CN107384957B - A kind of construction method, screening technique and the application of AAV auxiliary package carrier and the carrier that expressing miRNA - Google Patents
A kind of construction method, screening technique and the application of AAV auxiliary package carrier and the carrier that expressing miRNA Download PDFInfo
- Publication number
- CN107384957B CN107384957B CN201710553167.4A CN201710553167A CN107384957B CN 107384957 B CN107384957 B CN 107384957B CN 201710553167 A CN201710553167 A CN 201710553167A CN 107384957 B CN107384957 B CN 107384957B
- Authority
- CN
- China
- Prior art keywords
- carrier
- mirna
- aav
- expression
- clone
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/66—General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligation; Use of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
- C12N2750/00011—Details
- C12N2750/14011—Parvoviridae
- C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
- C12N2750/14151—Methods of production or purification of viral material
Abstract
The present invention relates to genetic engineering fields, and in particular to a kind of construction method, screening technique and the application of the AAV auxiliary package carrier and the carrier for expressing miRNA；The carrier is based on Rep2 and CapDJ and assists package carrier, and 2 × BsmBI of site of insertion clone miRNA between miR33-5 ' UTR and miR33-3 ' UTR under CMV promoter driving, miRNA expression small fragment connects the site 2xBsmBI into the skeleton carrier.The construction method of the carrier includes: preparation clone's skeleton；It prepares miRNA and expresses small fragment；MiRNA expression small fragment is connected on clone's skeleton carrier.The screening technique includes: to convert Stbl3 competent bacteria with the carrier, and plasmid extracts；By the plasmid co-transfection 293T cell of extraction；Titre compares screening.The present invention, which realizes, improves AAV production efficiency about 50% or more.
Description
Technical field
The present invention relates to genetic engineering fields, and in particular to a kind of AAV auxiliary package carrier and the carrier for expressing miRNA
Construction method, screening technique and application.
Background technique
Gene therapy at present is just gradually becoming reality from the dream of countless scientists in recent decades.The load of gene therapy
Body is always the key of whole gene treatment: needing to be able to satisfy safety, validity, specificity.A variety of viruses, non-virus carrier
It by the differentiation of many years, eliminates, recombinant adeno-associated virus (rAAV) carrier is the base for being known as meeting three above standard at present
Because of therapy vector.Due to the production yield Slow lifting for a long time of AAV, thus the popularity of clinical application is also made by this
About.As first gene therapy medicament Glybera by the treatment fatty acid enzyme defect that European Union ratifies was listed in recent years,
The SPK-RPE65 tri- phases clinical manifestation of the congenital blindness for the treatment of of Spark Theraputics company is outstanding, and AAV is as gene
The direction of therapy vector has been proved to completely with road, but the production efficiency of AAV is still the critical bottleneck of gene therapy.One need
The genetic disease of whole body F-duction is wanted to need AAV about 1x 1015The particle of AAV genome copy numbers (GC), and this clinical rank
Output need 500,000 dollars.In production, if can get with 50 15cm disks within the scope of current laboratory capabilities
The production efficiency of 1x10^13GC calculates, then to need to produce 100 times or 100 times production scales can just obtain medical treatment one
The total amount of patient.
Therefore, the yield bottleneck of AAV is urgently broken.The mainstream production method of AAV is three plasmid transfection 293T cells at present
Method.Three plasmid transfection methods are simple, quick, but since 293T is attached cell, extension of this method in scale relatively has tired
It is difficult.But if attached cell can be domesticated for suspension cell, then this method can break the limitation of itself, and it is raw to become large-scale industrial
The important candidate scheme produced.Adherent 293T cell is domesticated for suspension cell, and someone had been succeeded in recent years, but due to original
This production efficiency is still the failure to meet demand, therefore large-scale production can only be by solely increasing production scale.Therefore, in side
It improves, innovate in method, obtain one of the hot spot that higher AAV yield is current gene therapy.
Summary of the invention
In view of this, it is necessary to aiming at the problem that, provide it is a kind of express miRNA carrier and the carrier construction method,
Screening technique and application, the carrier are used as the expression of miRNA, to improve AAV production；The construction method, Screening Platform are real
It is existing high-throughput to handle each link, it saves each carrier and individually clones and the step of sequence verification, thus obtaining Effective selection knot
Vast resources and manpower are saved on the basis of fruit.
The invention is realized by the following technical scheme:
A kind of carrier of the expression miRNA based on conventional Rep2 and CapDJ auxiliary package carrier, structure as shown in Figure 1,
MiR33-5 ' UTR (SEQ ID NO:1) and miR33- in Rep2 and CapDJ auxiliary package carrier under CMV promoter driving
The site 2x BsmBI of insertion clone miRNA between 3 ' UTR (SEQ ID NO:2), miRNA expression small fragment is connected into skeleton
The site 2xBsmBI of carrier, and terminated and transcribed with the pA terminator of synthesis.
Further, the construction method of the carrier of the expression miRNA, step include:
(1), clone's skeleton of preparation linearisation cohesive end；
(2), the miRNA expression small fragment that Dual chain belt glues end is prepared；
(3), miRNA in (2) small fragment is expressed to be connected in (1) on clone's skeleton.
Further, the construction method of the carrier of the expression miRNA, specific steps include:
(1), it is packed with the above-mentioned Rep/CapDJ auxiliary for containing CMV-miR33-5 ' UTR-2xBsmBI-3 ' UTR expression cassette
Carrier is named as mRRC as miRNA expression cloning skeleton carrier, and the clone that BsmBI digestion obtains linearisation cohesive end uses
Carrier framework；
(2), the positive negative strand primer of the miRNA needed for synthesis, is made into 20uM concentration, by volume normal chain respectively: anti-chain:
10xT4DNA: sterilizing nuclease free H2The proportion of O=1:1:1:7 takes positive strand primer, negative strand primer that 10xT4DNA connection is added instead
Buffer is answered, and in sterilizing nuclease free H2It is mixed in O, 95 DEG C of denaturation after five minutes, are cooled down with 5 DEG C of speed per minute and annealed
To room temperature, the miRNA expression small fragment that Dual chain belt glues end is obtained；
(3), the expression small fragment of miRNA obtained in step (2) is connected to the skeleton of linearisation obtained in step (1)
The site 2xBsmBI (in 96 orifice plate of 200ul) of carrier: the miRNA expression small fragment that the Dual chain belt that annealing is generated glues end is dilute
After releasing 20 times, 1ul, then plus 25ng mRRC carrier framework, 1ul 10xT4DNA connection enzyme reaction buffer solution, 0.5ul T4DNA are taken
Ligase adds to 10ul total volume with water, and 16 DEG C connect 16 hours；Afterwards plus 1.5ul NEBuffer4 (10X) reaction buffers
Liquid, 1.5ul 10mmol/l ATP, 0.5ul Exonuclease V (5units), 37 DEG C are reacted 0.5 hour to get expression
The AAV of miRNA assists package carrier.
Further, the screening technique of the AAV auxiliary package carrier of the expression miRNA, specific steps include:
(1) package carrier is assisted by the AAV of above-mentioned steps building connection expression miRNA；
(2) convert: 2~10ul of carrier described in (1) converts Stbl3 competent bacteria (ThermoFisher company, goods
Number C737303) 20~100ul (96 orifice plate of 2ml), 42 DEG C put 2 minutes on ice after heat shock 45~60 seconds, then plus 1.5ml TB training
Support base 32 degree shaking table culture 20 hours；Culture bacterium solution 1.2ml is taken to make the extraction of endotoxin-free mini-scale plasmid；
(3) it transfects: the library plasmid mRRC and Ad helper plasmid pAd-deltaF6 that (2) Small Amount is extracted (carrier source:
Carrier portion, Univ Pennsylvania USA UPENN vector core PL-F-PVADF6), can be driven in wide spectrum promoters CAG
Purpose carrier pITR-CAG..Gluc (the expression Gluc fluorescence with both ends with AAVITR sequence of lower expression Gluc luciferase
Plain enzyme is voluntarily constructed by the prior art) (293T is derived from cotransfection 293T cellCRL-3216TM), using training
Support 10% fetal calf serum of base composition, 2mM L-glutamine (ATCC 30-2214), 1%Penicillin/Streptomycin
DMEM in high glucose in (hereinafter referred to as complete medium), at 37 DEG C, 5%CO2Under the conditions of cultivate 48~72 hours, if mRRC is not inserted
Enter the empty carrier of miRNA as control sample；
(4) titre compares screening: whole plate cell carries out Frozen-thawed cycled 3~4 times；Whole plate cell 4000g is centrifuged 15 minutes, is taken
Supernatant makees the infection that suspends: dividing 2E+5~1E+6 293T cell per well into 24 orifice plates, 5~100ul of supernatant is added, and add butyric acid
Sodium is to 2~50 μm of ol/l of final concentration；It is changed to the hole complete medium 200ul/ after 16 hours, supernatant is taken to detect Gluc enzyme after 24 hours
Activity intensity quantifies multiple compared with the control；Determination can improve the clone of 30% or more AAV yield, and the rear strain saved is made
Plate streaking culture chooses clone bacterium and determining miRNA sequence is sequenced.
Further, application of the AAV auxiliary package carrier of the expression miRNA in production AAV.
A method of AAV being produced using the AAV auxiliary package carrier of expression miRNA, specific steps include:
(1), about 1E+5 293T cell is spread into 24 orifice plates, with 37 DEG C of complete medium, 5%CO2Under the conditions of cultivate 16
Hour；
(2), with the carrier and Ad assistant carrier pAd-deltaF6 and pITR-CAG..Gluc carrier of the expression miRNA
Each 0.2~2ug is added in 0.05~0.2ml DMEM, adds PEI 15ul (1ug/ul), mixes at once, places under room temperature
It is added in cell culture medium after ten minutes；
(3), cell and supernatant are collected after cultivating 72 hours, under the conditions of 37 DEG C and in dry ice multigelation three times,
Supernatant is AAV crude extract after ten minutes for 10000g centrifugation；
(4) gained AAV coarse body fluid in (3) is passed through into currently used Iodixanol gradient ultra centrifugation or column chromatographic elution
Method AAV is made.
The invention has the advantages that:
It is any to express that present invention utilizes the 5 ' UTR and 3 ' UTR of the expression skeleton miR33 of an efficient miRNA
miRNA.Based on this skeleton, the positive negative strand primer of required miRNA is synthesized, annealing forms the pre-miRNA connected into skeleton
Express small fragment.
The vector construction of present invention simplification and the process for transfecting cell are realized high-throughput each link of processing, are saved each
Carrier individually clones and the step of sequence verification, realizes the method for high throughput to screen, thus obtaining Effective selection result
On the basis of save vast resources and manpower.It realizes and improves AAV production efficiency about 50% or more.
This patent in the AAV production method of three plasmid transfections by increasing by one miRNA or shRNA of expression, to increase
The production efficiency of AAV.The selection of miRNA is based on a vector selection skeleton: mRRC.This patent also innovatively establishes a letter
Easy but effective carrier construction method constructs a large amount of miRNA or shRNA expression vector using this platform and simple and easy method
To realize the high flux screening for improving AAV yield.
Detailed description of the invention
Fig. 1 is carrier structure schematic diagram of the present invention.
Fluorescence after Fig. 2 infects 293T cell 48 hours for acquisition miR-375-AAV-Gluc after mRRC-miR375 cotransfection
Plain activity ratio relatively schemes: the control generated after the mRRC empty carrier cotransfection that first cylindricality is inserted into figure for no miRNA
Control-AAV-Gluc, second cylindricality are miR-375-AAV-Gluc；The longitudinal axis represents the activity of luciferase after AAV infection
Compare, is control with first cylindricality.
Specific embodiment
The problem of solved in order to better illustrate the present invention, used technical solution and effect achieved, are now tied
It closes specific embodiment and related data is further described.It should be noted that the content of present invention is including but not limited to following implementation
Example and combinations thereof embodiment.
This part is by taking miR375 as an example, and technical scheme of the present invention is further explained.
Embodiment one constructs miRNA carrier library on mRRC carrier and makees to promote the screening of AAV yield
1, the carrier of expression miRNA of the invention, it is restricted interior which introduces two Type IIS at cloning site
The characteristics of enzyme cutting site BsmBI, this fermentoid, is cleavage site and recognition site 2~20 bases apart, therefore draws at the same time
When entering two contrary sites of identification, the identification sequence of itself can be removed after dicing, it is viscous after generating accurate cutting
End is connected for Insert Fragment, not remaining to express sequence useless sequence.
2, the construction method of the carrier of present invention expression miR-375, specific steps include:
(1) made with the Rep/CapDJ auxiliary package carrier for containing CMV-miR33-5 ' UTR-2xBsmBI-3 ' UTR expression cassette
For miR375 expression cloning skeleton carrier, it is named as mRRC, after BsmBI digestion, agarose electrophoresis recycles to obtain linearisation viscosity
Clone's skeleton of end；
(2) from the positive negative strand primer of miR375 needed for the synthesis of primer company:
MiR-375-F:
5’-gcagccccgcgacgagcccctcgcacaaaccggacctgagcgttttgttcgttcggctcgcgtga
ggc-3’
MiR-375-R:
5’-gcctgcctcacgcgagccgaacgaacaaaacgctcaggtccggtttgtgcgaggggctcgtcgcg
ggg-3'；
It is made into 20uM concentration, respectively takes 1ul that 1ul 10xT4DNA connection reaction buffer, 7ul H is added2It is mixed in O, 95 DEG C
Denaturation is annealed to room temperature after five minutes, with 5 DEG C of speed per minute cooling, forms the pre-miR375 (SEQ that Dual chain belt glues end
ID NO:3) expression small fragment；
(3) by the pre-miR375 expression small fragment connect into above-mentioned skeleton carrier the site 2xBsmBI (200ul, 96
In orifice plate): after the pre-miRNA expression small fragment that the Dual chain belt that annealing is generated glues end dilutes 20 times, take 1ul, then plus
25ng mRRC skeleton carrier, 1ul 10x T4DNA connection enzyme reaction buffer solution, 0.5ul T4DNA ligase, are added to water
10ul total volume, 16 DEG C connect 16 hours；Afterwards plus 1.5ul NEBuffer4 (10X) reaction buffer, 1.5ul10mmol/
LATP, 0.5ul Exonuclease V (5units), 37 DEG C are reacted 0.5 hour.
This method operates vector construction with 96 orifice plate high-flux parallels.Due to apply Exonuclease V (RecBCD,
NEB Cat#M0345S), the not connected carriers of the overwhelming majority are removed, loop connecting successful product is left behind, prevent from linear not connecting
It is connected into function plasmid and enters the useless clone being inserted into after bacterium by the non-target fragment of recombination generation, greatly reduce final clone's back
Scape, therefore converted product can not choose monoclonal as bed board；Using the result for screening the AAV yield that gets a promotion as standard, the positive is obtained
Confirmation is sequenced again after the selection result, and it detects the sequence in expression cassette, saves clone's routine link of the overwhelming majority.In contrast,
Exist in routine techniques due to accounting for a high proportion of non-purpose clone, needs to choose multiple clones, through too small upgrading grain and sequencing,
Correct clone is verified, then transfects, infect, screen.The low background cloning process application of high throughput of the invention introduces removal line
Property DNA excision enzyme V, can remove the not connected carriers of the overwhelming majority, leave behind successful connection product, it is ensured that conversion enters competence
The loop connecting product of the substantially successful connection of bacterium,
In the prior art due to the presence of unrelated clone, need to choose multiple clones, through too small upgrading grain and sequencing, verifying
Correct clone out, then transfect, infect, screen.High-flux clone method of the invention applies exonuclease
Exonuclease V removes not connected carrier, substantially reduces clone's background, so as to without clone's verifying is chosen the case where
The lower screening operation for making downstream experiment.
3, the screening technique of the carrier of present invention expression miRNA, specific steps include:
(1) above-mentioned carrier is constructed by above-mentioned steps；
(2) convert: 2~10ul of connection product carrier described in (3) converts Stbl3 competent bacteria
(ThermoFisher company, article No. C737303) 20~100ul (96 orifice plate of 2ml), 42 DEG C put on ice 2 after heat shock 45~60 seconds
Minute, then plus 1.5ml TB culture medium 32 degree shaking table culture 20 hours；Culture bacterium solution 1.2ml is taken to make endotoxin-free mini-scale plasmid
It extracts.
(3) it transfects: the library plasmid mRRC and Ad helper plasmid pAd-deltaF6 that (2) Small Amount is extracted (carrier source:
Carrier portion, Univ Pennsylvania USA UPENN vector core PL-F-PVADF6), can be driven in wide spectrum promoters CAG
The carrier pITR-CAG..Gluc (expression Gluc luciferase, voluntarily construct) with ITR mesh of lower expressing green fluorescent protein, it is total to
Transfecting 293T cell, (293T is derived fromCRL-3216TM), if mRRC is not inserted into the empty carrier of miRNA as control
Sample is cultivated 48~72 hours in 37 degree of 5%CO cell incubators；
(4) titre compares screening: whole plate cell carries out Frozen-thawed cycled 3~4 times；Whole plate cell 4000g is centrifuged 15 minutes, is taken
Supernatant makees the infection that suspends: dividing 2E+5~1E+6 293T cell per well into 24 orifice plates, 5~100ul of supernatant is added, and add butyric acid
Sodium is to 2~50 μm of ol/l of final concentration；Change complete medium after 16 hours into, the hole 200ul/ takes supernatant to detect after 24 hours
Gluc enzyme activity, quantifies multiple compared with the control；Determination can improve the clone of 30% or more AAV yield, afterwards with preservation
Strain scribing line chooses clone bacterium and determining miRNA sequence is sequenced.
The method that embodiment two produces AAV using the carrier of expression miRNA
Experimental material: 293T cell, Ad helper plasmid pAd-deltaF6, AAV assist packaging plasmid mRRC-375, ITR mesh
Carrier pITR-CAG..Gluc, PEI (1ug/ul), DMEM high glucose medium.
1, divide 1E+5 293T cell into 24 orifice plates in advance, with 37 DEG C of complete medium, 5%CO2Under the conditions of cultivate 16
Hour；
2, with the mRRC-375 carrier and Ad assistant carrier pAd-deltaF6 and pITR-CAG..Gluc carrier each 0.2~
2ug is added in 0.5ml DMEM, adds PEI15ul (1ug/ul), mixes at once, places and is added after ten minutes carefully under room temperature
In born of the same parents' culture medium；
3, cell and supernatant are collected after 72 hours, three times, 10000g is centrifuged 10 to multigelation in 37 DEG C of water-baths and dry ice
Supernatant is AAV crude extract after minute.
Comparative experiments: in addition to mRRC carrier replaces with the RC carrier of conventional AAV production, remaining reagent and step are complete
Equally.
Uciferase activity result after being infected 293T cell 48 hours using present invention expression miRNA carrier and conventional carrier
As shown in Fig. 2, interpretation of result: the present invention need not change in originally production AAV method, only replace original expression
The carrier RC (X) of AAV replication protein Rep2 and AAV-X serotype coat protein (CapX) is mRRC (X), that is, can reach promotion
The effect of AAV yield 50%.The no significant difference in terms of AAV mass.
The embodiments described above only express several embodiments of the present invention, and the description thereof is more specific and detailed, but simultaneously
Limitations on the scope of the patent of the present invention therefore cannot be interpreted as.It should be pointed out that for those of ordinary skill in the art
For, without departing from the inventive concept of the premise, various modifications and improvements can be made, these belong to guarantor of the invention
Protect range.Therefore, the scope of protection of the patent of the invention shall be subject to the appended claims.
<110>Guangzhou Pai Zhen Bioisystech Co., Ltd
<120>a kind of construction method, screening technique and the application of the AAV auxiliary package carrier and the carrier for expressing miRNA
<160> 3
<210> 1
<211> 100
<212> RNA
<213>artificial sequence
<400> 1
agggctctgc gtttgctcca ggtagtccgc tgctcccttg ggcctgggcc cactgacagc 60
cctggtgcct ctggccggct gcacacctcc tggcgggcag 100
<210> 2
<211> 100
<212> RNA
<213>artificial sequence
<400> 2
aggcctgccc tgactgccca cggtgccgtg gccaaagagg atctaagggc accgctgagg 60
gcctacctaa ccatcgtggg gaataaggac agtgtcaccc 100
<210> 3
<211> 64
<212> RNA
<213>artificial sequence
<400> 3
ccccgcgacg agcccctcgc acaaaccgga cctgagcgtt ttgttcgttc ggctcgcgtg 60
aggc 64
Claims (8)
1. a kind of AAV for expressing miRNA assists package carrier, which is characterized in that the carrier is based on Rep2 and CapDJ auxiliary and wraps
Load body, CMV promoter driving under miR33-5 ' UTR and miR33-3 ' UTR between insertion clone miRNA site 2 ×
BsmBI, miRNA expression small fragment connect the site 2xBsmBI into the skeleton carrier, and are terminated and turned with the pA terminator of synthesis
Record, wherein the base sequence of miR33-5 ' UTR is as shown in SEQ ID NO:1, the base sequence of miR33-3 ' UTR such as SEQ ID
Shown in NO:2, the base sequence of the miRNA is as shown in SEQ ID NO:3.
2. the construction method of the AAV auxiliary package carrier of expression miRNA described in claim 1, which is characterized in that the expression
The construction method of the carrier of miRNA, comprising steps of
(1), clone's skeleton of preparation linearisation cohesive end；
(2), the miRNA expression small fragment that Dual chain belt glues end is prepared；
(3), miRNA in (2) small fragment is expressed to be connected in (1) on clone's skeleton.
3. construction method according to claim 2, which is characterized in that the construction method of the carrier of the expression miRNA, tool
Body step includes:
(1), use the Rep/CapDJ for containing CMV-miR33-5 ' UTR-2xBsmBI-3 ' UTR expression cassette assist package carrier as
MiRNA expression cloning skeleton carrier, BsmBI digestion obtain the cloning vector skeleton of linearisation cohesive end；
(2), the positive negative strand primer of the miRNA needed for synthesis, is made into 20uM concentration, by volume normal chain respectively: anti-chain:
10xT4DNA: sterilizing nuclease free H2The proportion of O=1:1:1:7 takes positive strand primer, negative strand primer that 10xT4DNA connection is added instead
Buffer is answered, and in sterilizing nuclease free H2It is mixed in O, 95 DEG C of denaturation after five minutes, are cooled down with 5 DEG C of speed per minute and annealed
To room temperature, the miRNA expression small fragment that Dual chain belt glues end is obtained；
(3), the expression small fragment of miRNA obtained in step (2) is connected to the skeleton carrier of linearisation obtained in step (1)
The site 2 × BsmBI: after the miRNA expression small fragment that the Dual chain belt that annealing is generated glues end dilutes 20 times, take 1ul, then plus
MiRNA expression cloning skeleton carrier, 1ul 10xT4DNA connection enzyme reaction buffer solution, 0.5ul T4DNA in 25ng step (1)
Ligase adds to 10ul total volume with water, and 16 DEG C connect 16 hours；Afterwards plus 1.5ul NE Buffer4 reaction buffer,
1.5ul 10mmol/lATP, 0.5ul Exonuclease V, 37 DEG C of reaction 0.5 hour AAV auxiliary to get expression miRNA
Package carrier, wherein the additive amount that the extension rate of NE Buffer is 10, Exonuclease V is 5 units.
4. construction method according to claim 3, which is characterized in that the construction method uses 96 orifice plate high-flux parallels
Operation.
5. described in the AAV auxiliary package carrier or claim 2-4 any one of a kind of expression miRNA described in claim 1
The screening technique of the AAV auxiliary package carrier of the expression miRNA of method building, step include:
(1) prepare carrier described in claim 1, or construct connection table suddenly by claim 2-4 any one the method
AAV up to miRNA assists package carrier；
(2) convert: the carrier described in (1) converts Stbl3 competent bacteria, and culture takes culture bacterium solution to make endotoxin-free a small amount of
Plasmid extracts；
(3) it transfects: by the plasmid of (2) Small Amount extraction and Ad helper plasmid pAd-deltaF6, with the carrier pITR- of ITR mesh
CAG..Gluc cotransfection 293T cell, if being not inserted into the empty carrier of miRNA as control sample, culture；
(4) titre compares screening: whole plate cell carries out freeze thawing, and centrifugation takes supernatant to make the infection that suspends；Then Gluc enzymatic activity is detected
Intensity quantifies multiple compared with the control；Determination can improve the clone of AAV yield, save；Make plate with the clone's strain saved afterwards
Scribing line culture chooses clone bacterium and determining miRNA sequence is sequenced.
6. screening technique according to claim 5, which is characterized in that the specific steps of the screening technique include:
(1) prepare carrier described in claim 1, or construct connection table suddenly by claim 2-4 any one the method
AAV up to miRNA assists package carrier；
(2) it converts: converting Stbl3 competent bacteria with 2~10ul of carrier described in (1), 42 DEG C put ice after heat shock 45~60 seconds
Upper 2 minute, then plus 1.5ml TB culture medium 32 degree shaking table culture 20 hours；Culture bacterium solution 1.2ml is taken to make endotoxin-free a small amount of
Plasmid extracts；
(3) it transfects: by the plasmid of (2) Small Amount extraction and Ad helper plasmid pAd-deltaF6, with the carrier pITR- of ITR mesh
CAG..Gluc cotransfection 293T cell, if being not inserted into the empty skeleton carrier of miRNA as control sample, 37 degrees Celsius of 5%CO2
It is cultivated 48~72 hours in incubator；
(4) titre compares screening: whole plate cell carries out Frozen-thawed cycled 3~4 times；Whole plate cell 4000g is centrifuged 15 minutes, takes supernatant
Make the infection that suspends: dividing 2E+5~1E+6 293T cell per well into 24 orifice plates, 5~100ul of supernatant is added, and add sodium butyrate extremely
2~50 μm of ol/l of final concentration；Complete medium is changed to after 16 hours, the hole 200ul/ takes supernatant to detect Gluc enzyme activity after 24 hours
Property intensity, quantifies multiple compared with the control；Determination can improve the clone of AAV yield, save；Make plate with the strain saved afterwards to draw
Line culture chooses clone bacterium and determining miRNA sequence is sequenced.
7. screening technique according to claim 6, which is characterized in that the conversion operation of the step (2) is in 96 orifice plates
It completes.
8. a kind of method of the AAV auxiliary package carrier production AAV using expression miRNA, specific steps include:
(1), about 1 × 10 is spread5A 293T cell is into 24 orifice plates, with 37 DEG C of complete medium, 5%CO2Under the conditions of culture it is 16 small
When；
(2), take expression miRNA carrier and Ad assistant carrier pAd-deltaF6 and pITR-CAG..Gluc carrier each 0.2~
2ug is added in 0.05~0.2ml DMEM, adds PEI 15ul (1ug/ul), mixes at once, places after ten minutes under room temperature
It is added in cell culture medium；
(3), cell and supernatant are collected after cultivating 72 hours, under the conditions of 37 DEG C and in dry ice multigelation three times, 10000g from
Supernatant is AAV crude extract to the heart after ten minutes；
(4) AAV is made in gained AAV coarse body fluid in (3).
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710553167.4A CN107384957B (en) | 2017-07-07 | 2017-07-07 | A kind of construction method, screening technique and the application of AAV auxiliary package carrier and the carrier that expressing miRNA |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710553167.4A CN107384957B (en) | 2017-07-07 | 2017-07-07 | A kind of construction method, screening technique and the application of AAV auxiliary package carrier and the carrier that expressing miRNA |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107384957A CN107384957A (en) | 2017-11-24 |
| CN107384957B true CN107384957B (en) | 2019-04-19 |
Family
ID=60334321
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710553167.4A Active CN107384957B (en) | 2017-07-07 | 2017-07-07 | A kind of construction method, screening technique and the application of AAV auxiliary package carrier and the carrier that expressing miRNA |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107384957B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110184297A (en) * | 2019-05-27 | 2019-08-30 | 广州派真生物技术有限公司 | A kind of AAV auxiliary package carrier, building screening technique and application for expressing shRNA |
| CN111557927A (en) * | 2020-04-26 | 2020-08-21 | 天津大学 | Synthesis method of nanoparticles for treating immune hemolytic anemia |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101532024A (en) * | 2009-04-30 | 2009-09-16 | 许瑞安 | New type cell special gene HAAVmir containing microRNA combined sequence for gene treating |
| CN103290052B (en) * | 2012-02-24 | 2016-02-03 | 上海诺百生物科技有限公司 | A kind of adenovirus system of improvement and the Synthesis and applications of virion thereof |
-
2017
- 2017-07-07 CN CN201710553167.4A patent/CN107384957B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN107384957A (en) | 2017-11-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AU2015231231B2 (en) | Genome editing without nucleases | |
| CN104603272B (en) | The cell of adeno-associated virus vector can be produced | |
| CN106755089B (en) | Cell line for expressing goat lymphocyte activating molecules and construction method and application thereof | |
| US20200055925A1 (en) | Method for preparing whole bovine-derived broadly neutralizing antibody against serotype o foot-and-mouth disease virus | |
| CN108330147A (en) | A kind of foundation of recombined glandulae correlation viral vectors production technology | |
| CN107384957B (en) | A kind of construction method, screening technique and the application of AAV auxiliary package carrier and the carrier that expressing miRNA | |
| CN110951699A (en) | Recombinant rabies virus for expressing structural protein of canine distemper virus and application thereof | |
| Walker et al. | Method for efficient transduction of cancer stem cells | |
| CN112680443A (en) | Promoter pCalm1 and application thereof | |
| US20220243243A1 (en) | Expression of products from nucleic acid concatemers | |
| Liu et al. | An optimized circular polymerase extension reaction-based method for functional analysis of SARS-CoV-2 | |
| JP7440045B2 (en) | Nucleic acid-encapsulated AAV hollow particles | |
| Bardelli et al. | Analysis of replicative intermediates of Adeno-associated virus through hirt extraction and Southern Blotting | |
| CN105200059A (en) | SiRNA for targeted inhibition of mouse UCP2 gene expression and construction of expression vector thereof | |
| CN110184297A (en) | A kind of AAV auxiliary package carrier, building screening technique and application for expressing shRNA | |
| US20230310555A1 (en) | Compositions for genome editing and methods of use thereof | |
| US20220380750A1 (en) | Method for the production of raav and method for the in vitro generation of genetically engineered, linear, single-stranded nucleic acid fragments containing itr sequences flanking a gene of interest | |
| CN111394379B (en) | Site-directed mutagenesis method of large vector DNA (deoxyribonucleic acid) based on recombinase and super-fidelity DNA polymerase | |
| CN111378621B (en) | B lymphoma cell strain stably transfected by EB virus latent membrane protein 1, construction method and application thereof | |
| CN113736799A (en) | Goat parainfluenza virus type 3 infectious cDNA cloning construction method and application thereof | |
| CN105420275A (en) | Method for preparing exogenous functional gene targeted integration human neural stem cells | |
| CN106957820B (en) | Culture medium for in vitro chondrocyte telomere prolonged proliferation culture, kit and application | |
| CN112695032B (en) | Promoter pLRRK2 and application thereof | |
| CN112342244B (en) | Cell strain for expressing Furin protein and application of cell strain in avian infectious bronchitis virus culture | |
| CN117778431A (en) | Plasmid system for packaging recombinant adeno-associated virus and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |