CN104678092A - Application of high-positive-charge fluorescent protein in glycosaminoglycans (GAGs) and analogues of GAGs - Google Patents
Application of high-positive-charge fluorescent protein in glycosaminoglycans (GAGs) and analogues of GAGs Download PDFInfo
- Publication number
- CN104678092A CN104678092A CN201510044900.0A CN201510044900A CN104678092A CN 104678092 A CN104678092 A CN 104678092A CN 201510044900 A CN201510044900 A CN 201510044900A CN 104678092 A CN104678092 A CN 104678092A
- Authority
- CN
- China
- Prior art keywords
- glycosaminoglycan
- gags
- sample
- apply
- fluorescin
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
- G01N21/62—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
- G01N21/62—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light
- G01N21/63—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light optically excited
- G01N21/64—Fluorescence; Phosphorescence
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Immunology (AREA)
- Chemical & Material Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Analytical Chemistry (AREA)
- General Physics & Mathematics (AREA)
- Physics & Mathematics (AREA)
- Pathology (AREA)
- Engineering & Computer Science (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Biomedical Technology (AREA)
- Urology & Nephrology (AREA)
- Molecular Biology (AREA)
- Hematology (AREA)
- Investigating Or Analysing Biological Materials (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Microbiology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Medicinal Chemistry (AREA)
- Food Science & Technology (AREA)
- Biotechnology (AREA)
- Cell Biology (AREA)
Abstract
The invention relates to the application of high-positive-charge green fluorescent protein (GFP) in the research of glycosaminoglycans (GAGs), wherein the amino acid sequence of the high-positive-charge fluorescent protein is as shown in SEQ ID No. 1. According to the application of the high-positive-charge GFP, the high-positive-charge GFP is taken as a fluorescent probe with biocompatibility, high sensitivity and high selectivity for the first time and is applied to the visualization of the GAGs on the surface of a living cell, the high selectivity quantitative analysis of the GAGs in serum, the pollution analysis of excessively sulfated chondroitin sulfate in heparin, etc. Therefore, the defects that the traditional cationic dye is poor in biocompatibility, low in selectivity, low in sensitivity and the like in the detection of the GAGs can be overcome; the high-positive-charge GFP has important application value and can be widely applied to basic and application study, clinical diagnosis, detection of medicines and food, and the like which are related to the GAGs.
Description
Technical field
The present invention relates to the application of high positive charge green fluorescent protein in glycosaminoglycan research, belong to technological field of biochemistry.
Background technology
Glycosaminoglycan (Glycosaminoglycans, GAGs) is also called mucopolysaccharide, is the straight chain polyanionic polysaccharide of repetition disaccharide unit composition.Mainly comprise hyaluronic acid (Hyaluronic Acid, HA), heparin/Heparan sulfate (Heparin/Heparan Sulfate, Hep/HS), chondroitin sulfate/dermatan sulfate (Chondroitin Sulfate/Dermatan Sulfate, CS/DS), keratan sulfate (Keratan Sulfate, KS).Beyond the disaccharide unit of sulfuric acid keratan is made up of the D-galactose of neutrality and N-acetyl-glucosamine, the disaccharide unit of other GAGs is all made up of hexuronic acid (D-Glucose aldehydic acid/L-iduronic acid) and hexosamine (N-Acetyl-D-glucosamine/N-acetylgalactosamine).Wherein HA structure is relatively simple, and the disaccharide unit be made up of D-Glucose aldehydic acid and N-acetyl-glucosamine is formed by connecting through β-Isosorbide-5-Nitrae-glycosidic bond.Other GAGs then makes sugar chain become complex due to the effect of various modification enzyme, is mainly manifested in different parts hydroxyl (-OH) and amino (-NH in sugar chain
2) sulphation, D-Glucose aldehydic acid changes L-iduronic acid under the effect of C5-epimerase, the acetylation etc. of hexosamine two bit amino.This high complexity of GAGs sugar chain structure is not random generation, but there is the Space-time speciality of height, that various sugar chain synthesis relevant enzyme is caused by the different developmental phases expression regulation level of different cell tissue and organ, different structures makes it have different functions, and the complicacy of structure gives the diversity of its function.
GAGs is extensively present in zooblast cell surface and cellular matrix, by take part in various physiology and the pathologic process [1-4] such as the increment of cell and differentiation, intercellular identification, cell shift, tissue morphology occurs, canceration with the special interaction of various albumen, the a series of important biological function that GAGs has becomes important bioactive molecule, be used widely in medicine and functional food, as Hep, CS, HA etc. [5,6].
The structure of GAGs is relative to more complicated nucleic acid and protein, and its structural complexity and diversity are that its Structure and Function of research brings very large challenge.The various dye of positive ion (as: A Li Xinlan, toluidine blue and amido black etc.) is often used to dyeing and the detection of GAGs in sample.But this kind of dyestuff has a lot of shortcoming, as biocompatibility is poor, be not suitable for living cells and tissue staining; Selectivity is lower, causes the background value that appearance is very high; Sensitivity is lower.In recent years, various novel cationic chromophore is synthesized and carries out high-sensitivity detection for the Hep in damping fluid or serum, but its biocompatibility and need further research in the application of other glycosaminoglycan context of detection.Therefore, a kind of good biocompatibility, highly sensitive multi-usage GAG probe is urgently developed for the observation of GAGs in various biological sample and detection.
Green fluorescent protein (GFP) is find in the jellyfish of Aequorea victoria as far back as a kind of formal name used at school.Because the biologic facies reporter of GFP and living body biological is used to Celluar and Molecular Biology research.And GFP can be used for the Real-Time Monitoring of live body as molecular probe.Recently, by some nonconserved amino acid on GFP are sported the basic amino acid such as lysine, arginine, thus make it with a large amount of positive charges when not affecting GFP fluorescent characteristic, this high positive charge green fluorescent protein has been employed successfully in the transport agent that albumen and nucleic acid enter cell, and as the high sensitivity probe [7,8] of detection of nucleic acids.
Summary of the invention
The present invention is directed to the deficiencies in the prior art, a kind of means of detection glycosaminoglycan are newly provided, namely use high positive electricity green fluorescent protein to carry out qualitative and quantitative analysis detection to glycosaminoglycan.
Technical scheme of the present invention is as follows:
High positive charge fluorescin is as the application of fluorescent marker in glycosaminoglycan and/or the similar thing analysis of glycosaminoglycan detect, and the amino acid sequence of described high positive charge fluorescin is as shown in SEQ ID NO.1.
Preferred according to the present invention, the similar thing of described glycosaminoglycan is selected from polyanionic polysaccharide that is natural or manually semi-synthetic and full synthesis; Further preferably, the similar thing of described glycosaminoglycan is selected from: sulfated polysaccharides, polysialic acids, algin, carragheen, fucosan or lipopolysaccharides.
Preferred according to the present invention, concrete steps are as follows:
(1) make sample contact with high positive charge fluorescin, carry out hatching combination, incubation time 5 ~ 30min, hatch rear testing sample;
(2) the high positive charge fluorescin that glycosaminoglycan and/or the similar thing of glycosaminoglycan are not combined in detected sample is removed, or adopt the fluorescence quenching cancellation high positive charge fluorescin that glycosaminoglycan and/or the similar thing of glycosaminoglycan are combined in detected sample, obtained detected sample;
(3) fluorometric assay is carried out to detected sample, according to fluorescence intensity, qualitative and/or quantitative test is carried out to glycosaminoglycan in sample and/or glycosaminoglycan similar thing content.
Preferred according to the present invention, the sample in described step (1) is liquid, solid phase carrier, cell, tissue, organ.
Preferred according to the present invention, in described step (1), the exposure concentration of high positive charge fluorescin is 0.01-5.0 μ g/ml.
Preferred according to the present invention, in described step (2), fluorescence quenching is selected from: Graphene, nm of gold and/or organic molecule fluorescence quenching.
Preferred according to the present invention, in described step (3), quantitative test is the fluorescence intensity drawing standard curve by detecting different dilution standard model, linear equation is obtained according to the linear relationship between the concentration of typical curve and fluorescence intensity, the florescent intensity value of testing sample is substituted into gained linear equation, calculates the content obtaining glycosaminoglycan and/or the similar thing of glycosaminoglycan in sample.
Preferred according to the present invention, in described step (3), fluorometric assay carries out qualitative analysis for adopting fluorescent microscope, flow cytometer or living imaging equipment.
Beneficial effect
The present invention first using high positive electricity GFP (ScGFP) as biocompatibility, high sensitivity and high selectivity fluorescence probe, be applied to GAGs visual for liver cell surface, the high sensitivity quantitative test of GAGs in serum, chondroitin sulfate contamination analysis etc. oversulfated in heparin.Thus overcome the poor biocompatibility of traditional cation dyestuff in GAGs detects, the shortcoming such as selectivity is low, sensitivity is low, there is significant application value, the detection etc. of basic and applied research that GAGs is correlated with, clinical diagnosis, medicine and food can be widely used in.
Accompanying drawing explanation
Fig. 1: the polyacrylamide gel electrophoresis figure (SDS-PAGE) of high positive electricity green fluorescent protein (ScGFP) Expression and purification situation of recombinating.The sample that each swimming lane adds is respectively: M: protein molecular weight standard, and band from top to bottom size is 116kD, 66.2kD, 45kD, 35kD, 25kD, 18.4kD, 14.4kD; Swimming lane 1: thalline before control strain broken wall, applied sample amount 10 μ L, swimming lane 2: thalline before recombinant bacterium broken wall, applied sample amount 10 μ L, swimming lane 3: supernatant after recombinant bacterium broken wall, applied sample amount 10 μ L, swimming lane 4: through the ScGFP of ni-sepharose purification, applied sample amount 10 μ L.
Fig. 2: the glycosaminoglycan of variable concentrations is to the effect suppressing graphene oxide cancellation ScGFP fluorescence.A: hyaluronic acid (HA); B: chondroitin sulfate A (CSA) (CS-A); C: dermatan sulfate (DS); D: heparin (Hep).From bottom to top, the concentration of glycosaminoglycan is respectively 0, and 0.05,0.1,0.15,0.2,0.25,0.3,0.35,0.4,0.45,0.5,0.55,0.6,0.65,0.7,0.75,0.8,0.85,0.9,0.95,1 μ g/ml.
Fig. 3: the effect of the effects of heparin graphene oxide cancellation ScGFP fluorescence of variable concentrations in serum.From bottom to top, the concentration of Hep is respectively 0, and 0.05,0.1,0.15,0.2,0.25,0.3,0.35,0.4,0.45,0.5,0.55,0.6,0.65,0.7,0.75,0.8,0.85,0.9,0.95,1 μ g/ml.
Fig. 4: containing the heparin of different oversulfated chondroitin sulfate (OSCS) after heparinase degraded to the effect suppressing graphene oxide cancellation ScGFP fluorescence.
Fig. 5: the glycosaminoglycan of Laser Scanning Confocal Microscope auxiliary detection cell surface.
Fig. 6: the glycosaminoglycan of flow cytometer auxiliary detection cell surface.A: do not use ferment treatment; B: through chondroitin sulfate digestive enzyme ABC process; C: through Heparinase I, II and III process; D: through chondroitin sulfate digestive enzyme ABC and Heparinase I, II and III coprocessing.
Embodiment
The elaboration of following examples is some common technologies how implemented to disclose the present invention comprehensively, instead of in order to limit range of application of the present invention.Inventor has tried one's best the accuracy (such as measure, temperature, etc.) guaranteeing each parameter in embodiment, but some experimental errors and deviation also should be paid attention to.
The acquisition of embodiment 1, ScGFP gene
Obtained the amino acid sequence [7] of ScGFP (+36) by bibliographical information, and change the amino acid sequence of gained into corresponding base sequence, and carry out codon optimized to corresponding base, make it easier at expression in escherichia coli.Corresponding DNA sequence dna is synthesized entirely by Sheng Gong bio-engineering corporation.
The expression and purification of embodiment 2, ScGFP (+36) albumen
The ScGFP gene obtained with embodiment 1 is template, carries out pcr amplification.Primer is as follows:
Forward primer ScGFP-F:
(g
CATATGATGGGTCACCATCATCATCATCACG)
Reverse primer ScGFP-R:
(g
CTCGAGTTTGTAGCGTTCGTCACGACCGTG)
What forward primer underscore marked is restriction enzyme Nde I site, and what reverse primer underscore marked is restriction enzyme Xho I site.Double digestion is carried out to PCR primer, and the PCR primer through double digestion is connected through double digestion pET-22b carrier with same, and the recombinant plasmid (pET22b-ScGFP) that screening is positive.Gene sequencing result shows, insert ScGFP gene, and direction of insertion is correct between the Nde I and Xho I restriction enzyme site of pET-22b.
By pET22b-ScGFP transform Escherichia coli strain BL21 (DE3) (purchased from American Novagen company), the operation steps then provided according to the said firm carries out high positive electricity green fluorescent protein pET22b-ScGFP abduction delivering of recombinating.And use Ni Sepharose
tM6Fast Flow (GE) gel carries out purifying to scGFP, and purification condition operates according to the product manual of GE company.Detect the purifying situation of restructuring ScGFP with polyacrylamide gel electrophoresis, as shown in Figure 1, the restructuring ScGFP after purifying is single band to result on running gel, and the molecular weight of position and prediction matches; Through order-checking, amino acid sequence is as shown in SEQ ID NO.1.
The glycosaminoglycan of embodiment 3, variable concentrations suppresses the effect of graphene oxide cancellation scGFP fluorescence
The ScGFP of 0.01-0.5 μ g is added in 10mM Tris-HCl 100mM NaCl (pH7.0) solution, then add heparin (Hep) respectively, chondroitin sulfate A (CSA) (CS-A), dermatan sulfate (DS), hyaluronic acid (HA) make its final concentration be 0-1 μ g/ml, cumulative volume is 190 μ l, after room temperature places 10min, add the graphene oxide of 10 μ l, 10min is placed in mixing, room temperature.Fluorescent strength determining is carried out with fluorospectrophotometer (F-4600, Hitachi).Result shows, and when GAG concentration is 0-1 μ g/ml, the fluorescence intensity of reaction system and the concentration of glycosaminoglycan exist linear relationship (as Fig. 2).
The ScGFP adding 0.01-0.5 μ g in the serum of 10 times is being diluted with 10mM Tris-HCl 100mM NaCl (pH7.0), then the heparin (Hep) adding different amount respectively makes its final concentration be 0-1 μ g/ml, cumulative volume is 190 μ l, after room temperature places 10min, add the graphene oxide of 10 μ l, 10min is placed in mixing, room temperature.Fluorescent strength determining is carried out with fluorospectrophotometer (F-4600, Hitachi).Result shows, and in serum, the concentration of fluorescence intensity and Hep also exists linear relationship (as Fig. 3).The method may be used for the content detecting heparin in patients serum.
Embodiment 4, quantitative test is carried out to the heparin in blood serum sample
Heparin Standard product are dissolved in serum and are mixed with the standard solution that 100 μ l concentration are 0-10 μ g/ml by the drafting of typical curve.Get 20 μ l standard solution, add the ScGFP of 0.1 μ g, and be settled to 190 μ l with PBS, room temperature adds the graphene oxide of 10 μ l after placing 10min, and 10min is placed in mixing, room temperature.Carry out fluorescent strength determining with fluorospectrophotometer (F-4600, Hitachi), and establishing criteria solution concentration and corresponding fluorescence intensity carry out the drafting of typical curve.The typical curve of gained is: F=2.98C+126.09, and wherein F representative be fluorescence intensity, and what C represented is the concentration of heparin.
Get 20 μ l testing samples, then add the ScGFP of 0.1 μ g, and be settled to 190 μ l with PBS, room temperature adds the graphene oxide of 10 μ l after placing 10min, and 10min is placed in mixing, room temperature.Fluorescent strength determining is carried out with fluorospectrophotometer (F-4600, Hitachi).The fluorescence intensity recorded is 140.2, and bringing the concentration that typical curve can obtain heparin in blood serum sample into is 4.73 μ g/ml.
Embodiment 5, with ScGFP, the heparin polluted by oversulfated chondroitin sulfate (OSCS) to be detected
Heparin 10 μ g containing different content OSCS, with Heparinase I, the degraded of II and III appropriateness.The ScGFP of 0.01-0.5 μ g is added in 10mM Tris-Cl100mM NaCl solution, then the heparin adding pollution in solution makes its final concentration be 0-50 μ g/ml, after room temperature places 10min, add the graphene oxide of 10 μ l, adding 10mM Tris-Cl 100mMNaCl damping fluid makes its cumulative volume be 200 μ l, mixing, room temperature are placed 10min. and are finally used fluorospectrophotometer (F-4600, Hitachi) to measure.Result shows, and the content of OSCS is greater than 10
-6during %, detect by method of the present invention, as shown in Figure 4, the method detecting heparin pollution than the major part existed now is all simple and sensitive for result.
Embodiment 6, with ScGFP, Visual retrieval is carried out to the glycosaminoglycan of cell surface
Be that appropriate A549 cell cultivated by double dish at the bottom of the cover glass of 35mm at diameter, Dual culture 5 coils, wherein a dish Heparinase I, II and III process, the chondroitin sulfate digestive enzyme ABC process of one dish, one dish, two kinds of enzyme coprocessing, also have two dishes without ferment treatment, 30 DEG C of process 1-5h.All 5 dish cells are all dyeed with DAPI, except a cell coiled without ferment treatment does not add ScGFP as negative control, remaining adds 0.1-10 μ g ScGFP (200 μ l PBS) and hatches 5-30min, then uses 100-1, and 000 μ l PBS washs 2-5 time.Carry out confocal microscopy (LSM 700, Zeiss).Excitation wavelength is respectively 405nm and 488nm.Result shows, and compared with the control, ScGFP dyes strongly to cell surface, processes respectively with enzyme heparinase or chondrosulphatase, and the ScGFP fluorescent dye of cell significantly weakens; When adding two kinds of enzymes, cell surface fluorescence dyeing is basic eliminates (as Fig. 5).Illustrate that ScGFP can specificly be combined with the glycosaminoglycan of cell surface, simultaneous verification ScGFP has good histocompatbility, may be used for the detection of the glycosaminoglycan of rear biological cells and tissues.
Be that 10cm Tissue Culture Dish cultivates full 2 plate 293T cells with diameter, then cell blown outstanding, be divided into 4 parts.A Heparinase I, II and III process, it is a that with chondroitin sulfate digestive enzyme ABC process, one dish, two kinds of enzyme coprocessing, also have two parts without ferment treatment, with PBS polishing 500 μ l, 30 DEG C of process 1-5h.With PBS washing 2-5 time after process, each 1-5ml.Then every part adds 0.5-3 μ g ScGFP (100 μ l), and room temperature places 10min.With PBS washing 2-5 time, each 1-5ml.Finally filter and carry out flow cytometer (FACS Aria III, BD) analysis.Result shows, and compared with the control, dies down by the ScGFP fluorescence intensity of the cell of ferment treatment; When adding two kinds of enzymes, fluorescence intensity the most weak (as Fig. 6).This also illustrates that ScGFP can specificly be combined with the glycosaminoglycan of cell surface, and utilizes the method can carry out quantitative test to the glycosaminoglycan of cell surface.
List of references
1.Takagaki K,Nakamura T,Takeda Y,Daidouji K,Endo M.A new endo-beta-galactosidase acting on the Gal beta 1-3Gal linkage of the proteoglycan linkage region.J Biol Chem1992,267:18558-18563.
2.Silbert JE,Sugumaran G.Biosynthesis of chondroitin/dermatan sulfate.Iubmb Life2002,54:177-186.
3.Sugahara K,Mikami T,Uyama T,Mizuguchi S,Nomura K,Kitagawa H.Recent advances in the structural biology of chondroitin sulfate and dermatan sulfate.Curr Opin Struct Biol2003,13:612-620.
4.Izumikawa T,Kitagawa H,Mizuguchi S,Nomura KH,Nomura K,Tamura J,et al.Nematode chondroitin polymerizing factor showing cell-/organ-specific expression is indispensable for chondroitin synthesis and embryonic cell division.J Biol Chem 2004,279:53755-53761.
5.Jiang D,Liang J,Noble PW.Hyaluronan in tissue injury and repair.In:Annu Rev Cell Dev Biol 2007.pp.435-461.
6.Noble PW.Hyaluronan and its catabolic products in tissue injury and repair.Matrix Biol2002,21:25-29.
7.Lawrence MS,Phillips KJ,Liu DR.Supercharging proteins can impart unusual resilience.J Am Chem Soc 2007,129:10110-10112.
8.Lei C,Huang Y,Nie Z,Hu J,Li L,Lu G,Han Y,Yao S.A supercharged fluorescent protein as a versatile probe for homogeneous DNA detection and methylation analysis.Angew Chem Int Ed Engl.2014,53:8358-8362.
Claims (9)
1. high positive charge fluorescin is as the application of fluorescent marker in glycosaminoglycan and/or the similar thing analysis of glycosaminoglycan detect, and the amino acid sequence of described high positive charge fluorescin is as shown in SEQ ID NO.1.
2. apply as claimed in claim 1, it is characterized in that, the similar thing of described glycosaminoglycan is selected from polyanionic polysaccharide that is natural or manually semi-synthetic and full synthesis.
3. apply as claimed in claim 2, it is characterized in that, the similar thing of described glycosaminoglycan is selected from: sulfated polysaccharides, polysialic acids, algin, carragheen, fucosan or lipopolysaccharides.
4. apply as claimed in claim 1, it is characterized in that, concrete steps are as follows:
(1) make sample contact with high positive charge fluorescin, carry out hatching combination, incubation time 5 ~ 30min, hatch rear testing sample;
(2) the high positive charge fluorescin that glycosaminoglycan and/or the similar thing of glycosaminoglycan are not combined in detected sample is removed, or adopt the fluorescence quenching cancellation high positive charge fluorescin that glycosaminoglycan and/or the similar thing of glycosaminoglycan are combined in detected sample, obtained detected sample;
(3) fluorometric assay is carried out to detected sample, according to fluorescence intensity, qualitative and/or quantitative test is carried out to glycosaminoglycan in sample and/or glycosaminoglycan similar thing content.
5. apply as claimed in claim 4, it is characterized in that, the sample in described step (1) is liquid, solid phase carrier, cell, tissue, organ.
6. apply as claimed in claim 4, it is characterized in that, in described step (1), the exposure concentration of high positive charge fluorescin is 0.01-5.0 μ g/ml.
7. apply as claimed in claim 4, it is characterized in that, in described step (2), fluorescence quenching is selected from: Graphene, nm of gold and/or organic molecule fluorescence quenching.
8. apply as claimed in claim 4, it is characterized in that, in described step (3), quantitative test is the fluorescence intensity drawing standard curve by detecting different dilution standard model, linear equation is obtained according to the linear relationship between the concentration of typical curve and fluorescence intensity, the florescent intensity value of testing sample is substituted into gained linear equation, calculates the content obtaining glycosaminoglycan and/or the similar thing of glycosaminoglycan in sample.
9. apply as claimed in claim 4, it is characterized in that, in described step (3), fluorometric assay carries out qualitative analysis for adopting fluorescent microscope, flow cytometer or living imaging equipment.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510044900.0A CN104678092B (en) | 2015-01-28 | 2015-01-28 | Application of the positive charge fluorescin high in glycosaminoglycan analysis detection |
| PCT/CN2015/097648 WO2016119536A1 (en) | 2015-01-28 | 2015-12-17 | Application of high-positive-charge fluorescent protein in analysis and detection of glycosaminoglycans and analogues thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510044900.0A CN104678092B (en) | 2015-01-28 | 2015-01-28 | Application of the positive charge fluorescin high in glycosaminoglycan analysis detection |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104678092A true CN104678092A (en) | 2015-06-03 |
| CN104678092B CN104678092B (en) | 2017-06-06 |
Family
ID=53313437
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510044900.0A Active CN104678092B (en) | 2015-01-28 | 2015-01-28 | Application of the positive charge fluorescin high in glycosaminoglycan analysis detection |
Country Status (2)
| Country | Link |
|---|---|
| CN (1) | CN104678092B (en) |
| WO (1) | WO2016119536A1 (en) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105606827A (en) * | 2016-03-14 | 2016-05-25 | 山东大学 | Kit for high-sensitivity detection on proteoglycan and preparation method of kit |
| WO2016119536A1 (en) * | 2015-01-28 | 2016-08-04 | 山东大学 | Application of high-positive-charge fluorescent protein in analysis and detection of glycosaminoglycans and analogues thereof |
| CN107085109A (en) * | 2017-05-15 | 2017-08-22 | 山东大学深圳研究院 | Application of the high positive charge green fluorescent protein in hepatocarcinoma early diagnosis kit is prepared |
| CN107460179A (en) * | 2017-09-22 | 2017-12-12 | 青岛农业大学 | A kind of polysaccharide degrading enzyme and its encoding gene and application |
| CN107991294A (en) * | 2017-11-28 | 2018-05-04 | 陕西慧康生物科技有限责任公司 | A kind of detection method of poly sialic acid |
| CN108195808A (en) * | 2017-12-26 | 2018-06-22 | 中国石油大学(华东) | A kind of method for detecting oversulfated chondroitin sulfate in sodium heparin class impurity |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101490548A (en) * | 2006-06-02 | 2009-07-22 | 哈佛大学校长及研究员协会 | Protein surface remodeling |
| US20140011214A1 (en) * | 2012-05-21 | 2014-01-09 | Colorado State University Research Foundation | Detection of biopolymer interactions, cancer cells, and pathogens using split-supercharged gfp |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104678092B (en) * | 2015-01-28 | 2017-06-06 | 山东大学 | Application of the positive charge fluorescin high in glycosaminoglycan analysis detection |
-
2015
- 2015-01-28 CN CN201510044900.0A patent/CN104678092B/en active Active
- 2015-12-17 WO PCT/CN2015/097648 patent/WO2016119536A1/en active Application Filing
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101490548A (en) * | 2006-06-02 | 2009-07-22 | 哈佛大学校长及研究员协会 | Protein surface remodeling |
| US20140011214A1 (en) * | 2012-05-21 | 2014-01-09 | Colorado State University Research Foundation | Detection of biopolymer interactions, cancer cells, and pathogens using split-supercharged gfp |
Non-Patent Citations (2)
| Title |
|---|
| CHUNYANG LEI 等: "A Supercharged Fluorescent Protein as a Versatile Probe for Homogeneous DNA Detection and Methylation Analysis", 《ANGEWANDTE CHEMIE INTERNATIONAL EDITION》 * |
| 张莉 等: "糖胺聚糖分析测定的研究进展", 《分析化学》 * |
Cited By (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2016119536A1 (en) * | 2015-01-28 | 2016-08-04 | 山东大学 | Application of high-positive-charge fluorescent protein in analysis and detection of glycosaminoglycans and analogues thereof |
| CN105606827A (en) * | 2016-03-14 | 2016-05-25 | 山东大学 | Kit for high-sensitivity detection on proteoglycan and preparation method of kit |
| WO2017157194A1 (en) * | 2016-03-14 | 2017-09-21 | 山东大学 | Kit for proteoglycans high sensitivity detection and manufacturing method for same |
| CN105606827B (en) * | 2016-03-14 | 2017-12-12 | 山东大学 | A kind of kit for proteoglycans high-sensitivity detection and preparation method thereof |
| CN107085109A (en) * | 2017-05-15 | 2017-08-22 | 山东大学深圳研究院 | Application of the high positive charge green fluorescent protein in hepatocarcinoma early diagnosis kit is prepared |
| CN107460179A (en) * | 2017-09-22 | 2017-12-12 | 青岛农业大学 | A kind of polysaccharide degrading enzyme and its encoding gene and application |
| CN107460179B (en) * | 2017-09-22 | 2021-06-29 | 青岛农业大学 | Polysaccharide degrading enzyme and coding gene and application thereof |
| CN107991294A (en) * | 2017-11-28 | 2018-05-04 | 陕西慧康生物科技有限责任公司 | A kind of detection method of poly sialic acid |
| CN107991294B (en) * | 2017-11-28 | 2020-11-06 | 陕西慧康生物科技有限责任公司 | Method for detecting polysialic acid |
| CN108195808A (en) * | 2017-12-26 | 2018-06-22 | 中国石油大学(华东) | A kind of method for detecting oversulfated chondroitin sulfate in sodium heparin class impurity |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2016119536A1 (en) | 2016-08-04 |
| CN104678092B (en) | 2017-06-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104678092B (en) | Application of the positive charge fluorescin high in glycosaminoglycan analysis detection | |
| Laurent et al. | The properties and turnover of hyaluronan | |
| Leroy | Connective tissue synthesis by scleroderma skin fibroblasts in cell culture | |
| Westergren-Thorsson et al. | Increased deposition of glycosaminoglycans and altered structure of heparan sulfate in idiopathic pulmonary fibrosis | |
| Coulson-Thomas et al. | Dimethylmethylene blue assay (DMMB) | |
| Kuiper et al. | A detailed quantitative outcome measure of glycosaminoglycans in human articular cartilage for cell therapy and tissue engineering strategies | |
| JP2002520029A (en) | Method for selecting potential antimetastatic and anti-inflammatory drugs using mammalian heparanase as a probe | |
| CN108553481A (en) | It is a kind of that there is the carbohydrate composition for promoting wound healing effect and its application | |
| Brézillon et al. | Probing glycosaminoglycan spectral signatures in live cells and their conditioned media by Raman microspectroscopy | |
| Zhao et al. | Diabetes results in structural alteration of chondroitin sulfate in the urine | |
| Monroe et al. | Heterogeneous multi-laminar tissue constructs as a platform to evaluate aortic valve matrix-dependent pathogenicity | |
| Ha et al. | Characterization of heparan sulfate from the unossified antler of Cervus elaphus | |
| Dellias et al. | Structural composition and differential anticoagulant activities of dermatan sulfates from the skin of four species of rays, Dasyatis americana, Dasyatis gutatta, Aetobatus narinari and Potamotrygon motoro | |
| Danes et al. | Further studies on metachromasia in cultured human fibroblasts: staining of glycosaminoglycans (mucopolysaccharides) by alcian blue in salt solutions | |
| CN103869002B (en) | Analysis method for determining oligomerization thelenota ananas glycosaminoglycan content | |
| Petit et al. | Controlled sulfatation of natural anionic bacterial polysaccharides can yield agents with specific regenerating activity in vivo | |
| Cruz et al. | Structural elucidation of an acidic galactan from the eggs of mollusc Pomacea lineata | |
| US20160201112A1 (en) | Nanosensor for detecting the activity of glycosaminoglycan-cleaving enzymes and uses thereof | |
| Volpi et al. | Agarose-gel electrophoresis for the quality assurance and purity of heparin formulations | |
| Qin et al. | Unique structural characteristics and biological activities of heparan sulfate isolated from the mantle of the scallop Chlamys farreri | |
| Carnachan et al. | Heparan sulfate identification and characterisation: method I. Heparan sulfate identification by NMR analysis | |
| Koźma et al. | Glycosaminoglycans of human serum and their alterations in diabetes mellitus | |
| Lan et al. | A single injection of bleomycin reduces glycosaminoglycan sulfation up to 30 days in the C57BL/6 mouse model of lung fibrosis | |
| RU2196988C2 (en) | Method for diagnostics of mucopolysaccharidosis | |
| Németh-Csóka et al. | Biological significance of helical conformation of acid polysaccharides |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |