WO2016119536A1 - Application of high-positive-charge fluorescent protein in analysis and detection of glycosaminoglycans and analogues thereof - Google Patents

Abstract

The invention relates to an application of a high positive-charge green fluorescent protein (GFP) in the research of glycosaminoglycans (GAGs), an amino acid sequence of the high-positive-charge fluorescent protein being that shown in SEQ ID NO. 1. The method comprises: applying the high-positive-charge GFP as a fluorescent probe with biocompatibility, high sensitivity and high selectivity to visualization of GAGs on the surface of a living cell, high-selectivity quantitative analysis of GAGs in a serum, pollution analysis of excessively sulfated chondroitin sulfate in heparin, etc., thereby overcoming the defects of poor biocompatibility, low selectivity and low sensitivity, etc. of conventional cationic dyes in GAGs detection. The present invention has a high application value and can be widely applied to GAG-related fundamental and applied research, clinical diagnosis, analysis of medicines and food, etc.

Description

Application of high positive charge fluorescent protein in the detection and detection of glycosaminoglycans and their analogues Technical field

The invention relates to the application of a high positive green fluorescent protein in the study of glycosaminoglycans, and belongs to the field of biochemical technology.

Background technique

Glycosaminoglycans (GAGs), also known as mucopolysaccharides, are linear polyanionic polysaccharides composed of repeating disaccharide units. Mainly including Hyaluronic Acid (HA), Heparin/Heparan Sulfate (Hep/HS), Chondroitin Sulfate/Dermatan Sulfate (CS/DS), Keratin Sulfate (Keratan Sulfate, KS). In addition to the disaccharide units of keratan sulfate, which are composed of neutral D-galactose and N-acetylglucosamine, the disaccharide units of other GAGs are derived from hexuronic acid (D-glucuronic acid/L-Edu Uronic acid) is composed of hexosamine (N-acetylglucosamine/N-acetylgalactosamine). Among them, the HA structure is relatively simple, and a disaccharide unit composed of D-glucuronic acid and N-acetylglucosamine is linked by a β-1,4-glycosidic bond. Other GAGs make the sugar chain extremely complicated due to the action of various modified enzymes, mainly in the sulfation of hydroxyl (-OH) and amino (-NH ₂ ) in different parts of the sugar chain, and D-glucuronic acid in C5- Under the action of epimerase, it is converted into L-iduronic acid, acetylation of the di-amino group of hexosamine, and the like. The high complexity of the GAGs sugar chain structure is not random, but has a high temporal and spatial specificity, which is caused by the expression level of various sugar chain synthesis related enzymes in different developmental stages of different cell tissues and organs. Structures have different functions, and the complexity of the structure gives them a diversity of functions.

GAGs are widely distributed on the cell surface and cell matrix of animal cells. They participate in various physiological and pathological processes such as cell proliferation and differentiation, cell-to-cell recognition, cell transfer, tissue morphogenesis, and carcinogenesis through specific interactions with various proteins. [1-4], a series of important biological functions of GAGs make it an important bioactive molecule, widely used in medicine and functional foods, such as Hep, CS, HA, etc. [5,6].

The structure of GAGs is more complex than nucleic acids and proteins, and its structural complexity and diversity pose great challenges for studying the relationship between structure and function. Various cationic dyes (eg, alixin blue, toluidine blue, and amide black) are often used for the staining and detection of GAGs in samples. However, such dyes have many disadvantages, such as poor biocompatibility, and are not suitable for staining living cells and tissues; low selectivity, resulting in high background values; low sensitivity. In recent years, various novel cationic chromophores have been synthesized and used for high sensitivity detection of Hep in buffer or serum, but their biocompatibility and application in the detection of other glycosaminoglycans need further study. Therefore, it is urgent to develop a biocompatible, highly sensitive multi-purpose GAG probe for the observation and detection of GAGs in various biological samples.

Green fluorescent protein (GFP) was first discovered in a jellyfish named Aequorea victoria. Because GFP and biofilm reporter genes for living organisms are used in cell biology and molecular biology research. And GFP can be used as a molecular probe for real-time monitoring of living organisms. Recently, by mutating some non-conservative amino acids on GFP to basic amino acids such as lysine and arginine, a large amount of positive charge is carried out without affecting the fluorescence characteristics of GFP. Charge green fluorescent protein has been successfully used as a transport vector for proteins and nucleic acids to enter cells, and as a highly sensitive probe for nucleic acid detection [7,8].

Summary of the invention

The invention aims at the deficiencies of the prior art, and provides a novel means for detecting glycosaminoglycans, that is, qualitative and quantitative analysis and detection of glycosaminoglycans by using high positive green fluorescent protein.

The technical solution of the present invention is as follows:

The use of a highly positively charged fluorescent protein as a fluorescent marker for the detection of glycosaminoglycans and/or glycosaminoglycan analogs, the amino acid sequence of which is shown in SEQ ID NO.

According to a preferred embodiment of the present invention, the glycosaminoglycan analog is selected from a natural or artificial semi-synthetic and fully synthetic polyanionic polysaccharide; further preferably, the glycosaminoglycan analog is selected from the group consisting of: a sulfated polysaccharide, and more Polysialic acid, alginate, carrageenan, fucoidan or lipopolysaccharide.

According to a preferred embodiment of the invention, the specific steps are as follows:

(1) contacting the sample with a highly positively charged fluorescent protein, incubated and incubated for 5 to 30 minutes, and the sample to be tested after incubation;

(2) removing a highly positively charged fluorescent protein that is not bound to the glycosaminoglycan and/or glycosaminoglycan analog in the sample to be detected, or quenching the glycosaminoglycan and/or the sample to be detected using a fluorescence quencher and/or Or a high positively charged fluorescent protein bound by a glycosaminoglycan analog to prepare a sample to be tested;

(3) The sample to be tested is subjected to fluorescence measurement, and the content of glycosaminoglycan and/or glycosaminoglycan analogue in the sample is qualitatively and/or quantitatively analyzed according to the fluorescence intensity.

According to a preferred embodiment of the invention, the sample in step (1) is a liquid, a solid phase carrier, a cell, a tissue, an organ.

According to the preferred embodiment of the present invention, in the step (1), the contact concentration of the high positively charged fluorescent protein is 0.01 to 5.0 μg/ml.

According to a preferred embodiment of the present invention, in the step (2), the fluorescence quencher is selected from the group consisting of graphene, nano gold, and/or an organic small molecule fluorescence quencher.

According to the preferred method of the present invention, in the step (3), the quantitative analysis is to draw a standard curve by detecting the fluorescence intensity of the standard sample of different dilutions, and obtain a linear equation according to the linear relationship between the concentration of the standard curve and the fluorescence intensity, The fluorescence intensity value of the sample to be tested is substituted into the obtained linear equation, and the content of glycosaminoglycan and/or glycosaminoglycan analog in the sample is calculated.

Preferably, in the step (3), the fluorescence is determined by qualitative analysis using a fluorescence microscope, a flow cytometer or a living imaging device.

Beneficial effect

The present invention is the first to use high-positive GFP (ScGFP) as a biocompatible, highly sensitive and highly selective fluorescent probe for visualization of GAGs for living cell surface, high sensitivity quantitative analysis of GAGs in serum, heparin Chondroitin sulfate contamination analysis of persulfation. Therefore, it overcomes the shortcomings of traditional cationic dyes in the detection of GAGs, such as poor biocompatibility, low selectivity and low sensitivity. It has important application value and can be widely used in basic and applied research, clinical diagnosis, medicine and food related to GAGs. Detection, etc.

DRAWINGS

Figure 1: Polyacrylamide gel electrophoresis pattern (SDS-PAGE) of recombinant high positive green fluorescent protein (ScGFP) expression and purification. The samples added in each lane were: M: protein molecular weight standard, the strip size was 116kD, 66.2kD, 45kD, 35kD, 25kD, 18.4kD, 14.4kD from top to bottom; lane 1: pre-broken cells of the control strain, The sample volume was 10 μL, lane 2: the pre-debrided cell was pre-broken, the sample volume was 10 μL, lane 3: the supernatant of the recombinant strain was broken, and the sample volume was 10 μL. Lane 4: ScGFP purified by nickel column, loading amount 10 μL.

Figure 2: Effect of different concentrations of glycosaminoglycans on inhibition of graphene oxide quenching ScGFP fluorescence. A: hyaluronic acid (HA); B: chondroitin sulfate A (CS-A); C: dermatan sulfate (DS); D: heparin (Hep). From bottom to top, the glycosaminoglycan concentrations were 0, 0.05, 0.1, 0.15, 0.2, 0.25, 0.3, 0.35, 0.4, 0.45, 0.5, 0.55, 0.6, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9, respectively. 0.95, 1μg/ml.

Figure 3: Different concentrations of heparin in serum inhibit the effect of graphene oxide on quenching ScGFP fluorescence. From bottom to top, the concentrations of Hep are 0, 0.05, 0.1, 0.15, 0.2, 0.25, 0.3, 0.35, 0.4, 0.45, 0.5, 0.55, 0.6, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9, 0.95, 1 μg, respectively. /ml.

Figure 4: Effect of heparin containing different persulfated chondroitin sulfate (OSCS) on inhibition of graphene oxide quenching of ScGFP fluorescence after heparinase degradation.

Figure 5: Confocal microscopy assisted detection of glycosaminoglycans on the cell surface.

Figure 6: Flow cytometry assisted detection of glycosaminoglycans on the cell surface. A: not treated with enzyme; B: treated with chondroitin sulfate degrading enzyme ABC; C: treated with heparinase I, II and III; D: co-sulfated chondroitin-degrading enzyme ABC and heparinase I, II and III deal with.

detailed description

The following examples are set forth to fully disclose some of the common techniques of the present invention, and are not intended to limit the scope of application of the present invention. The inventors have made every effort to ensure the accuracy of the parameters in the examples (eg, amount, temperature, etc.), but some experimental errors and deviations should also be considered.

Example 1. Acquisition of ScGFP gene

The amino acid sequence of ScGFP (+36) was obtained by literature reports [7], and the obtained amino acid sequence was converted into the corresponding base sequence, and the corresponding base was codon optimized to make it easier in Escherichia coli. expression. The corresponding DNA sequence was fully synthesized by Biotech Engineering.

Example 2. Expression and purification of ScGFP(+36) protein

The ScGFP gene obtained in Example 1 was used as a template to carry out PCR amplification. The primers are as follows:

Forward primer ScGFP-F:

( gCATATG ATGGGTCACCATCATCATCATCACG)

Reverse primer ScGFP-R:

(g CTCGAG TTTGTAGCGTTCGTCACGACCGTG)

The forward primer is underlined with the restriction endonuclease Nde I site, and the reverse primer is underlined with the restriction endonuclease Xho I site. The PCR product was double-digested, and the double-digested PCR product was also subjected to double digestion. The pET-22b vector was ligated and the positive recombinant plasmid (pET22b-ScGFP) was screened. The gene sequencing results showed that the ScGFP gene was inserted between the Nde I and Xho I restriction sites of pET-22b, and the insertion direction was correct.

pET22b-ScGFP was transformed into E. coli strain BL21 (DE3) (purchased from Novagen, USA), and then subjected to recombinant high-positive green fluorescent protein pET22b-ScGFP-induced expression according to the procedure provided by the company. ScGFP gel and purified according to purification conditions GE's product manual manipulation ^{Ni Sepharose TM 6Fast Flow (GE)} . The purification of recombinant ScGFP was detected by polyacrylamide gel electrophoresis. The results showed that the purified recombinant ScGFP showed a single band on the electrophoresis gel and its position was consistent with the predicted molecular weight. After sequencing, the amino acid sequence was as follows. SEQ ID NO. 1 is shown.

Example 3: Different concentrations of glycosaminoglycan inhibit the effect of graphene oxide on quenching scGFP fluorescence

0.01-0.5 μg of ScGFP was added to a solution of 10 mM Tris-HCl 100 mM NaCl (pH 7.0), and then heparin (Hep), chondroitin sulfate A (CS-A), dermatan sulfate (DS), hyaluronic acid were separately added. (HA) The final concentration was 0-1 μg/ml, and the total volume was 190 μl. After standing at room temperature for 10 min, 10 μl of graphene oxide was added, mixed, and allowed to stand at room temperature for 10 min. Fluorescence intensity measurement was performed using a fluorescence spectrophotometer (F-4600, Hitachi). The results showed that there was a linear relationship between the fluorescence intensity of the reaction system and the concentration of glycosaminoglycan at a glycosaminoglycan concentration of 0-1 μg/ml (Fig. 2).

0.01-0.5 μg of ScGFP was added to the serum diluted 10-fold with 10 mM Tris-HCl 100 mM NaCl (pH 7.0), and then different amounts of heparin (Hep) were added thereto to a final concentration of 0-1 μg/ml. After 190 μl and room temperature for 10 min, 10 μl of graphene oxide was added, mixed, and allowed to stand at room temperature for 10 min. Fluorescence intensity measurement was performed using a fluorescence spectrophotometer (F-4600, Hitachi). The results showed a linear relationship between fluorescence intensity and Hep concentration in serum (Figure 3). This method can be used to detect the amount of heparin in the patient's serum.

Example 4, Quantitative Analysis of Heparin in Serum Samples

The standard curve was drawn, and the heparin standard was dissolved in serum to prepare 100 μl of a standard solution having a concentration of 0-10 μg/ml. 20 μl of the standard solution was added, 0.1 μg of ScGFP was added, and the volume was adjusted to 190 μl with PBS. After standing at room temperature for 10 min, 10 μl of graphene oxide was added, mixed, and left at room temperature for 10 min. The fluorescence intensity was measured by a fluorescence spectrophotometer (F-4600, Hitachi), and a standard curve was drawn based on the standard solution concentration and the corresponding fluorescence intensity. The resulting standard curve is: F = 2.98C + 126.09, where F represents the fluorescence intensity and C represents the concentration of heparin.

20 μl of the sample to be tested was taken, then 0.1 μg of ScGFP was added, and the volume was adjusted to 190 μl with PBS. After standing at room temperature for 10 min, 10 μl of graphene oxide was added, mixed, and left at room temperature for 10 min. Fluorescence intensity measurement was performed using a fluorescence spectrophotometer (F-4600, Hitachi). The measured fluorescence intensity was 140.2, and the concentration of heparin in the serum sample was 4.73 μg/ml.

Example 5: Detection of heparin contaminated with persulfated chondroitin sulfate (OSCS) with ScGFP

10 μg of heparin containing different levels of OSCS was moderately degraded with heparinase I, II, and III. Add 0.01-0.5 μg of ScGFP to 10 mM Tris-Cl 100 mM NaCl solution, then add contaminating heparin to the solution to a final concentration of 0-50 μg/ml. After standing at room temperature for 10 min, add 10 μl of graphene oxide and add 10 mM. Tris-Cl 100 mM NaCl buffer was used to make a total volume of 200 μl, mixed, and allowed to stand at room temperature for 10 min. Finally, the measurement was carried out by a fluorescence spectrophotometer (F-4600, Hitachi). The results show that when the content of OSCS is more than 10 ^-6 %, it is detected by the method of the present invention, and the results are as shown in Fig. 4, which is simpler and more sensitive than most existing methods for detecting heparin contamination.

Example 6. Visual detection of glycosaminoglycans on cell surface with ScGFP

A suitable amount of A549 cells were cultured on a 35 mm diameter cover glass culture dish, and a total of 5 plates were cultured, one of which was treated with heparinase I, II, and III, and one plate was treated with chondroitin sulfate degrading enzyme ABC. The plates were co-treated with two enzymes, and two plates were treated without enzymes and treated at 30 ° C for 1-5 h. All 5 cells were stained with DAPI, except that one cell without enzyme treatment was not added with ScGFP as a negative control, and the rest was added with 0.1-10 μg ScGFP (200 μl PBS) for 5-30 min, then 100-1,000 μl PBS. Wash 2-5 times. Confocal microscopy (LSM 700, Zeiss) was performed. The excitation wavelengths were 405 nm and 488 nm, respectively. The results showed that compared with the control, ScGFP strongly stained the cell surface, and treated with enzyme heparinase or chondroitinase separately, the ScGFP fluorescence staining of the cells was significantly weakened; when two enzymes were added, the cell surface fluorescence staining was basically eliminated (such as Figure 5). It is indicated that ScGFP can specifically bind to glycosaminoglycans on the cell surface, and it is proved that ScGFP has good histocompatibility and can be used for the detection of glycosaminoglycans in post-cells and tissues.

Two plates of 293T cells were cultured in a 10 cm diameter cell culture dish, and then the cells were suspended and divided into 4 portions on average. One was treated with heparinase I, II, and III, one was treated with chondroitin sulfate degrading enzyme ABC, one plate was treated with two enzymes, and two were treated without enzyme, supplemented with PBS 500 μl, 30 ° C Process 1-5h. After treatment, wash with PBS 2-5 times, 1-5 ml each time. Then 0.5-3 μg of ScGFP (100 μl) was added to each portion and left at room temperature for 10 min. Wash 2-5 times with PBS, 1-5 ml each time. Final filtration was performed by flow cytometry (FACS Aria III, BD) analysis. The results showed that the intensity of ScGFP fluorescence of the cells treated with the enzyme was weaker than that of the control; the fluorescence intensity was the weakest when the two enzymes were added (Fig. 6). This also indicates that ScGFP can specifically bind to glycosaminoglycans on the cell surface, and this method can be used to quantitatively analyze glycosaminoglycans on the cell surface.

References involved in the specification

1. Takagaki K, Nakamura T, Takeda Y, Daidouji K, Endo M. A new endo-beta-galactosidase acting on the Gal beta 1-3Gal linkage of the proteoglycan linkage region. J Biol Chem 1992, 267: 18558-18563.

2. Silbert JE, Sugumaran G. Biosynthesis of chondroitin/dermatan sulfate. Iubmb Life 2002, 54: 177-186.

3. Sugahara K, Mikami T, Uyama T, Mizuguchi S, Nomura K, Kitagawa H. Recent advances in the structural biology of chondroitin sulfate and dermatan sulfate. Curr Opin Struct Biol 2003, 13: 612-620.

4. Izumikawa T, Kitagawa H, Mizuguchi S, Nomura KH, Nomura K, Tamura J, et al. Nematode chondroitin polymerizing factor showing cell-/organ-specific expression is indispensable for chondroitin synthesis and embryonic cell division. J Biol Chem 2004, 279:53755-53761.

5. Jiang D, Liang J, Noble PW. Hyaluronan in tissue injury and repair. In: Annu Rev Cell Dev Biol 2007. pp. 435-461.

6. Noble PW. Hyaluronan and its catabolic products in tissue injury and repair. Matrix Biol 2002, 21: 25-29.

7. Lawrence MS, Phillips KJ, Liu DR. Supercharging proteins can impart unusual resilience. J Am Chem Soc 2007, 129: 10110-10112.

8.Lei C, Huang Y, Nie Z, Hu J, Li L, Lu G, Han Y, Yao S. A supercharged fluorescent protein as a versatile probe for homogeneous DNA detection and methylation analysis. Angew Chem Int Ed Engl. 2014, 53: 8358-8362.

Claims (9)

1. The use of a highly positively charged fluorescent protein as a fluorescent marker for the detection of glycosaminoglycans and/or glycosaminoglycan analogs, the amino acid sequence of which is shown in SEQ ID NO.
2. The use according to claim 1 wherein said glycosaminoglycan analogue is selected from the group consisting of natural or artificial semi-synthetic and fully synthetic polyanionic polysaccharides.
3. The use according to claim 2, wherein the glycosaminoglycan analogue is selected from the group consisting of sulfated polysaccharides, polysialic acid, alginate, carrageenan, fucoidan or lipopolysaccharide.
4. The application of claim 1 wherein the specific steps are as follows:

   (1) contacting the sample with a highly positively charged fluorescent protein, incubated and incubated for 5 to 30 minutes, and the sample to be tested after incubation;

   (2) removing a highly positively charged fluorescent protein that is not bound to the glycosaminoglycan and/or glycosaminoglycan analog in the sample to be detected, or quenching the glycosaminoglycan and/or the sample to be detected using a fluorescence quencher and/or Or a high positively charged fluorescent protein bound by a glycosaminoglycan analog to prepare a sample to be tested;

   (3) The sample to be tested is subjected to fluorescence measurement, and the content of glycosaminoglycan and/or glycosaminoglycan analogue in the sample is qualitatively and/or quantitatively analyzed according to the fluorescence intensity.
5. The use according to claim 4, wherein the sample in the step (1) is a liquid, a solid phase carrier, a cell, a tissue, an organ.
6. The use according to claim 4, wherein in the step (1), the contact concentration of the highly positive fluorescent protein is from 0.01 to 5.0 μg/ml.
7. The use according to claim 4, wherein in the step (2), the fluorescence quencher is selected from the group consisting of graphene, nano gold and/or organic small molecule fluorescence quencher.
8. The application according to claim 4, wherein in the step (3), the quantitative analysis is performed by detecting the fluorescence intensity of the standard sample of different dilutions, according to the concentration between the concentration of the standard curve and the fluorescence intensity. The linear relationship is obtained by linear equation, and the fluorescence intensity value of the sample to be tested is substituted into the obtained linear equation, and the content of glycosaminoglycan and/or glycosaminoglycan analog in the sample is calculated.
9. The use according to claim 4, wherein the fluorescence measurement in the step (3) is qualitative analysis using a fluorescence microscope, a flow cytometer or a living imaging device.

Images