CN107384957A - The AAV auxiliary package carriers of expression miRNA a kind of and construction method, screening technique and the application of the carrier - Google Patents
The AAV auxiliary package carriers of expression miRNA a kind of and construction method, screening technique and the application of the carrier Download PDFInfo
- Publication number
- CN107384957A CN107384957A CN201710553167.4A CN201710553167A CN107384957A CN 107384957 A CN107384957 A CN 107384957A CN 201710553167 A CN201710553167 A CN 201710553167A CN 107384957 A CN107384957 A CN 107384957A
- Authority
- CN
- China
- Prior art keywords
- mirna
- carrier
- aav
- expression
- clone
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/66—General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligation; Use of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
- C12N2750/00011—Details
- C12N2750/14011—Parvoviridae
- C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
- C12N2750/14151—Methods of production or purification of viral material
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Plant Pathology (AREA)
- Medicinal Chemistry (AREA)
- Virology (AREA)
- Analytical Chemistry (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to genetic engineering field, and in particular to the AAV auxiliary package carriers of expression miRNA a kind of and construction method, screening technique and the application of the carrier；The carrier is based on Rep2 and CapDJ auxiliary package carriers, and clone miRNA 2 × BsmBI of site is inserted between miR33 5 ' UTR and miR33 3 ' UTR under CMV promoter driving, and miRNA expression small fragments connect the 2xBsmBI sites into the skeleton carrier.The construction method of the carrier includes：Prepare clone's skeleton；Prepare miRNA expression small fragments；MiRNA expression small fragments are connected on clone's skeleton carrier.The screening technique includes：Stbl3 competence bacteriums, plasmid extraction are converted with the carrier；By the plasmid co-transfection 293T cells of extraction；Titre compares screening.The present invention, which realizes, improves AAV production efficiencys about more than 50%.
Description
Technical field
The present invention relates to genetic engineering field, and in particular to the AAV auxiliary package carriers of expression miRNA a kind of and the carrier
Construction method, screening technique and application.
Background technology
Gene therapy at present is just progressively becoming reality from the dream of countless scientists in recent decades.The load of gene therapy
Body is always the key of whole gene treatment：Need that security, validity, specificity can be met.A variety of viruses, non-virus carrier
By differentiation for many years, eliminate, recombinant adeno-associated virus (rAAV) carrier is the base for being known as meeting three above standard at present
Because of therapy vector.Due to AAV production yield Slow lifting, thus the popularity of clinical practice is also made by this for a long time
About.As first gene therapy medicament Glybera for treating fatty acid enzyme defect by European Union's approval was listed in recent years,
The SPK-RPE65 tri- phases clinical manifestations of the congenital blindness for the treatment of of Spark Theraputics companies are outstanding, and AAV is as gene
The direction of therapy vector has been proved to completely with road, but AAV production efficiency is still the critical bottleneck of gene therapy.One need
Wanting the genetic disease of whole body F-duction needs AAV about 1x 1015The particle of AAV genome copy numbers (GC), and this clinical rank
Output need 500,000 dollars.In production, if can be obtained with 50 15cm disks in the range of current laboratory capabilities
1x10^13GC production efficiency calculates, then the production scale for needing to produce 100 times or 100 times can just obtain medical treatment one
The total amount of patient.
Therefore, AAV yield bottleneck is urgently broken.AAV main flow production method is three plasmid transfection 293T cells at present
Method.Three plasmid transfection methods are simple, quick, but because 293T is attached cell, extension of this method in scale relatively has tired
It is difficult.But if attached cell can be domesticated for suspension cell, then this method can break the limitation of itself, turn into large-scale industrial life
The important candidate scheme of production.Adherent 293T cells are domesticated for suspension cell, and someone is successful in recent years, but due to original
This production efficiency is still the failure to meet demand, therefore large-scale production can only be by solely increasing production scale.Therefore, in side
Improve, innovate in method, it is one of focus of current gene therapy to obtain higher AAV yields.
The content of the invention
In view of this, it is necessary to for the problem of, there is provided the carrier of expression miRNA a kind of and the construction method of the carrier,
Screening technique and application, the carrier are used as miRNA expression, to improve AAV productions；The construction method, Screening Platform are real
Existing high flux handles each link, each carrier individually clone and the step of sequence verification is saved, so as to obtain Effective selection knot
Ample resources and manpower are saved on the basis of fruit.
