding Ag); Reaction system is 25ul, comprising: 2x Real-TimePCR mix12.5ul:1x cDNA dilution Buffer 9.5ul:SYBR Greenl 0.5ul:Sense Primer0.25ul:Antisense Primer0.25ul cDNA: template is standard substance 2ul 1.: 2. sample RT liquid 2ul:GAPDH 2ul.The PCR reaction conditions: 95 ℃-30s, 95 ℃ 0s-58 ℃ 5s-72 ℃ of 15s, 60cycles:95 ℃-0s; Melting curve 50 ' c-95 ' c:40 ' C-30s.Airborne LightCycler Data Analysis software analysis quantitative result, through GAPDH/GFAP amplification curve and typical curve, analyze pGFAP-shRNA1,2,3 and Control-shRNA transfection group/untransfected group GFAP genetic expression suppress situation.According to the typical curve equation, obtain the original template relative quantity by the Ct value.The relative quantification that the ratio of GFAP template amount and confidential reference items GAPDH is expressed as GFAP; Compare the efficient that three kinds of sequences disturb star spongiocyte GFAP to express; It is thus clear that three kinds of sequences of design all can effectively suppress the expression of GFAP, suppress efficient and be respectively 81%, 63%, 56%.Optimal Jamming sequence pGFAP-shRNA1.The result sees table 3.
Table 3 interference group and control group real-time quantitative fluorescence RT-PCR parameter and inhibition effect
4.2 immunoblotting (Western blot) identifies that GFAP suppresses effect
1. selected by flow cytometry apoptosis is collected positive cell line
Ditto respectively organize the transfection positive cell, get RFP positive cell 2 * 10 for every group with selected by flow cytometry apoptosis
6, totally four groups of 6 samples are gone the immune protein marking according to the following steps.
2. immunoblotting
After selecting cell with 4 ℃ of PBS washing three times each component respectively, add the 100ul cell pyrolysis liquid, ice bath 30min, 4 ℃ then, the centrifugal 10min of 12000rpm, behind the cracking 30min 4 ℃, the centrifugal 5min of 12000rpm gets the supernatant packing and places one 20 ℃ of preservations.(final concentration is 0.1MTris, PH6.8,4%SDS during detection frozen protein sample to be added respective volume 4 * sample-loading buffer; 20% glycerine, 0.2% tetrabromophenol sulfonphthalein, 10% β-ME); Vibration 20s adds the β mercaptoethanol, after 3-5min is boiled in water-bath; Sample thief adds each swimming lane, and the appearance total amount is 20u g on the albumen.After the SDS-PAGE gel electrophoresis separates behind the application of sample; The protein electricity is gone on the NC film; With the NC film with 5%milk/TBST confining liquid 1h after, the goat-anti rabbit two that adds anti-GFAP of rabbit one anti-(1: 200) and horseradish peroxidase-labeled successively resists (1: 5000), hatches 1h for 37 ℃; Drip working fluid (enhancing liquid and stable peroxidase solution in the ECL reagent are mixed in 1: 1 ratio), room temperature 1-1.5mim.Exposure develops photographic film, and adopts gel electrophoresis imaging analysis system, and the colour developing band of nitrocellulose filter is carried out scanning analysis, represents the protein expression amount with band gray-scale value (band area * average gray value).48h behind the astrocyte coding plamid vector transfection of spinal cord source; After the sorting of the capable RFP fluorescence of flow cytometer; To infect positive cell group cracking extracting albumen. under the prerequisite of total protein applied sample amount unanimity, carry out Westernblot and detect; The result shows (see figure 5), and star spongiocyte GFAP protein expression all receives the RNA interference behind pGFAP-shRNA1,2,3 plasmid transfections; Each group colour developing band scanning average gray is through chi square test, and experimental group GFAP expression amount is compared with control group, and there is statistical significant difference p＜0.05.PGFAP-shRNA1 group colour developing band scanning MV is minimum, and this result conforms to real-time quantitative fluorescence RT-PCR result.The result sees table 4 and accompanying drawing 5.
Table 4 interference group and control group GFAP protein expression semi-quantitative analysis
| Group | Not interference group (non-transfection group) | pGFAP -shRNA1 | pGFAP -shRNA2 | pGFAP -shRNA3 | Negative control (stochastic sequence) |
| GFAP/GAPDH (OD value) | ?10.56 * | 2.75 * | 4.81 * | 5.26 * | 10.39 |
The OD value: optical density(OD),
*Expression experimental group GFAP expresses the OD value and compares with control group, and there is statistical significant difference P＜0.05.
Short hairpin RNA (shRNA) double chain oligonucleotide of three couple of design; Express in the interference model at astrocyte GFAP; According to real-time RT-PCR and Western blot result, the efficient that is inhibited is respectively 56%, 63%, 81% candidate molecules, and to suppress efficient be 81% Optimal Jamming fragment thereby filter out GFAP; Successfully construct GFAP and express the efficient siRNA carrier for expression of eukaryon that suppresses; Because the carrier for expression of eukaryon high specificity that the present invention makes up, to suppress efficient high, for follow-up RNA perturbation technique be applied to central nervous system injury in vivo after glial scar suppress, necessary basis in early stage is established in short neurotization.
Above content is to combine concrete preferred implementation to the further explain that the present invention did, and can not assert that practical implementation of the present invention is confined to these explanations.For the those of ordinary skill of technical field under the present invention, under the prerequisite that does not break away from the present invention's design, can also make some simple deduction or replace, all should be regarded as belonging to protection scope of the present invention.
Sequence table
< 110>the attached Shenzhen of Nanfang Medical Univ hospital
< 120>siRNA molecule expression vector and the construction process and the purposes of differentially inhibiting GFAP protein expression
<140>
<141>
<160>10
<210>1
<211>66
<212>DNA
< 213>artificial sequence
<220>
< 223>according to the specific nucleotide sequence design, with template as siRNA.
<400>1
gatccgtcaa?tgccggcttc?aaagattcaa?gacgtctttg?aagccggcattgattttttg?aattca
<210>2
<211>66
<212>DNA
< 213>artificial sequence
<220>
< 223>according to the specific nucleotide sequence design, with template as siRNA.
<400>2
agcttgaatt?caaaaaatca?atgccggctt?caaagacgtc?ttgaatctttgaagccggca?ttgacg
<210>3
<211>66
<212>DNA
< 213>artificial sequence
<220>
< 223>according to the specific nucleotide sequence design, with template as siRNA.
<400>3
gatccgtgac?cgctttgcta?gctacttcaa?gacggtagct?agcaaagcggtcattttttg?agctca
<210>4
<211>66
<212>DNA
< 213>artificial sequence
<220>
< 223>according to the specific nucleotide sequence design, with template as siRNA.
<400>4
agcttgagct?caaaaaatga?ccgctttgct?agctaccgtc?ttgaagtagctagcaaagcg?gtcaca
<210>5
<211>66
<212>DNA
< 213>artificial sequence
<220>
< 223>according to the specific nucleotide sequence design, with template as siRNA.
<400>5
gatccgcctc?cagatccgag?aaaccttcaa?gacgggtttc?tcggatctggaggttttttg?tcgaca
<210>6
<211>66
<212>DNA
< 213>artificial sequence
<220>
< 223>according to the specific nucleotide sequence design, with template as siRNA.
<400>6
agcttgtcga?caaaaaacct?ccagatccga?gaaacccgtc?ttgaaggtttctcggatctg?gaggcg
<210>7
<211>20
<212>DNA
< 213>artificial sequence
<220>
< 223>according to the specific nucleotide sequence design, with primer as pcr amplification.
<400>7
ataccacccca?aaggcaatca
<210>8
<211>21
<212>DNA
< 213>artificial sequence
<220>
< 223>according to the specific nucleotide sequence design, with primer as pcr amplification.
<400>8
tctggcaacg?gtttccataa?c
<210>9
<211>21
<212>DNA
< 213>artificial sequence
<220>
< 223>according to the specific nucleotide sequence design, with primer as pcr amplification.
<400>9
catcaccatc?ttccaggagg?g
<210>10
<211>20
<212>DNA
< 213>artificial sequence
<220>
< 223>according to the specific nucleotide sequence design, with primer as pcr amplification.
<400>10
Tgaccttgcc?cacagccttg
Claims (5)
1. the construction process of the differentially inhibiting GFAP protein siRNA molecule expression vector of expressing is characterized in that: it comprises the steps: that (1) makes up or the small molecules interference RNA template of synthetic specificity GFAP gene target; (2) utilize described small molecules interference RNA template to make up small molecular interfering RNA expression vector; Be characterised in that described small molecules interference RNA sequence is selectively targeted GFAP gene,
Described small molecules interference RNA sequence is from the nucleotide sequence of GFAP gene coding region, and the GFAP gene is the proteic gene of coding GFAP;
Positive-sense strand sequence and antisense strand sequence are respectively
5 '-GATCCGTCAATGCCGGCTTCAAAGATTCAAGACGTCTTTGAAGCCGGCATTGATTT TTTGAATTCA-3 ' (SEQ ID NO:1) and
3’-GCAGTTACGGCCGAAGTTTCTAAGTTCTAAGTTCTGCAGAAACTTCGGCCGTAACTAAAAAACTTAAGTTCGA-5’(SEQ?ID?NO：2)。
2. the construction process of the siRNA molecule expression vector that differentially inhibiting GFAP protein according to claim 1 is expressed, it is characterized in that: described small molecules interference RNA template is a synthetic Nucleotide, positive-sense strand sequence and antisense strand sequence are respectively
5 '-GATCCGTCAATGCCGGCTTCAAAGATTCAAGACGTCTTTGAAGCCGGCATTGATTT TTTGAATTCA-3 ' (SEQ ID NO:1) and
3 '-GCAGTTACGGCCGAAGTTTCTAAGTTCTAAGTTCTGCAGAAACTTCGGCCGTAACT AAAAAACTTAAGTTCGA-5 ' (SEQ ID NO:2); Described nucleotide sequence is designed to bob folder appearance shRNA molecule, and its loop-stem structure length is 9 bases.
3. the differentially inhibiting GFAP protein siRNA molecule expression vector of expressing is characterized in that: it clones into by one section extraneous nucleotide that expression vector constitutes, and described extraneous nucleotide positive-sense strand sequence and antisense strand sequence are respectively
5 '-GATCCGTCAATGCCGGCTTCAAAGATTCAAGACGTCTTTGAAGCCGGCATTGATTT TTTGAATTCA-3 ' (SEQ ID NO:1) and
3’-GCAGTTACGGCCGAAGTTTCTAAGTTCTAAGTTCTGCAGAAACTTCGGCCGTAACTAAAAAACTTAAGTTCGA-5’(SEQ?ID?NO：2)。
4. the siRNA molecule expression vector that differentially inhibiting GFAP protein according to claim 3 is expressed; It is characterized in that: said expression vector is that adenovirus carrier or other can be used for the carrier that small molecules interference RNA is expressed, and carrier can be expressed small molecules interference RNA in cell.
5. the siRNA molecule expression vector of expressing according to claim 3 or 4 described differentially inhibiting GFAP proteins; It is characterized in that: said expression vector be transfected in the eukaryotic cell or mammalian body in, and in eukaryotic cell or the corresponding small molecules interference RNA of Mammals expression in vivo.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200710075824 CN101126098B (en) | 2007-07-05 | 2007-07-05 | Small disturbance RNA molecule expression carrier for differentially inhibiting GFAP protein expression and its construction method and use thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200710075824 CN101126098B (en) | 2007-07-05 | 2007-07-05 | Small disturbance RNA molecule expression carrier for differentially inhibiting GFAP protein expression and its construction method and use thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101126098A CN101126098A (en) | 2008-02-20 |
| CN101126098B true CN101126098B (en) | 2012-07-11 |
Family
ID=39094231
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 200710075824 Expired - Fee Related CN101126098B (en) | 2007-07-05 | 2007-07-05 | Small disturbance RNA molecule expression carrier for differentially inhibiting GFAP protein expression and its construction method and use thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101126098B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102671243A (en) * | 2012-05-10 | 2012-09-19 | 浙江大学 | Quaternized chitosan/siRNA composite particle-loaded skin regeneration material and preparation method thereof |
| CN107460179B (en) * | 2017-09-22 | 2021-06-29 | 青岛农业大学 | Polysaccharide degrading enzyme and coding gene and application thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2004078940A2 (en) * | 2003-03-05 | 2004-09-16 | Senesco Technologies, Inc. | USE OF ANTISENSE OLIGONUCLEOTIDES OR siRNA TO SUPPRESS EXPRESSION OF eIF-5A1 |
| WO2005017154A1 (en) * | 2003-08-18 | 2005-02-24 | Japan Health Sciences Foundation | IMPROVED siRNA MOLECULE AND METHOD OF INHIBITING GENE EXPRESSION WITH THE USE OF THE SAME |
| CN1759182A (en) * | 2002-11-22 | 2006-04-12 | 克雷顿研究院 | Compositions and systems for the regulation of genes |
-
2007
- 2007-07-05 CN CN 200710075824 patent/CN101126098B/en not_active Expired - Fee Related
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1759182A (en) * | 2002-11-22 | 2006-04-12 | 克雷顿研究院 | Compositions and systems for the regulation of genes |
| WO2004078940A2 (en) * | 2003-03-05 | 2004-09-16 | Senesco Technologies, Inc. | USE OF ANTISENSE OLIGONUCLEOTIDES OR siRNA TO SUPPRESS EXPRESSION OF eIF-5A1 |
| WO2005017154A1 (en) * | 2003-08-18 | 2005-02-24 | Japan Health Sciences Foundation | IMPROVED siRNA MOLECULE AND METHOD OF INHIBITING GENE EXPRESSION WITH THE USE OF THE SAME |
Non-Patent Citations (5)
| Title |
|---|
| Young-Don Kwak, Elena Choumkina, Kiminobu Sugaya.Amyloid precursor protein is involved in staurosporine inducedglial differentiation of neural progenitor cells.Biochemical and Biophysical Research Communications344.2006,344431-437. * |
| 付雪梅 封志纯.RNA干扰介导新生大鼠星形胶质细胞水通道蛋白-4基因沉默.中国循证儿科杂志1 4.2006,1(4),279-284. |
| 付雪梅 封志纯.RNA干扰介导新生大鼠星形胶质细胞水通道蛋白-4基因沉默.中国循证儿科杂志1 4.2006,1(4),279-284. * |
| 赵卿.应用siRNA抑制星形细胞胶质纤维酸性蛋白基因后对GFAP表达的影响.中国优秀硕士学位论文全文数据库 医药卫生科技辑 11.2006,(11),E066-67. |
| 赵卿.应用siRNA抑制星形细胞胶质纤维酸性蛋白基因后对GFAP表达的影响.中国优秀硕士学位论文全文数据库 医药卫生科技辑 11.2006,(11),E066-67. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101126098A (en) | 2008-02-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Hauptmann et al. | Biochemical isolation of Argonaute protein complexes by Ago-APP | |
| Siddique et al. | A parasitic nematode releases cytokinin that controls cell division and orchestrates feeding site formation in host plants | |
| Bu et al. | A miR-34a-numb feedforward loop triggered by inflammation regulates asymmetric stem cell division in intestine and colon cancer | |
| Sim et al. | The brain-enriched microRNA miR-9-3p regulates synaptic plasticity and memory | |
| Ly et al. | DSCAM is a netrin receptor that collaborates with DCC in mediating turning responses to netrin-1 | |
| Rodgers et al. | mTORC1 controls the adaptive transition of quiescent stem cells from G0 to GAlert | |
| CN105960459A (en) | Inhibition of NEAT1 for treatment of solid tumors | |
| Berger et al. | FACS purification and transcriptome analysis of drosophila neural stem cells reveals a role for Klumpfuss in self-renewal | |
| Indrieri et al. | Mutations in COX7B cause microphthalmia with linear skin lesions, an unconventional mitochondrial disease | |
| O'Connell et al. | Inositol phosphatase SHIP1 is a primary target of miR-155 | |
| Siegel et al. | A functional screen implicates microRNA-138-dependent regulation of the depalmitoylation enzyme APT1 in dendritic spine morphogenesis | |
| Sagane et al. | Functional specialization of cellulose synthase genes of prokaryotic origin in chordate larvaceans | |
| Szekely et al. | Werner protein protects nonproliferating cells from oxidative DNA damage | |
| Wang et al. | The RNA-binding protein QKI5 regulates primary miR-124-1 processing via a distal RNA motif during erythropoiesis | |
| US20070020652A1 (en) | Methods and compositions for RNA interference | |
| Ning et al. | Molecular mechanism of microRNA-21 promoting Schwann cell proliferation and axon regeneration during injured nerve repair | |
| Yatsenko et al. | Drosophila miR-9a targets the ECM receptor Dystroglycan to canalize myotendinous junction formation | |
| Luxenhofer et al. | MicroRNA-9 promotes the switch from early-born to late-born motor neuron populations by regulating Onecut transcription factor expression | |
| Johnson et al. | Endothelial connexin 37, connexin 40, and connexin 43 respond uniquely to substrate and shear stress | |
| Sun et al. | Circular RNAs in human and vertebrate neural retinas | |
| Yuan et al. | GFAP hyperpalmitoylation exacerbates astrogliosis and neurodegenerative pathology in PPT1-deficient mice | |
| Liu et al. | MicroRNA-206 regulates cell movements during zebrafish gastrulation by targeting prickle1a and regulating c-Jun N-terminal kinase 2 phosphorylation | |
| Bonnet et al. | Quaking RNA-binding proteins control early myofibril formation by modulating tropomyosin | |
| Doll et al. | The diversity of stomatal development regulation in Callitriche is related to the intrageneric diversity in lifestyles | |
| Feng et al. | LncRNA ELFN1-AS1 promotes retinoblastoma growth and invasion via regulating miR-4270/SBK1 axis |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20120711 Termination date: 20130705 |