CN103923899B - A kind of glycosaminoglycan lyases and encoding gene and application - Google Patents

Abstract

The present invention relates to a kind of glycosaminoglycan lyases and encoding gene and application. Is the amino acid sequence of glycosaminoglycan lyases as SEQ? ID? shown in NO.2; Is the nucleotide sequence of the encoding gene of glycosaminoglycan lyases as SEQ? ID? shown in NO.1; Glycosaminoglycan lyases prepared by the present invention is 110,000U/mg, is 45,000U/mg to the specific activity of chondroitin sulfate hyaluronic specific activity; Enzyme activity be known commercialization glycosaminoglycan lyases (as, CSaseABC, CSaseAC? I and II etc.) tens to hundreds of times, can be applicable to the field such as medicine and cosmetics, have broad application prospects.

Description

A kind of glycosaminoglycan lyases and encoding gene and application

Technical field

The present invention relates to a kind of glycosaminoglycan lyases and encoding gene and application, belong to gene engineering technology field.

Background technology

Glycosaminoglycan (Proteoglycans, GAG) is called again mucopolysaccharide, is the straight-chain polysaccharide of repetition disaccharide unit composition. Mainly comprise hyaluronic acid (HyaluronicAcid, HA), heparin/Heparan sulfate (Heparin/HeparanSulfate, Hep/HS), chondroitin sulfate/dermatan sulfate (ChondroitinSulfate/DermatanSulfate, CS/DS), keratan sulfate (KeratanSulfate, KS). Except the disaccharide unit of keratan sulfate is made up of neutral D-galactolipin and N-acetyl-glucosamine, the disaccharide unit of other glycosaminoglycan is all made up of hexuronic acid (D-Glucose aldehydic acid/L-iduronic acid) and hexosamine (N-acetyl ammonia gucosamine/N-acetylgalactosamine). Wherein hyaluronic acid structure is relatively simple, and the disaccharide unit being made up of D-Glucose aldehydic acid and N-acetyl-glucosamine is formed by connecting through β-Isosorbide-5-Nitrae-glycosidic bond. Other glycosaminoglycan becomes complex because the effect of various modification enzymes makes sugar chain; be mainly manifested in the sulphation of different parts hydroxyl (OH) in sugar chain and amino (NH2); D-Glucose aldehydic acid changes L-iduronic acid under the effect of C5-epimerase, the acetylation of hexosamine two bit aminos etc. This high complexity of glycosaminoglycan sugar chain structure is not random generation, but there is Space-time speciality highly, that the synthetic relevant enzyme of various sugar chains is due to the different developmental phases expression regulation level of different cell tissue and organ, different structures makes it have different functions, and the complexity of structure is given the diversity of its function.

Glycosaminoglycan is extensively present in zooblast cell surface and cellular matrix, by having participated in increment and the differentiation of cell with the special interaction of various albumen, intercellular identification, cell shifts, tissue morphology occurs, the various physiology such as canceration and pathologic process (KnudsonandKnudson1993, PerrimonandBernfield2000, KarbownikandNowak2013) a series of important biological function that glycosaminoglycan has becomes important bioactive molecule, in medicine and functional food, be used widely, as heparin, chondroitin sulfate, hyaluronic acid (Noble2002, Jiang, Liangetal.2007) etc. but due to the inhomogeneity of glycosaminoglycan structure, the particularly high complexity of sulfated glycosaminoglycans structure, makes the same glycosaminoglycan of separate sources and different batches in activity, have very big-difference (Sugahara, Mikamietal.2003). large quantity research in recent years shows, the biological function of glycosaminoglycan is that functional areas by having special construction in polysaccharide chain and the special interaction of specific protein realize, in same polysaccharide chain, there are the functional areas of different structure, can exercise different functions from different protein-interactings, therefore can pass through selective Partial digestion glycosaminoglycan polysaccharide chain, the specific function district oligosaccharides of preparation structure homogeneous or relatively homogeneous is for medicine and functional food, this series products not only structure and activity is determined, but also because molecular weight minor benefit has improved utilization rate greatly in absorption.

Glycosaminoglycan digestive enzyme is the important tool enzyme of research glycosaminoglycan structure-activity relationship, mainly comprises microbe-derived lyases system and the hydrolase system of animal origin. Can be divided into hyaluronidase, chondroitin sulfate/dermatan sulfate digestive enzyme, heparin/Heparan sulfate digestive enzyme, the large class of keratan sulfate digestive enzyme four according to the difference of substrate, wherein can simultaneously degrade non-sulfuric acid and N-acetylgalactosamine 4 (CS-A) or 6(CS-C) the low degree of sulfation chondroitin sulfate section of position sulfovinic acid of most of hyaluronidase, but degradation speed is far below degraded hyaluronic acid. As the hyaluronic acid hydrolase (Zaneveld, Polakoskietal.1973) from sheep and bull testis, can be under acid PH by degradable hyaluronic acid be tetrose and six sugar. From the hyaluronate lyase of streptomycete the hyaluronic acid of can only degrading, end-product is tetrose and six sugar (OhyaandKaneko1970) of non-reducing end band unsaturated double-bond. Do not find in animal body single-minded chondroitin sulfate/dermatan sulfate digestive enzyme family always, the degraded that more and more studies show that chondroitin sulfate/sulfuric acid skin element in mammalian body is mainly to be completed by some enzymes of hyaluronic acid enzyme family, hyaluronidase family member HYAL4 is accredited as a chondroitin sulfate hydrolase (Yamada, Sugaharaetal.2011) recently. Microbe-derived chondroitinase (CSase), as CSaseABC and CSaseAC show certain hyaluronic acid degradation activity, but CSaseB is height selectivity dermatan sulfate digestive enzyme, to chondroitin sulfate and hyaluronic acid all without degrading activity. Different substrate selectives and the product diversity of utilizing various glycosaminoglycan digestive enzymes to have, can form 26S Proteasome Structure and Function research to baroque glycosaminoglycan, in conjunction with various compartment analysis means, the specific function district of being combined with target protein in polysaccharide chain is identified, and prepared by final enzyme process medicinal for high activity and function oligosaccharides.

Glycosaminoglycan has formed cell protective barrier together with extraneous as the chief component composition of extracellular matrix; protection body cell is avoided damage; but in disease treatment; fine and close extracellular matrix has suppressed the permeability of medicine in tissue and effectively diffusion; onset time and the curative effect of medicine are reduced; especially to some macromolecular drugs, as the protein medicaments such as insulin and antibody. For many years, hyaluronidase is widely used in clinical, there is at present the commercialization hyaluronidase of three kinds of FDA Food and Drug Administrations (FDA) approval to utilize, respectively the Amphadase in bull testis source, the Vitrase in sheep testicle source, and the just people of the listing hyaluronidase Hylenex that recombinates recently. The main application of hyaluronidase comprises clinically: promote absorption and the diffusion (Schuller, Castonguayetal.1991) of other medicines as auxiliary agent; For the subcutaneous perfusion of liquid; Filling the unexpected hyaluronic degraded of plastic operation for hyaluronic acid eliminates; Be used for the treatment of to glycosaminoglycan metabolic disorder and accumulate relevant refractory skin, as (PCTpublicationsWO00/38732 such as diabetic keratopathy scleredema, chorionitis, keloids; WO01/45743; AndGermanPatentNo.19963538) (Lee, Grummeretal.2010). In addition, a large amount of reports prove, chondrosulphatase CSaseABC can promote neuron axon regeneration (Moon in neurotrosis by degraded chondroitin sulfate, Asheretal.2001, Bradbury, Moonetal.2002, Kwok, Afsharietal.2008, BradburyandCarter2011).

In sum, glycosaminoglycan digestive enzyme is not only glycosaminoglycan structure function and is studied requisite instrument, and has important using value in the active oligosaccharides preparation of glycosaminoglycan and disease treatment. But the high vigor osamine Polyose degradation enzyme at present with using value is little, therefore finds and identify that new and effective stable glycosaminoglycan digestive enzyme is significant.

Summary of the invention

The present invention is directed to the deficiencies in the prior art, a kind of glycosaminoglycan lyases and encoding gene and application are provided.

A kind of glycosaminoglycan lyases, amino acid sequence is as (a) or (b):

(a) amino acid sequence is as shown in SEQIDNO.2;

(b) amino acid sequence in (a) through replacement, lack or add one or several amino acid and have glycosaminoglycan lyases activity by (a) derivative protein.

Preferred according to the present invention, described amino acid sequence (b) is as shown in SEQIDNO.3 or SEQIDNO.4.

An encoding gene for glycosaminoglycan lyases, nucleotide sequence is as (i) or (ii):

(i) nucleotide sequence is as shown in SEQIDNO.1;

(ii) under stringent condition, there is the protein DNA molecule of glycosaminoglycan lyases activity with the DNA sequence dna hybridization (i) limiting and coding.

Preferred according to the present invention, described nucleotide sequence (ii) described under stringent condition, refer to:

Containing in 6 × SSC buffer solution of 0.5%SDS, at 65 DEG C, hybridize, then respectively wash film once with the 2 × SSC buffer solution containing 0.1%SDS with containing 1 × SSC buffer solution of 0.1%SDS.

Further preferred according to the present invention, described nucleotide sequence is (ii) as SEQIDNO.5 or SEQIDNO.6.

A kind of recombinant expression carrier has inserted the encoding gene of above-mentioned glycosaminoglycan lyases in expression vector.

Above-mentioned expression vector is selected from coli expression carrier, Yeast expression carrier, hay bacillus expression vector, lactic acid bacteria expression vectors, streptomyces expression vector, phage vector, filamentous fungi expression vector, plant expression vector, insect expression vector or mammalian cell expression vector.

A kind of recombinant bacterium or transgenic cell line have inserted the encoding gene of above-mentioned glycosaminoglycan lyases in host cell or clone.

Above-mentioned host cell or clone are selected from e. coli host cell, saccharomycete host cell, hay bacillus host cell, lactic acid bacteria host cell, actinomyces host cell, filamentous fungal host cell, insect cell or mammalian cell.

For recombinant bacterium or the transgenic cell line of recombinant expressed glycosaminoglycan lyases HCDase, can be that e. coli host cell is (as EscherichiacoliBL21, EscherichiacoliJM109, EscherichiacoliDH5 α etc.), saccharomycete host cell is (as Saccharomycescerevisiae, Pichiapastoris, KluyveromycesIactis etc.), hay bacillus host cell is (as BacillussubtilisR25, Bacillussubtilis9920 etc.), lactic acid bacteria host cell (as LacticacidbacteriaC0CC101 etc.), actinomyces host cell (as Streptomycesspp. etc.), filamentous fungal host cell (as Trichodermaviride, Trichodermareesei, Aspergillusniger, Aspergillusnidulans etc.), insect cell (as Bombyxmori, Antharaeaeucalypti etc.) or mammalian cell (as Chinese hamster ovary cell CHO, immature hamster kidney cell BHK, Chinese hamster pneumonocyte CHL etc.).

Above-mentioned glycosaminoglycan lyases is as strengthening the absorption of medicine or sending composition in the application of preparing in medicine.

Beneficial effect

Glycosaminoglycan lyases prepared by the present invention is 110,000U/mg, is 45,000U/mg to the specific activity of chondroitin sulfate hyaluronic specific activity; Enzyme activity be known commercialization glycosaminoglycan lyases (as, CSaseABC, CSaseACI and II etc.) tens to hundreds of times, can be applicable to the field such as medicine and cosmetics, have broad application prospects.

Brief description of the drawings

The protein three-dimensional structure model of Fig. 1, glycosaminoglycan lyases HCDase;

The polyacrylamide gel electrophoresis figure (SDS-PAGE) of Fig. 2, restructuring glycosaminoglycan lyases HCDase Expression and purification situation;

Wherein: M, protein molecular weight standard, band from top to bottom size is 116kD, 66.2kD, 45kD, 35kD, 25kD, 18.4kD, 14.4kD; Thalline before swimming lane 1, control strain broken wall, applied sample amount 10 μ L, thalline before swimming lane 2, recombinant bacterium broken wall, applied sample amount 10 μ L, supernatant after swimming lane 3, recombinant bacterium broken wall, applied sample amount 10 μ L, swimming lane 4, through the HCDase of ni-sepharose purification, applied sample amount 10 μ L.

Fig. 3, the activity influence curve of p Η value to glycosaminoglycan lyases HCDase;

Fig. 4, the activity influence curve of temperature to glycosaminoglycan lyases HCDase;

Fig. 5, the stability influence curve of temperature to glycosaminoglycan lyases HCDase;

Fig. 6, the stability influence curve of pH value to glycosaminoglycan lyases HCDase;

Fig. 7, the affect column diagram of metal ion on glycosaminoglycan lyases HCDase activity;

The HPLC analysis chart of Fig. 8, glycosaminoglycan lyases HCDase degraded hyaluronic acid and chondroitin sulfate products therefrom;

The HPLC analysis chart of Fig. 9, glycosaminoglycan lyases HCDase different time degraded hyaluronic acid products therefrom.

Detailed description of the invention

The elaboration of following examples, is for some common technologies that openly how the present invention implements comprehensively, instead of in order to limit range of application of the present invention. Inventor has tried one's best and has guaranteed in embodiment the accuracy (for example amount, temperature, etc.) of a parameter, but some experimental errors and deviation also should be paid attention to. Except as otherwise noted, in the present invention, molecular weight refers to weight average molecular weight, and temperature is degree Celsius.

The acquisition of embodiment 1, glycosaminoglycan lyases

Picking vibrios (Vibriosp.) FC509 inoculation, in 100mL fluid nutrient medium, is that under 28 DEG C, the revolution condition that is 200rpm, shaking table is cultivated 12 hours, adds chondroitin sulfate to make mass concentration reach 0.01%, continues to cultivate 48h in temperature; Medium centrifugal is collected to supernatant culture medium, the ammonium sulfate precipitation that supernatant is 80% with final concentration, collecting precipitation, precipitation is dialysed and is removed ammonium sulfate with PBS buffer solution, makes glycosaminoglycan lyases.

Above-mentioned vibrios (Vibriosp.) FC509, within on 03 12nd, 2014, be preserved in China Committee for Culture Collection of Microorganisms's common micro-organisms center, deposit number CGMCCNO.8913, address: No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City Institute of Microorganism, Academia Sinica.

Every liter of component of aforesaid liquid culture medium is as follows:

Chondroitin sulfate 5g, tryptone 10g, yeast extract 5g, NaCl30g, KH₂PO₄3g、K₂HPO₄7g、(NH₄)₂SO₄2g、MgSO₄·7H₂05mg、FeSO₄·7H₂02mg, pH value is 7.2.

Enzyme activity unit definition: catalysis glycosaminoglycan per minute produces the needed enzyme amount of 1 μ moL unsaturated double-bond. Survey glycosaminoglycan according to ultraviolet method and split the method (Yamagata, Saitoetal.1968) that enzyme enzyme is lived, recording enzyme work in the fluid nutrient medium of Vibriosp.FC509 bacterial strain is 3,000U/mL.

The extraction of embodiment 2, vibrios (Vibriosp.) FC509 strain gene group DNA

By vibrios (Vibriosp.) FC509 inoculation, to fluid nutrient medium (with embodiment 1), under 30 DEG C, the condition of 200rpm, shaken cultivation is to OD₆₀₀=0.8; Get and cultivate bacterium liquid 40mL, centrifugal 25min under 12,000rmp condition, collects bacterial sediment, and with lysozyme buffer solution (10mMTris-HClpH8.0) washing of 20mL, centrifugal 25min under 12,000rmp condition, collects bacterial sediment;

In above-mentioned bacterial sediment, every pipe adds lysozyme buffer solution 12.0mL, obtains the bacterium liquid of about 14.0mL, and adding respectively concentration is the each 560 μ L of lysozyme of 20mg/mL, its final concentration approximately 800 μ g/mL; After ice bath 1.0h, 37 DEG C of temperature are bathed 2h, to solution thickness; Add 10wt%SDS0.82mL, the Proteinase K solution 60 μ L of 100mg/mL, 52 DEG C of water-bath 1.0h; Phenol/chloroform/isoamyl alcohol (volume ratio 25:24:1) 15mL that adds Tris-balance to cross, puts upside down and mixes gently, to fully emulsified; Centrifugal 10min under 10,000g, 4 DEG C of conditions, shifts supernatant, adds NaAc-HAc(pH5.2, the 3.0M of 2.0mL) buffer solution, and the absolute ethyl alcohol of 17.0mL, mix; Go out thread DNA with the rifle choicest of 1.0mL, be transferred in the EP centrifuge tube of 1.5mL, with 70% ethanol (storing in-20 DEG C), wash 2 times, micro-ly abandon supernatant after centrifugal; Centrifugal 3min under 10,000g, 4 DEG C of conditions, thoroughly discards supernatant; Sample is in aseptic working platform, and alcolhol burner leeward dries up dry; With the resuspended dissolving DNA sample of aseptic deionized water, 4 DEG C are spent the night, and obtain macromolecule genomic DNA.

Embodiment 3, the scanning of vibrios (Vibriosp.) FC509 strain gene group and sequence analysis thereof.

The macromolecule genomic DNA that embodiment 2 is made check order (Mei Ji biotech firm). With NCBI(NationalCenterforBiotechnologyInformation, http://www.ncb1.nlm.nih.gov/) on software sequencing result is analyzed. NCBI analysis software used is OpenReadingFrameFinder(ORFFinder, http://www.ncb1.nlm.nih.gov/gorf/gorf.html) and BasicLocalAlignmentSearchTool(BLAST, http://blast.ncb1.nlm.nih.gov/Blast.cgi).

In NCBI analysis result demonstration Vibriosp.FC509 strain gene group, carry a glycosaminoglycan lyase gene hcdase, hcdase gene code head of district 2436bp, its nucleotide sequence is as shown in SEQIDNO.1. There is 49% homology with 384 amino acid of hyaluronatelyase gene in the whole genome sequence (NCBI number of registration: YP_206952.1) of VibriofischeriES114.

The glycosaminoglycan lyases HCDase of hcdase gene code is made up of 778 amino acid, and its amino acid sequence is as shown in SEQIDNO.2, and the theoretical molecular of protein is about 89kD. With SimpleModularArchitectureResearchTool(SMART, http://smart.embl_heidelberg.de/) analyze the structural information of glycosaminoglycan lyases HCDase, result shows that the 1st to the 22nd amino acid of N end is signal peptide sequence, and 23-778 amino acids sequence belongs to glycosaminoglycan lyases superfamily. The protein three-dimensional structure of glycosaminoglycan lyases HCDase is carried out to homology modeling with SWISS-MODEL homology modeling service device (http://swissmodel.expasy.org), the HCDase protein three-dimensional structure model finally obtaining as shown in Figure 1.

Under stringent condition, there is the protein DNA molecule of glycosaminoglycan lyases activity with sequence hybridization shown in SEQIDNO.1 and coding, as the DNA molecular of nucleotide sequence as shown in SEQIDNO.5, SEQIDNO.6.

DNA molecular by nucleotide sequence as shown in SEQIDNO.5, SEQIDNO.6 is containing in 6 × SSC buffer solution (being ShiJi Co., Ltd purchased from health) of 0.5%SDS, hybridization at 65 DEG C, then respectively washes film once with the 2 × SSC buffer solution containing 0.1%SDS with containing 1 × SSC buffer solution of 0.1%SDS.

The protein molecule of the DNA molecule encode shown in above-mentioned SEQIDNO.5, SEQIDNO.6, amino acid sequence is as shown in SEQIDNO.3 or SEQIDNO.4, wherein the protein molecule of SEQIDNO.3 is compared with the protein molecule shown in SEQIDNO.2, there is 2% difference (amino acid whose substituting), the protein molecule of SEQIDNO.4 compared with the protein molecule shown in SEQIDNO.2, have 3% difference (amino acid whose substitute, disappearance, insert).

Recombinant expressed in Escherichia coli of embodiment 4, HCDsae gene

The macromolecule genomic DNA making taking embodiment 2 is template, carries out pcr amplification. Primer is as follows:

Forward primer HCDase-F:GCCATGGATATGCAAGCGATGACCACCAGTTCACTG；

Reverse primer HCDase-R:GCTCGAGTCGCACTGAAAATTGATAACTTTGTCC；

What forward primer underscore marked is restriction enzyme NcoI site, and what reverse primer underscore marked is restriction enzyme XhoI site. PrimerstarHSDNA polymerase is purchased from precious biotech firm, and the description of product that PCR reaction system provides according to company operates.

PCR reaction condition: 94 DEG C of denaturation 5min; 94 DEG C of sex change 30s, 68 DEG C of 1.5min, 35 circulations; 72 DEG C are extended 10min.

By NcoI and XhoI double digestion for PCR product, agarose gel electrophoresis reclaims the PCR product that enzyme is cut. To be purchased from product pET-22b carrier NcoI and the XhoI double digestion of Novagen company of the U.S., agarose gel electrophoresis reclaims enzyme and cuts carrier large fragment. NcoI and XhoI are all purchased from precious biotech firm, the system of enzyme-to-substrate reaction, the description of product operation that temperature and time all provides according to company.

PCR product through double digestion is connected through double digestion pET-22b carrier with same, connect after product transforms e.colistraindh5α and coat on the Luria-Bertani culture medium solid plate that contains 50 μ g/mL ampicillins, cultivate 14h, picking monoclonal for 37 DEG C; Monoclonal is accessed in the liquid Luria-Bertani culture medium that contains 50 μ g/mL ampicillins and cultivated, extract plasmid; Plasmid is carried out to bacterium liquid PCR checking with forward primer HCDase-F and reverse primer HCDase-R, and result obtains the amplified production that size is correct, and the recombinant plasmid that preliminary proof builds is correct; Then this recombinant plasmid is sent to the order-checking of Sheng Gong biotech firm, result shows, between the NcoI of pET-22b and XhoI restriction enzyme site, insert the hcdsae gene shown in SEQIDNO.1, and direction of insertion is correct, so further prove that the recombinant plasmid building is correct, by this recombinant plasmid called after pET22b-HCDase.

PET22b-HCDase is transformed to coli strain BL21 (DE3) (purchased from Novagen company of the U.S.), the operating procedure then providing according to the said firm glycosaminoglycan lyases HCDase abduction delivering of recombinating. And with NiSepharose6FastFlow(GE) gel carries out purifying to HCDase, and purification condition is according to the product manual operation of GE company. The purifying situation that detects restructuring glycosaminoglycan lyases HCDase with polyacrylamide gel electrophoresis, as shown in Figure 2, the restructuring glycosaminoglycan lyases HCDase after purifying is single band to result on running gel, and the molecular weight of position and prediction matches.

The zymologic property analysis of embodiment 5, restructuring glycosaminoglycan lyases HCDase

The impact on enzymatic activity of pH and temperature

Be 150mMHAc-NaAc, the NaH of 1% hyaluronic acid or chondroitin sulfate substrate, HCDase enzyme liquid, different pH values by mass concentration₂PO₄-Na₂HPO₄, Tris-HCl buffer solution and water (pH scope is 5.0～10.0), in 2:1:3:4(volume ratio) ratio mix after, at 30 DEG C of reaction 60min, by aforesaid ultraviolet method survey enzyme activity. Result shows that HCDsae reaches maximum vigor in the time of pH8.0, and the optimal reaction pH that shows HCDase is that 8.0(is as Fig. 3).

Under optimal pH, be 1% hyaluronic acid or chondroitin sulfate substrate, HCDase enzyme liquid and 150mMNaH by mass concentration₂PO₄-Na₂HPO₄Buffer solution (pH8.0) is in 2:1:3:4(volume ratio) ratio mix, respectively at different temperatures (0 DEG C～90 DEG C) reaction 10min, by aforesaid ultraviolet method survey enzyme activity. Result shows that HCDase reaches maximum vigor in the time of 30 DEG C, and the optimal reactive temperature that shows HCDase is 30 DEG C (as Fig. 4).

The impact on enzyme stability of pH and temperature

Be that 1% hyaluronic acid or chondroitin sulfate substrate solution are in 2:3(volume ratio by the HCDase enzyme liquid after the lower heat treatment 1h of different temperatures (0 DEG C～70 DEG C) and mass concentration) ratio mix, then under optimum temperature and optimal pH, measuring residual enzyme lives, to be defined as 100% relative activity (relativieactivity) without the work of heat treated enzyme liquid enzyme, result shows that HCDase has good heat endurance (as Fig. 5) at the temperature lower than 60 DEG C.

Will be at 30 DEG C, different pH(pH5～10) HCDase enzyme liquid after preincubate 1h and mass concentration be that 1% hyaluronic acid or chondroitin sulfate substrate solution are in 2:3(volume ratio) ratio mix, then under optimum temperature and optimal pH, measuring residual enzyme lives, be defined as 100% relative activity (relativieactivity) with the enzyme liquid enzyme work of processing without pH, result is presented in the scope of pH5-9, HCDase enzyme is lived and is still kept more than 60%, shows that HCDase is to wide (as Fig. 6) of pH value tolerance range.

The impact of metal ion on HCDsae activity

Be that 1% hyaluronic acid or chondroitin sulfate substrate, HCDase enzyme liquid, 150mMTris-HCl buffer solution and water are in 2:1:3:4(volume ratio by mass concentration) ratio mix after, then in reaction system, add different metal ions, the ion final concentration adding is 1mM or 10mM, then at 30 DEG C of reaction 60min, survey enzyme activity by aforesaid ultraviolet method. Control group is the activity (being set as 100%) of HCDase while not adding any metal ion, shown in result Fig. 7. Experimental result shows, K⁺、Na⁺、Fe²⁺、Mn²⁺Can increase HCDase activity, Li⁺、Mg²⁺、Co²⁺、Ni²⁺、Cr³⁺、Fe³⁺Active substantially without impact, Ag on HCDase⁺、Cu²⁺、Ca²⁺、Fe²⁺、Hg²⁺、Pb²⁺、Zn²⁺Present inhibitory action (Fig. 7) Deng other ions enzyme work.

The enzyme activity determination of embodiment 6, HCDase

Be that 1% hyaluronic acid or chondroitin sulfate substrate, HCDase enzyme liquid, 150mMTris-HCl buffer solution and water are in 2:1:3:4(volume ratio by mass concentration) ratio mix after, under optimum temperature and optimal pH, react 2-10min, survey enzyme activity (Yamagata by aforesaid ultraviolet method, Saitoetal.1968), simultaneously with being purchased from the protein content that health is the quantification of protein kit measurement HCDase enzyme liquid of ShiJi Co., Ltd, the result HCDase that shows to recombinate is 110 to hyaluronic specific activity, 000U/mg, be 45,000U/mg to the specific activity of chondroitin sulfate.

Albumen shown in SEQIDNO.3 is 100,000U/mg, is 40,000U/mg to the specific activity of chondroitin sulfate hyaluronic specific activity;

Albumen shown in SEQIDNO.4 is 89,000U/mg, is 37,000U/mg to the specific activity of chondroitin sulfate hyaluronic specific activity;

The high efficiency liquid phase (HPLC) of embodiment 7, HCDase degraded glycosaminoglycan catabolite is analyzed

Be that 1% hyaluronic acid or chondroitin sulfate substrate, HCDase enzyme liquid, 150mMTris-HCl buffer solution and water are in 2:1:3:4(volume ratio by mass concentration) ratio mix after, at pH8.0, under 30 DEG C of conditions, react, the product of choosing different enzymolysis times (0,0.25,1,5,15,30,120min) carries out HPLC analysis. HPLC analysis condition is gel column: superdexpeptide10/300GL(GE); Mobile phase: 0.2M carbonic hydroammonium; Flow velocity: 0.4mL/min; Testing conditions: UV232nm.

As shown in Figure 8 and Figure 9, along with the increase of degradation time, the product degree of polymerization is fast reducing with the prolongation of degradation time, is finally converted into disaccharides as can be seen from Figure 9 for result. This result shows that HCDase belongs to inscribe glycosaminoglycan lyases, can be used to preparation and the glycosaminoglycan structure activity study of glycosaminoglycan oligosaccharides.

Embodiment 8, the application of glycosaminoglycan lyases HCDase in medicine

Glycosaminoglycan lyases HCDase can, for strengthening the absorption of medicine or/and send, include but not limited to permeate through skin approach ancillary drug. Exemplary medicine comprises that corticosteroid is as hydrocortisone, prednisolone, beclomethasone propionic ester, flumethasone, triamcinolone, clobetasol propionate etc.; Antalgesic and/or antiinflammatory are as paracetamol, mefenamic acid, Flufenamic acid, Diclofenac, C14H10Cl2NNaO2, alclofenac, Oxyphenbutazone, phenylbutazone, brufen, Flurbiprofen, salicylic acid, menthol, camphor, naproxen etc.; Antihypertensive is as pindolol, Indenolol, nifepine etc.; Antibiotic is as penicillin, tetracycline, terramycin, neomycin, erythromycin, chloramphenicol etc.; Anesthetic is as lidocaine, benzocainum etc. and other drug.

By compress, gauze, or other skin is smeared approach and is used glycosaminoglycan lyases. Glycosaminoglycan lyases solution can be coated to suitable apply ointment or plaster upper (as 5-6 layer gauze). Apply ointment or plaster and should cover affected area, and apply ointment or plaster and itself fix with paraffin paper or bandage. The amount of the preparation of application depends on the area of damage, is generally 5-100IU/cm². Apply ointment or plaster and should use 12-24 hour every day, use continuously 10-100 days.

Use solution, suspension, gel, paste, ointment, other formulas (be with or without other activating agent, can use) of emulsifiable paste or glycosaminoglycan lyases for part. In the formulas such as solution, comprise pharmacy and cosmetic field and use acceptable diluent for part, adjuvant and excipient, these other formula mainly comprises that buffer is as phosphate, citrate, acetate and other acylate, antioxidant be if ascorbic acid, peptide, protein are as seralbumin, gelatin or immunoglobulin (Ig); Hydrophilic polymer is as polyvinylpyrrolidone, natural or synthetic oil; Amino acid is as glycine, glutamic acid, aspartic acid, or arginine; Monose, disaccharides and other carbohydrate, comprise cellulose or derivatives thereof, glucose, lactose, mannose or dextrin; Chelating agent is as EDTA; Sugar alcohol is as mannitol or D-sorbite; Inorganic salts, as sodium chloride, and non-ionic surface active agent is as tween, polyethylene glycol.

A kind of preferred, glycosaminoglycan lyases preparation is that the freeze-dried powder of glycosaminoglycan lyases HCDase suspends or is dissolved in the solvent that contains 0.1%-10% sucrose, 1%-20% glycerine, and the pH of solution remains within the scope of 6.5-8.5.

Glycosaminoglycan lyases composition can pass through oral administration or parenteral, and glycosaminoglycan lyases composition can be combined with suitable delivery vector rear administration.

Can obtain the glycosaminoglycan lyases pharmaceutical preparation for orally using by the combination of reactive compound and solid excipient. Selecting above-mentioned mixture to add suitable attached auxiliary agent to mix uses. If necessary, suitable excipient is carbohydrate or protein, for example sugar, cellulose, bovine serum albumin(BSA) etc.

Glycosaminoglycan lyases enzyme and medicine (as hydrocortisone, antibiotic, vitamin) combination. With oral gel, paste, or the form of suspension is by intravenous, subcutaneous or intramuscular injection administration; Or with ointment, cream, face shield topical; And as cosmetics adjuvant, for strengthening the absorption of skin.

The bibliography relating in description

1、Bradbury,E.J.andL.M.Carter(2011)."Manipulatingtheglialscar:ChondroitinaseABCasatherapyforspinalcordinjury."BrainResearchBulletin84(4-5):306-316.

2、Bradbury,E.J.,etal.(2002)."ChondroitinaseABCpromotesfunctionalrecoveryafterspinalcordinjury."Nature416(6881):636-640.

3、Jiang,D.,etal.(2007).Hyaluronanintissueinjuryandrepair.AnnualReviewofCellandDevelopmentalBiology.23:435-461.

4、Karbownik,M.S.andJ.Z.Nowak(2013)."Hyaluronan:Towardsnovelanti-cancertherapeutics."PharmacologicalReports65(5):1056-1074.

5、Knudson,C.B.andW.Knudson(1993)."Hyaluronan-bindingproteinsindevelopment,tissuehomeostasis,anddisease."FASEBjournal:officialpublicationoftheFederationofAmericanSocietiesforExperimentalBiology7(13):1233-1241.

6、Kwok,J.C.F.,etal.(2008)."Proteoglycansinthecentralnervoussystem:Plasticity,regenerationandtheirstimulationwithchondroitinaseABC."RestorativeNeurologyandNeuroscience26(2-3):131-145.

7、Lee,A.,etal.(2010)."Hyaluronidase."DermatologicSurgery36(7):1071-1077.

8、Moon,L.D.F.,etal.(2001)."RegenerationofCNSaxonsbacktotheirtargetfollowingtreatmentofadultratbrainwithchondroitinaseABC."NatureNeuroscience4(5):465-466.

9、Noble,P.W.(2002)."Hyaluronananditscatabolicproductsintissueinjuryandrepair."MatrixBiology21(1):25-29.

10、Ohya,T.andY.Kaneko(1970)."Novelhyaluronidasefromstreptomyces."Biochimicaetbiophysicaacta198(3):607-609.

11、Perrimon,N.andM.Bernfield(2000)."Specificitiesofheparansulphateproteoglycansindevelopmentalprocesses."Nature404(6779):725-728.

12、Schuller,H.M.,etal.(1991)."Modulationoftheuptakeandmetabolismof4-(methylnitrosamino)-1-(3-pyridyl)-1-butanonebynicotineinhamsterlung."Cancerresearch51(8):2009-2014.

13、Sugahara,K.,etal.(2003)."Recentadvancesinthestructuralbiologyofchondroitinsulfateanddermatansulfate."CurrentOpinioninStructuralBiology13(5):612-620.

14、Yamada,S.,etal.(2011)."Evolutionofglycosaminoglycans:Comparativebiochemicalstudy."Communicative&IntegrativeBiology4(2):150-158.

15、Yamagata,T.,etal.(1968)."Purificationandpropertiesofbacterialchondroitinasesandchondrosulfatases."TheJournalofbiologicalchemistry243(7):1523-1535.

16、Zaneveld,L.J.,etal.(1973)."Propertiesofacrosomalhyaluronidasefrombullspermatozoa.Evidenceforitssimilaritytotesticularhyaluronidase."TheJournalofbiologicalchemistry248(2):564-570。

Claims (8)

1. a glycosaminoglycan lyases, is characterized in that, amino acid sequence is as (a) or (b):

(a) amino acid sequence is as shown in SEQIDNO.2;

(b) amino acid sequence is as shown in SEQIDNO.3 or SEQIDNO.4.

2. an encoding gene for glycosaminoglycan lyases, is characterized in that, nucleotide sequence is as (i) or (ii):

(i) nucleotide sequence is as shown in SEQIDNO.1;

(ii) nucleotide sequence is as SEQIDNO.5 or SEQIDNO.6.

3. a recombinant expression carrier has inserted the coding of glycosaminoglycan lyases claimed in claim 2 in expression vectorGene.

4. recombinant expression carrier as claimed in claim 3, is characterized in that, described expression vector is selected from Bacillus coli expression and carriesBody, Yeast expression carrier, hay bacillus expression vector, lactic acid bacteria expression vectors, streptomyces expression vector, phage vector, silkShape fungus expression vector, plant expression vector, insect expression vector or mammalian cell expression vector.

5. a transgenic cell line has inserted the coding base of glycosaminoglycan lyases claimed in claim 2 in cloneCause.

6. transgenic cell line as claimed in claim 5, is characterized in that, it is thin that described clone is selected from escherichia coli hostBorn of the same parents, saccharomycete host cell, hay bacillus host cell, lactic acid bacteria host cell, actinomyces host cell, filamentous fungi hostCell, insect cell or mammalian cell.

7. the application of glycosaminoglycan lyases in the preparation of glycosaminoglycan oligosaccharides described in claim 1.

Described in claim 1 glycosaminoglycan lyases as strengthen medicine absorption or send composition prepare in medicine shouldWith.