The present invention is achieved through the following technical solutions：
A kind of expression miRNA of Rep2 and CapDJ auxiliary package carrier based on routine carrier, structure as shown in figure 1,
MiR33-5 ' UTR (SEQ ID NO in Rep2 and CapDJ auxiliary package carriers under CMV promoter driving:And miR33- 1)
3’UTR(SEQ ID NO:2) insertion clone miRNA site 2x BsmBI between, miRNA expression small fragments are connected into skeleton
The 2xBsmBI sites of carrier, and transcription is terminated with the pA terminators of synthesis.
Further, the construction method of the carrier of the expression miRNA, step include：
(1) clone's skeleton of linearisation cohesive end, is prepared；
(2) the miRNA expression small fragments that Dual chain belt glues end, are prepared；
(3) miRNA in (2), is expressed into small fragment to be connected in (1) on clone's skeleton.
Further, the construction method of the carrier of the expression miRNA, specific steps include：
(1), packed with the above-mentioned Rep/CapDJ auxiliary for containing CMV-miR33-5 ' UTR-2xBsmBI-3 ' UTR expression cassettes
Carrier is named as mRRC, the clone that BsmBI digestions obtain linearizing cohesive end uses as miRNA expression cloning skeleton carriers
Carrier framework；
(2), the positive negative strand primer of the miRNA needed for synthesis, is made into 20uM concentration, by volume normal chain respectively：Anti-chain：
10xT4DNA：The nuclease free that sterilizes H2O=1:1:1:7 proportioning takes positive strand primer, negative strand primer to add 10xT4DNA connections instead
Buffer solution is answered, and in sterilizing nuclease free H2Mixed in O, after 95 DEG C are denatured 5 minutes, are cooled with 5 DEG C per minute of speed and annealed
To normal temperature, the miRNA expression small fragments that Dual chain belt glues end are obtained；
(3) the miRNA expression small fragments of gained in step (2), are connected into the skeleton into the linearisation of gained in step (1)
The 2xBsmBI sites of carrier (in the orifice plates of 200ul 96)：The miRNA expression small fragments for Dual chain belt caused by annealing being glued end are dilute
After releasing 20 times, 1ul is taken, then add 25ng mRRC carrier frameworks, 1ul 10xT4DNA connections enzyme reaction buffer solution, 0.5ul T4DNA
Ligase, 10ul cumulative volumes are added to water, 16 DEG C connect 16 hours；Afterwards plus 1.5ul NEBuffer4 (10X) reactions buffer
Liquid, 1.5ul 10mmol/l ATP, 0.5ul Exonuclease V (5units), 37 DEG C are reacted 0.5 hour, produce expression
MiRNA AAV auxiliary package carriers.
Further, the screening technique of the AAV auxiliary package carriers of the expression miRNA, specific steps include：
(1) the AAV auxiliary package carriers by above-mentioned steps structure connection table up to miRNA；
(2) convert：2~10ul of carrier described in (1) converts Stbl3 competence bacterium (ThermoFisher companies, goods
Number C737303) 20~100ul (orifice plates of 2ml 96), 42 DEG C of heat shocks are put 2 minutes on ice after 45~60 seconds, then add 1.5ml TB trainings
Base is supported in 32 degree of shaking table cultures 20 hours；Culture bacterium solution 1.2ml is taken to make the extraction of endotoxin-free mini-scale plasmid；
(3) transfect：By the plasmid mRRC storehouses and Ad helper plasmids pAd-deltaF6 (carrier sources of the extraction of (2) Small Amount：
Carrier portion of Univ Pennsylvania USA UPENN vector core PL-F-PVADF6), can be driven in wide spectrum promoters CAG
Lower expression Gluc luciferases (express Gluc fluorescence with purpose carrier pITR-CAG..Gluc of the both ends with AAVITR sequences
Plain enzyme, voluntarily being built by prior art) cotransfection 293T cells (293T, derive fromCRL-3216TM), using training
Support the hyclone of base composition 10%, 2mM L-glutamine (ATCC 30-2214), 1%Penicillin/Streptomycin
DMEM in high glucose in (hereinafter referred to as complete medium), at 37 DEG C, 5%CO2Under the conditions of cultivate 48~72 hours, if mRRC is not inserted
Enter miRNA empty carrier as control sample；
(4) titre compares screening：Whole plate cell carries out Frozen-thawed cycled 3~4 times；Whole plate cell 4000g is centrifuged 15 minutes, is taken
Supernatant makees the infection that suspends：Divide 2E+5~1E+6 293T cell per well into 24 orifice plates, add 5~100ul of supernatant, and add butyric acid
Sodium is to 2~50 μm of ol/l of final concentration；Complete medium 200ul/ holes are changed to after 16 hours, take supernatant to detect Gluc enzymes after 24 hours
Activity intensity, quantify multiple compared with the control；It is determined that the clone of AAV yield more than 30% can be improved, the rear strain preserved is made
Plate streaking culture, choose clone bacterium sequencing and determine miRNA sequence.
Further, application of the AAV auxiliary package carriers of the expression miRNA in AAV is produced.
A kind of method using the AAV auxiliary package carrier productions AAV for expressing miRNA, specific steps include：
(1) about 1E+5 293T cell, is spread into 24 orifice plates, with 37 DEG C of complete medium, 5%CO2Under the conditions of cultivate 16
Hour；
(2), with the carrier and Ad assistant carrier pAd-deltaF6 and pITR-CAG..Gluc carriers of the expression miRNA
Each 0.2~2ug, add in 0.05~0.2ml DMEM, add PEI 15ul (1ug/ul), mix at once, placed under normal temperature
Added after 10 minutes in cell culture medium；
(3) cell and supernatant are collected after, cultivating 72 hours, under the conditions of 37 DEG C with multigelation in dry ice three times,
Supernatant is AAV crude extracts after 10000g is centrifuged 10 minutes；
(4) gained AAV coarse body fluids in (3) are eluted by currently used Iodixanol gradient ultra centrifugation or column chromatography
Method AAV is made.
Beneficial effect of the present invention：
It is any to express present invention utilizes efficient miRNA expression skeleton miR33 5 ' UTR and 3 ' UTR
miRNA.Based on this skeleton, required miRNA positive negative strand primer is synthesized, anneal the pre-miRNA for being formed and being connected into skeleton
Express small fragment.
The flow of the simplified vector construction of the present invention and transfectional cell, realize that high flux handles each link, save each
The independent clone and the step of sequence verification of carrier, realizes with high-throughout method to screen, so as to obtain Effective selection result
On the basis of save ample resources and manpower.Realize and improve AAV production efficiencys about more than 50%.
This patent in the AAV production methods of three plasmid transfections by increasing by one miRNA or shRNA of expression, with increase
AAV production efficiency.MiRNA selection is based on a vector selection skeleton：mRRC.This patent also innovatively establishes a letter
Easy but effective carrier construction method, substantial amounts of miRNA or shRNA expression vectors are constructed using this platform and simple and easy method
To realize the high flux screening for improving AAV yield.
Brief description of the drawings
Fig. 1 is carrier structure schematic diagram of the present invention.
Fig. 2 is to obtain miR-375-AAV-Gluc after mRRC-miR375 cotransfections to infect 293T cells fluorescence after 48 hours
Plain activity ratio relatively schemes：First cylindricality is caused control after the mRRC empty carrier cotransfections without miRNA insertions in figure
Control-AAV-Gluc, second cylindricality are miR-375-AAV-Gluc；The longitudinal axis represents the activity of luciferase after AAV infection
Compare, using first cylindricality as control.
Embodiment
In order to which problem, used technical scheme and the effect reached solved by the invention is better described, now tie
Close specific embodiment and related data is expanded on further.It should be noted that present invention is including but not limited to following implementation
Example and combinations thereof embodiment.
This part is described further by taking miR375 as an example to technical solution of the present invention.
Embodiment one builds the screening that lifting AAV yield is made in miRNA carriers storehouse on mRRC carriers
1st, expression miRNA of the invention carrier, it is restricted interior that the carrier introduces two Type IIS at cloning site
Enzyme cutting site BsmBI, it is that cleavage site, at a distance of 2~20 bases, therefore draws at the same time with recognition site the characteristics of this fermentoid
When entering two identification sites in opposite direction, the recognition sequence of itself can be removed after dicing, produced viscous after accurate cutting
End connects for Insert Fragment, not remaining to reach useless sequence to sequence table.
2nd, the construction method of present invention expression miR-375 carrier, specific steps include：
(1) made with the Rep/CapDJ auxiliary package carriers for containing CMV-miR33-5 ' UTR-2xBsmBI-3 ' UTR expression cassettes
For miR375 expression cloning skeleton carriers, mRRC is named as, after BsmBI digestions, agarose electrophoresis reclaims to obtain linearisation viscosity
Clone's skeleton of end；
(2) from the positive negative strand primer of the miR375 needed for the synthesis of primer company：
miR-375-F：
5’-gcagccccgcgacgagcccctcgcacaaaccggacctgagcgttttgttcgttcggctcgcgtgag
gc-3’
miR-375-R：
5’-gcctgcctcacgcgagccgaacgaacaaaacgctcaggtccggtttgtgcgaggggctcgtcgcgg
gg-3’；
20uM concentration is made into, respectively takes 1ul to add 1ul 10xT4DNA coupled reaction buffer solutions, 7ul H2Mixed in O, 95 DEG C
After denaturation 5 minutes, normal temperature is annealed to 5 DEG C per minute of speed cooling, forms the pre-miR375 (SEQ that Dual chain belt glues end
ID NO:3) small fragment is expressed；
(3) by the pre-miR375 expression small fragment connect into above-mentioned skeleton carrier 2xBsmBI sites (200ul, 96
In orifice plate)：After 20 times of pre-miRNA expression small fragments dilution for Dual chain belt caused by annealing being glued end, 1ul is taken, then add
25ng mRRC skeleton carriers, 1ul 10x T4DNA connections enzyme reaction buffer solution, 0.5ul T4DNA ligases, are added to water
10ul cumulative volumes, 16 DEG C connect 16 hours；Afterwards plus 1.5ul NEBuffer4 (10X) reaction buffer, 1.5ul10mmol/
LATP, 0.5ul Exonuclease V (5units), 37 DEG C are reacted 0.5 hour.
This method operates vector construction with 96 orifice plate high-flux parallels.Due to apply Exonuclease V (RecBCD,
NEB Cat#M0345S), the not connected carriers of the overwhelming majority are removed, leave behind loop connecting successful product, prevent from linear not connecting
It is connected into work(plasmid and enters after bacterium the useless clone inserted by the non-purpose fragment of restructuring generation, greatly reduces and finally clone the back of the body
Scape, therefore converted product can not choose monoclonal as bed board；Using the result for screening the AAV yield that gets a promotion as standard, the positive is obtained
The sequence for confirming that it is detected in expression cassette is sequenced after the selection result again, saves clone's routine link of the overwhelming majority.By contrast,
Exist in routine techniques due to accounting for a high proportion of non-purpose clone, it is necessary to choose multiple clones, through too small upgrading grain and sequencing,
Correct clone is verified, then transfects, infect, screen.The low background cloning process application of high flux of the present invention, which introduces, removes line
Property DNA excision enzyme V, can remove the not connected carriers of the overwhelming majority, leave behind successful connection product, it is ensured that conversion enters competence
The loop connecting product of the substantially successful connection of bacterium,
In the prior art because the presence of unrelated clone is, it is necessary to choose multiple clones, through too small upgrading grain and sequencing, checking
Go out correct clone, then transfect, infect, screen.The high-flux clone method of the present invention applies exonuclease
Exonuclease V, not connected carrier is removed, substantially reduces clone's background, so as to without the situation for choosing clone's checking
The lower screening operation for making downstream experiment.
3rd, the screening technique of present invention expression miRNA carrier, specific steps include：
(1) above-mentioned carrier is built by above-mentioned steps；
(2) convert：2~10ul of connection product carrier described in (3) converts Stbl3 competence bacteriums
(ThermoFisher companies, article No. C737303) 20~100ul (orifice plates of 2ml 96), 42 DEG C of heat shocks put on ice 2 after 45~60 seconds
Minute, then add 1.5ml TB culture mediums in 32 degree of shaking table cultures 20 hours；Culture bacterium solution 1.2ml is taken to make endotoxin-free mini-scale plasmid
Extraction.
(3) transfect：By the plasmid mRRC storehouses and Ad helper plasmids pAd-deltaF6 (carrier sources of the extraction of (2) Small Amount：
Carrier portion of Univ Pennsylvania USA UPENN vector core PL-F-PVADF6), can be driven in wide spectrum promoters CAG
The carrier pITR-CAG..Gluc (expression Gluc luciferases, voluntarily build) of the band ITR mesh of lower expressing green fluorescent protein, it is total to
Transfection 293T cells (293T, derive fromCRL-3216TM), if mRRC is not inserted into miRNA empty carrier as control
Sample, cultivate 48~72 hours in 37 degree of 5%CO cell culture incubators；
(4) titre compares screening：Whole plate cell carries out Frozen-thawed cycled 3~4 times；Whole plate cell 4000g is centrifuged 15 minutes, is taken
Supernatant makees the infection that suspends：Divide 2E+5~1E+6 293T cell per well into 24 orifice plates, add 5~100ul of supernatant, and add butyric acid
Sodium is to 2~50 μm of ol/l of final concentration；Change complete medium after 16 hours into, 200ul/ holes, take supernatant to detect after 24 hours
Gluc enzyme activities, quantify multiple compared with the control；It is determined that the clone of AAV yield more than 30% can be improved, it is rear to use what is preserved
Strain is rule, and is chosen clone bacterium sequencing and is determined miRNA sequence.
The method that embodiment two produces AAV using the carrier for expressing miRNA
Experiment material：293T cells, Ad helper plasmids pAd-deltaF6, AAV auxiliary packaging plasmid mRRC-375, ITR mesh
Carrier pITR-CAG..Gluc, PEI (1ug/ul), DMEM high glucose mediums.
1st, 1E+5 293T cell is divided in advance into 24 orifice plates, with 37 DEG C of complete medium, 5%CO2Under the conditions of cultivate 16
Hour；
2nd, with the mRRC-375 carriers and Ad assistant carriers pAd-deltaF6 and pITR-CAG..Gluc carrier each 0.2~
2ug, add in 0.5ml DMEM, add PEI15ul (1ug/ul), mix at once, added after being placed 10 minutes under normal temperature thin
In born of the same parents' culture medium；
3rd, cell and supernatant are collected after 72 hours, three times, 10000g centrifuges 10 to multigelation in 37 DEG C of water-baths and dry ice
Supernatant is AAV crude extracts after minute.
Contrast experiment：In addition to the RC carriers that mRRC carriers replace with conventional AAV productions, remaining reagent and step are complete
Equally.
Utilize uciferase activity result after present invention expression miRNA carriers and conventional carrier infection 293T cells 48 hours
As shown in Fig. 2 interpretation of result：The present invention need not change originally in production AAV methods, only replace original expression
The carrier RC (X) of AAV replication protein Rep2 and AAV-X serotype coat protein (CapX) is mRRC (X), you can reaches lifting
The effect of AAV yield 50%.The no significant difference in terms of AAV mass.
Embodiment described above only expresses the several embodiments of the present invention, and its description is more specific and detailed, but simultaneously
Therefore the limitation to the scope of the claims of the present invention can not be interpreted as.It should be pointed out that for one of ordinary skill in the art
For, without departing from the inventive concept of the premise, various modifications and improvements can be made, these belong to the guarantor of the present invention
Protect scope.Therefore, the protection domain of patent of the present invention should be determined by the appended claims.
<110>Guangzhou Pai Zhen Bioisystech Co., Ltd
<120>The AAV auxiliary package carriers of expression miRNA a kind of and construction method, screening technique and the application of the carrier
<160> 3
<210> 1
<211> 100
<212> RNA
<213>Artificial sequence
<400> 1
agggctctgc gtttgctcca ggtagtccgc tgctcccttg ggcctgggcc cactgacagc 60
cctggtgcct ctggccggct gcacacctcc tggcgggcag 100
<210> 2
<211> 100
<212> RNA
<213>Artificial sequence
<400> 2
aggcctgccc tgactgccca cggtgccgtg gccaaagagg atctaagggc accgctgagg 60
gcctacctaa ccatcgtggg gaataaggac agtgtcaccc 100
<210> 3
<211> 64
<212> RNA
<213>Artificial sequence
<400> 3
ccccgcgacg agcccctcgc acaaaccgga cctgagcgtt ttgttcgttc ggctcgcgtg 60
aggc 64
Claims (8)
1. a kind of expression miRNA AAV auxiliary package carriers, it is characterised in that the carrier is based on Rep2 and CapDJ auxiliary and wrapped
Body is loaded, miR33-5 ' UTR (the SEQ ID NO under CMV promoter driving:And miR33-3 ' UTR (SEQ ID NO 1):2)
Between insertion clone miRNA 2 × BsmBI of site, miRNA expression small fragments connect 2xBsmBI positions into the skeleton carrier
Point, and transcription is terminated with the pA terminators of synthesis.
2. the construction method of the AAV auxiliary package carriers of the expression miRNA described in claim 1, it is characterised in that the expression
The construction method of miRNA carrier, including step：
(1) clone's skeleton of linearisation cohesive end, is prepared；
(2) the miRNA expression small fragments that Dual chain belt glues end, are prepared；
(3) miRNA in (2), is expressed into small fragment to be connected in (1) on clone's skeleton.
3. construction method according to claim 2, it is characterised in that the construction method of the carrier of the expression miRNA, tool
Body step includes：
(1), by the use of contain CMV-miR33-5 ' UTR-2xBsmBI-3 ' UTR expression cassettes Rep/CapDJ aid in package carrier as
MiRNA expression cloning skeleton carriers, BsmBI digestions obtain linearizing the cloning vector skeleton of cohesive end；
(2), the positive negative strand primer of the miRNA needed for synthesis, is made into 20uM concentration, by volume normal chain respectively：Anti-chain：
10xT4DNA：The nuclease free that sterilizes H2O=1:1:1:7 proportioning takes positive strand primer, negative strand primer to add 10xT4DNA connections instead
Buffer solution is answered, and in sterilizing nuclease free H2Mixed in O, after 95 DEG C are denatured 5 minutes, are cooled with 5 DEG C per minute of speed and annealed
To normal temperature, the miRNA expression small fragments that Dual chain belt glues end are obtained；
(3) the miRNA expression small fragments of gained in step (2), are connected into the skeleton carrier into the linearisation of gained in step (1)
2 × BsmBI sites：After 20 times of miRNA expression small fragments dilution for Dual chain belt caused by annealing being glued end, 1ul is taken, then add
MiRNA expression clonings skeleton carrier, 1ul 10xT4DNA connections enzyme reaction buffer solution, 0.5ul T4DNA in 25ng steps (1)
Ligase, 10ul cumulative volumes are added to water, 16 DEG C connect 16 hours；Afterwards plus 1.5ul NEBuffer4 (10X) reactions buffer
Liquid, 1.5ul 10mmol/lATP, 0.5ul Exonuclease V (5units), 37 DEG C are reacted 0.5 hour, produce expression
MiRNA AAV auxiliary package carriers.
4. construction method according to claim 3, it is characterised in that the construction method uses 96 orifice plate high-flux parallels
Operation.
5. described in the AAV auxiliary package carriers or claim 2-4 any one of the expression miRNA described in a kind of claim 1
The screening technique of the expression miRNA of method structure AAV auxiliary package carriers, step include：
(1) prepare the carrier described in claim 1, or connection table is built suddenly by claim 2-4 any one methods describeds
AAV up to miRNA aids in package carrier；
(2) convert：The carrier described in (1) converts Stbl3 competence bacteriums, culture, takes culture bacterium solution to make endotoxin-free a small amount of
Plasmid extraction；
(3) transfect：By the plasmid and Ad helper plasmids pAd-deltaF6, the carrier pITR- with ITR mesh of the extraction of (2) Small Amount
CAG..Gluc cotransfection 293T cells, if being not inserted into miRNA empty carrier as control sample, culture；
(4) titre compares screening：Whole plate cell carries out freeze thawing, centrifugation, takes supernatant to make the infection that suspends；Then Gluc enzymatic activitys are detected
Intensity, quantify multiple compared with the control；It is determined that the clone of AAV yield can be improved, preserve；Make flat board with the clone's strain preserved afterwards
Line culture, choose clone bacterium sequencing and determine miRNA sequence.
6. screening technique according to claim 5, it is characterised in that the specific steps of the screening technique include：
(1) prepare the carrier described in claim 1, or connection table is built suddenly by claim 2-4 any one methods describeds
AAV up to miRNA aids in package carrier；
(2) convert：2~10ul of carrier described in (1) converts Stbl3 competence bacteriums, and 42 DEG C of heat shocks put ice after 45~60 seconds
Upper 2 minute, then add 1.5ml TB culture mediums in 32 degree of shaking table cultures 20 hours；Culture bacterium solution 1.2ml is taken to make endotoxin-free a small amount of
Plasmid extraction；
(3) transfect：By the plasmid and Ad helper plasmids pAd-deltaF6, the carrier pITR- with ITR mesh of the extraction of (2) Small Amount
CAG..Gluc cotransfection 293T cells, if being not inserted into miRNA empty skeleton carrier as control sample, 37 degrees Celsius of 5%CO2
Cultivated 48~72 hours in incubator；
(4) titre compares screening：Whole plate cell carries out Frozen-thawed cycled 3~4 times；Whole plate cell 4000g is centrifuged 15 minutes, takes supernatant
Make the infection that suspends：Divide 2E+5~1E+6 293T cell per well into 24 orifice plates, add 5~100ul of supernatant, and add sodium butyrate extremely
2~50 μm of ol/l of final concentration；Complete medium is changed to after 16 hours, 200ul/ holes, takes supernatant to detect Gluc enzyme activity after 24 hours
Property intensity, quantifies multiple compared with the control；It is determined that the clone of AAV yield can be improved, preserve；Make flat board with the strain preserved afterwards to draw
Line culture, choose clone bacterium sequencing and determine miRNA sequence.
7. screening technique according to claim 6, it is characterised in that the conversion operation of the step (2) is in 96 orifice plates
Complete.
8. a kind of method using the AAV auxiliary package carrier productions AAV for expressing miRNA, specific steps include：
(1) about 1 × 10, is spread5Individual 293T cells are into 24 orifice plates, with 37 DEG C of complete medium, 5%CO2Under the conditions of culture it is 16 small
When；
(2), take expression miRNA carrier and Ad assistant carriers pAd-deltaF6 and pITR-CAG..Gluc carrier each 0.2~
2ug, add in 0.05~0.2ml DMEM, add PEI 15ul (1ug/ul), mix at once, after being placed 10 minutes under normal temperature
Add in cell culture medium；
(3) cell and supernatant are collected after, cultivating 72 hours, under the conditions of 37 DEG C and in dry ice multigelation three times, 10000g from
The heart after 10 minutes supernatant be AAV crude extracts；
(4) AAV is made in gained AAV coarse body fluids in (3).
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710553167.4A CN107384957B (en) | 2017-07-07 | 2017-07-07 | A kind of construction method, screening technique and the application of AAV auxiliary package carrier and the carrier that expressing miRNA |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710553167.4A CN107384957B (en) | 2017-07-07 | 2017-07-07 | A kind of construction method, screening technique and the application of AAV auxiliary package carrier and the carrier that expressing miRNA |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107384957A true CN107384957A (en) | 2017-11-24 |
| CN107384957B CN107384957B (en) | 2019-04-19 |
Family
ID=60334321
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710553167.4A Active CN107384957B (en) | 2017-07-07 | 2017-07-07 | A kind of construction method, screening technique and the application of AAV auxiliary package carrier and the carrier that expressing miRNA |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107384957B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110184297A (en) * | 2019-05-27 | 2019-08-30 | 广州派真生物技术有限公司 | A kind of AAV auxiliary package carrier, building screening technique and application for expressing shRNA |
| CN111557927A (en) * | 2020-04-26 | 2020-08-21 | 天津大学 | Synthesis method of nanoparticles for treating immune hemolytic anemia |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101532024A (en) * | 2009-04-30 | 2009-09-16 | 许瑞安 | New type cell special gene HAAVmir containing microRNA combined sequence for gene treating |
| CN103290052A (en) * | 2012-02-24 | 2013-09-11 | 江苏诺百生物科技有限公司 | Improved adenovirus vector system, preparation and application of its virus particle |
-
2017
- 2017-07-07 CN CN201710553167.4A patent/CN107384957B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101532024A (en) * | 2009-04-30 | 2009-09-16 | 许瑞安 | New type cell special gene HAAVmir containing microRNA combined sequence for gene treating |
| CN103290052A (en) * | 2012-02-24 | 2013-09-11 | 江苏诺百生物科技有限公司 | Improved adenovirus vector system, preparation and application of its virus particle |
Non-Patent Citations (1)
| Title |
|---|
| 连忠辉等: "一种包装AAV2/5的重组单纯疱疹病毒的构建", 《病毒学报》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110184297A (en) * | 2019-05-27 | 2019-08-30 | 广州派真生物技术有限公司 | A kind of AAV auxiliary package carrier, building screening technique and application for expressing shRNA |
| CN111557927A (en) * | 2020-04-26 | 2020-08-21 | 天津大学 | Synthesis method of nanoparticles for treating immune hemolytic anemia |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107384957B (en) | 2019-04-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20210277419A1 (en) | Genome Editing without Nucleases | |
| CN104694573A (en) | Method for inhibiting HIV-1 infectious agent from infecting primary lymphocyte by utilizing CRISPR/Cas9 | |
| CN108330147A (en) | A kind of foundation of recombined glandulae correlation viral vectors production technology | |
| CN107384957B (en) | A kind of construction method, screening technique and the application of AAV auxiliary package carrier and the carrier that expressing miRNA | |
| US20220243243A1 (en) | Expression of products from nucleic acid concatemers | |
| JP7440045B2 (en) | Nucleic acid-encapsulated AAV hollow particles | |
| CN112680443A (en) | Promoter pCalm1 and application thereof | |
| CN113195001A (en) | Recombinant parvovirus vector and preparation method and application thereof | |
| CN105200059A (en) | SiRNA for targeted inhibition of mouse UCP2 gene expression and construction of expression vector thereof | |
| CN107201371B (en) | Recombinant rabies virus carrying de-optimized M gene and two G genes | |
| CN110184297A (en) | A kind of AAV auxiliary package carrier, building screening technique and application for expressing shRNA | |
| US20220380750A1 (en) | Method for the production of raav and method for the in vitro generation of genetically engineered, linear, single-stranded nucleic acid fragments containing itr sequences flanking a gene of interest | |
| CN109321583B (en) | Method for constructing reversed genetic system of muscovy duck reovirus | |
| CN106957820B (en) | Culture medium for in vitro chondrocyte telomere prolonged proliferation culture, kit and application | |
| CN105420275A (en) | Method for preparing exogenous functional gene targeted integration human neural stem cells | |
| CN111378621B (en) | B lymphoma cell strain stably transfected by EB virus latent membrane protein 1, construction method and application thereof | |
| Di Gioia et al. | Vaccinia virus genome editing using CRISPR | |
| CN114990162A (en) | Method for reducing plasmid residue in production of AAV (adeno-associated virus) viral vector | |
| CN116042544A (en) | Serotype 13 recombinant adeno-associated virus and preparation method and application thereof | |
| Ildefonso et al. | Adeno-associated virus delivery of viral serpins for ocular diseases: Design and validation | |
| CN118028370A (en) | PTYAAV series of vectors for adeno-associated virus packaging | |
| CN116875597A (en) | Vector for correcting LMNA cardiomyopathy pathogenic mutation and application thereof | |
| CN109628490A (en) | A kind of shRNA recombinant adeno-associated virus preventing canine distemper | |
| CN117757752A (en) | Marc-145 cell line for stably expressing PRRSV secondary structural protein and preparation method and application thereof | |
| CN116218906A (en) | RNA editor expression plasmid, exosome aptamer fusion expression plasmid and targeted gene RNA editing method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |