CN101532024A - New type cell special gene HAAVmir containing microRNA combined sequence for gene treating - Google Patents
New type cell special gene HAAVmir containing microRNA combined sequence for gene treating Download PDFInfo
- Publication number
- CN101532024A CN101532024A CN200910136134A CN200910136134A CN101532024A CN 101532024 A CN101532024 A CN 101532024A CN 200910136134 A CN200910136134 A CN 200910136134A CN 200910136134 A CN200910136134 A CN 200910136134A CN 101532024 A CN101532024 A CN 101532024A
- Authority
- CN
- China
- Prior art keywords
- gene
- cell
- protein
- vector
- helper plasmid
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Abstract
The invention relates to the molecular medicine and gene treating field, in particularly, a gene segment which is new, cell target special, and can eliminate replication ability and synthesizing ability of nucleocapsid protein from source and clean the pollution protein. The gene segment is composed of a recombinant aden-associated virus vector helper plasmid non-structure and/or structure gene, and at least one copy cell special microRNA target sequence which can be used in multiple cell strains directly, and also can be used for constructing recombinant aden-associated virus plasmid and vector to prepare medicine, basic medicine and clinic gene treating.
Description
Technical field:
The present invention relates to field of gene, in particular to a kind of novel, cell-targeting specificity, thoroughly eliminate viral capsid proteins from the source and duplicate with synthesis capability and remove the gene fragment of its contaminating protein and use on basis and clinical medicine.
Background technology:
The carrier that gene therapy clinical trial is at present used is still in the majority with virus vector, accounts for more than 75%.Wherein, adenovirus (adenovirus) and retrovirus (retrovirus) carrier have accounted for major part and [have been permitted Ruian etc., " molecular gene pharmacology ", Bei Jingdaxuechubanshe ﹠amp; Medical science press of Peking University, 2008, Beijing].Virus is not have a parasitic form of cyto-architectural minimum, the simplest life under the survival in very long natural evolutionary process.In natural evolutionary process in several thousand, it can find valid approach to enter human body.Virus vector then utilized the viral natural or shell transformed and (or) outer membrane structure loads goal gene.Because virus itself is a kind of pathogenic agent, so human body is constituted certain potential safety hazard.At present, though gene therapy research has obtained gratifying progress, it is to be overcome to still have many obstacles to have, and a wherein topmost obstacle is the immune response of host to gene therapy vector and/or transgene product generation.Genomic medicine both may cause the inherency immune response, may cause the adaptive immunity reaction again.Immune response usually causes gene expression efficiency to descend, and treatment can not be lasting, and curative effect is poorer when especially reusing same vehicle, even produces serious toxic side effect.Therefore, in order to realize the long-term efficacy of gene therapy, must manage to reduce immune response, inducing immune tolerance.
Adeno-associated virus or claim adeno associated virus (AAV) to belong to Parvoviridae is single stranded DNA, about 4.7kb, can infect division stage and non-division stage cell, and can be integrated in host cell chromosome, can expression steady in a long-term.Duplicating of AAV depends on helper virus, as adenovirus or simplexvirus etc.Though the AAV carrier does not contain virus coat protein gene, virus capsid protein can pass through major histocompatibility complex (MHC) II classpath and give CD4 with antigen presentation
+The T cell.When it contacts with body once more, can activate the B cell, produce specificity neutralizing antibody, obviously suppress the carrier mediated gene transmission of AAV at AAV.As in the experiment of immunity suitable energy mouse and rhesus monkey, finding that the coat protein of intramuscular injection AAV2 carrier can activate Th2 cell and B cell, produce specific IgM of AAV2 and IgG.The AAV carrier is except the dependent B cell response of energy inducing T cell, but the also B cell response of inducing T cell dependent/non-dependent.Discover, by spleen the AAV carrier is input to the B cell response that the mouse portal system can be brought out part T cell dependent/non-dependent, its time length is shorter than the dependent B cell response of T cell.Also relevant by the humoral immune reaction that the AAV virus capsid protein causes with its using dosage, reduce the generation that carrier dosage can significantly reduce humoral immune reaction.
Nearest hemophilia gene therapy clinical trial shows that after passing through the hepatic artery administration, the AAV2 shell has started CD8
+The immune response that T is cell-mediated, the liver cell generation cytotoxicity to the carrier of having transduceed only continued for 8 weeks thereby effective factor IX (FIX) is expressed, and caused the treatment failure.The researchist thinks, the patient once infected AAV2, and have memory CD8+T cell at virus at body, after the receptor gene treatment, the AAV2 shell has activated these memory CD8+T cell, the liver cell that causes containing the AAV2 carrier is removed [Halbert Clet al J Virol, 1998.72 (12): p.9795-80] by immunity system.
In target tissue, duplicate the dangerous immune response long-term existence that the synthetic packaging protein residual contamination of AAV particle (rcAAV) institute causes, especially in FIX expressed the hemophilia clinical treatment, the dangerous immune response that AAV particle (rcAAV) synthetic packaging protein causes was widely paid close attention to always.To contain the proteic rcAAV particulate influence of potentially contaminated in order systematically reducing, thoroughly to eliminate viral capsid proteins from the source and duplicate research with synthesis capability, up to now, Shang Weijian has relevant report both domestic and external.
The objective of the invention is design construction a kind of novel, cell-specific, include a plurality of organizing specifics such as the gene fragment of the microRNA binding sequence of liver special (has-mir-122) and hematopoiesis special (has-mir-142-3p) sequence copy; nationality is with control packing protein gene fragment expression; and then remove the adeno-associated virus packaging protein and pollute the carrier mediated immune response of bringing out of AAV, can achieve success clinical to guarantee gene therapy.
Summary of the invention:
The invention provides the gene fragment that a kind of virus replication gene, packaging protein gene and cell-specific target microRNA sequence are formed.Its virus replication gene can be the AAV1 type, AAV2 type, AAV4 type, AAV5, AAV8 type, AAV9 and other types AAV and other viral replicator or nonstructural gene; Its virus packing protein gene can be an AAV virus packing protein gene, adenovirus packaging protein gene, slow virus packaging protein gene or other virus packing protein gene; Its cell-specific target microRNA sequence can be selected from liver cell targeted, pneumonocyte target, hematopoietic cell target, or other cell targeted microRNA.
Gene fragment provided by the invention can directly import liver cell line, the stem cell strain, and the pneumonocyte strain, muscle cell strain or other cell strains also can be used for making up recombinant adeno-associated virus plasmid and carrier, are used for fundamental research and clinical gene therapy.
The invention provides a kind of adeno-associated virus plasmid and carrier, spread to thus to slow virus, adenovirus and other viral vector.
(sequence is: TGGAGTGTGACAATGGTGTTTG) (sequence is: the gene fragment of Zu Chenging TGTAGTGT TTCCTACTTTATGGA) with 4 copy hematopoietic cell specific target tropisms' has-mir-142-3pmicroRNA to the invention provides the hsa-mir-122microRNA of a kind of adeno-associated virus packaging protein gene and 4 copy liver targets, it can directly apply to the various kinds of cell strain, also can be used for the structure of gene therapy recombinant adeno-associated virus plasmid and carrier.
The present invention also provides a kind of AAV2 helper plasmid (HAAVmir) novel, that include the microRNA binding sequence of a plurality of liver cells special (hsa-mir-122) and hematopoietic cell special (has-mir-142-3p) sequence copy, it has the feature of microRNA target AAV2 type helper plasmid HAAVmir, and its sequence is:
Has-mir-122 sequence: TGGAGTGTGACAATGGTGTTTG
Has-mir-142-3p sequence: TGTAGTGTTTCCTACTTTATGGA
Novel AAV2 helper plasmid HAAVmir duplicates the profile of expressing with packaging gene in 293 cells, exactly likes with original helper plasmid pH22.Output by two kinds of HAAVmir and pH22 helper plasmid packing is also roughly the same.Plasmid by the preparation of novel helper plasmid is equally matched with the effect that traditional method prepares.In human hepatocyte's strain, the expression of its packaging protein significantly reduces; 99.9% packaging protein is suppressed in liver, adopts the Westernblot method to fail to detect the expression of packaging protein.
Novel cell specificity provided by the invention includes recombinant adeno-associated virus plasmid and the carrier that the gene HAAVmir of microRNA binding sequence makes up, and it comprises from the AAV carrier and inserts class treatment with acceptable assistant agent on goal gene and the pharmacology.
Novel cell specificity provided by the invention includes outward appearance, throughput and the transfection effect that virus vector that the gene HAAVmir of microRNA binding sequence makes up does not influence virus vector.
The gene HAAVmir that novel cell specificity provided by the invention includes the microRNA binding sequence does not influence goal gene effective expression in vivo.
Novel cell specificity provided by the invention includes the gene HAAVmir of microRNA binding sequence can be in liver thoroughly to be eliminated adeno-associated virus packing capsid protein and duplicates with synthesis capability and remove its contaminating protein from the source, thereby guarantees to utilize the validity of FIX to clinical hemophilia gene therapy.
The present invention can implement not only that the inside and outside target cell removes thoroughly from the source that the adeno-associated virus capsid protein duplicates and synthesis capability and pollute capsid protein, and helps the effective regulation and control of AAV carrier to virus packing protein gene expression.Also be suitable for simultaneously adenovirus, slow virus, conversely transcribe virus, foamy virus, hsv, Xin Peisi virus, variola virus and mosaic type or the compound virus and the preparation and the application of other virus vector.
The invention effect:
A kind of gene fragment novel, that form by the microRNA sequence of virus packing protein gene and cell-specific target provided by the invention; in target cell, can thoroughly eliminate the synthetic replication of capsid protein from the source; thereby the immune response of being brought out after minimizing and even the release gene therapy is to guarantee the validity of gene therapy in preclinical medicine and clinical medicine.
Novel gene fragment composition of the present invention is clear, and determined curative effect is particularly suitable for prevention and the treatment of virus type pharmaceutical carrier in clinical disease; Be particularly suitable for containing the application of adenovirus class carrier in the hemophilia clinical treatment of factor IX (FIX) genomic medicine.
Description of drawings:
Fig. 1, traditional AAV2 helper plasmid (pH22) and novel AAV2 helper plasmid HAAVmir.
Wherein: A-pH22; B-HAAVmir;
A-4 copy mir122 sequence; B-4 copy mir-142-3p sequence.
Fig. 2., HAAVmir is to packing AAV2 virus vector effect detection
Wherein: A.-Western detects HAAV2mir-CMV-LacZ carrier package albumen distribution plan
(a-HAAVmir helper plasmid) and AAV2-CMV-LacZ (b-pH22 helper plasmid);
B-PCR detects the virus vector titre in real time;
-AAV2-CMV-LacZ carrier; Zero-HAAV2mir-CMV-LacZ carrier;
X-represent density.
Fig. 3., the detection of HAAVmir helper plasmid transfection efficiency
Wherein: MIO1,000 or 10,000 represent virus titer
A-AAV2-CMV-LacZ and HAAV2mir-CMV-LacZ carrier transfection Hela cell are after 48 hours, and cell dyeing is analyzed the transfection situation of LacZ;
B-.AAV2-CMV-LacZ and HAAV2mir-CMV-LacZ carrier transfection Hela cell showed LacZ cell dyeing analysis of accounts transfection situation under the mirror after 72 hours;
C.-the LacZ expression of AAV2-CMV-LacZ and HAAV2mir-CMV-LacZ carrier transfection C57BL/J6 mouse tissue.
Fig. 4., HAAVmir helper plasmid adenovirus carrier expresses the detection of factor IX FIX level
Wherein: ◇-AAV2-ApoE-hAAT-hFIX;-AAV2-ApoE-hAAT-hFIX (mir);
X-time (week).
Fig. 5., the detection expressed of HAAVmir helper plasmid adenovirus carrier packaging protein
Wherein: A-.Western hybridization; B.-Western hybridizes quantitative analysis (gray scale scanning)
A-mouse-anti-AAV packaging protein monoclonal antibody is that the Western of probe detects;
B-mouse-anti-EGFP monoclonal antibody is that the Western of probe detects;
1-5-proteic expression in HEK293 (1-pCMV-AAV2 contrast; 2.-the pCMV-HAAV2mir carrier; 3.-the pCMV-HAAV2mir122 carrier; 4.-pCMV-HAAV2142mir; 5-.mock contrast);
6-10-proteic expression in the HHL5 liver cell (6.-the pCMV-AAV2 contrast; 7.-the pCMV-HAAV2mir carrier; 8.-the pCMV-HAAV2mir122 carrier; 9.-pCMV-HAAV2142mir; 10.mock contrast); 11. positive control.
Fig. 6 .HAAVmir helper plasmid adenovirus carrier is the detection of packaging protein expression in animal body
Wherein: a-mouse-anti-AAV packaging protein monoclonal antibody is that the Western of probe detects;
B-mouse-anti-EGFP monoclonal antibody is that the Westem of probe detects;
1-3.-pCMV-HAAV2mir carrier; 4-6.-pCMV-AAV2 contrast;
7-9.-pCMV-HAAV2mir122 carrier; 10-12.-pCMV-HAAV2142mir;
13.-mock contrast; 14.-positive control.
Embodiment:
Below listed embodiment only for helping those skilled in the art to understand the present invention better, but do not limit the present invention in any way.
＜embodiment 1 〉The structure of microRNA target HAAVmir gene
The miRNA that the sequences Design of microRNAmir-122 target box and mir-142-3p target box and corresponding liver are special and hematopoietic cell is special is perfect complementary..
The AAV type has microRNA target helper plasmid hsa-mir-122 and has-mir-142-3p sequence
Its sequence is: Has-mir-122 sequence: TGGAGTGTGACAATGGTGTTTG;
Has-mir-142-3p sequence: TGTAGTGTTTCCTACTTTATGGA;
Mir-122 target box is by oligonucleotide 5 '-CCA TTG TCA CAC TCC AGT CAC AAA CAC CAT TGT CAC ACTCCA GCT AGC CAA ACA CCA TTG-3 ', and 5 '-GCA TGC TGG AGT GTG ACA ATG GTG TTT GAGCTT GGA GTG TGA CAATGG TGT TTG GCT AGC-3 ' anneals;
Mir-142-3p target box is by oligonucleotide 5 '-GCA TGC TCC ATA AAG TAG GAA ACA CTA CAC GAT TCCATA AAG TAG GAA ACA CTA CAA CCG-3 ', and 5 '-CCT ACT TTA TGG AGT GAT GTA GTG TTT CCTACT TTA TGGAAC CGG TTG TAG TGT TTC CTA-3 ' anneals.
And annealing reaction is according to the specification sheets of manufacturers, in the PCR thermo cycler, carry out (Eppendorf, Westbury, NY), the circulating temperature of use be 94 ℃ 5 minutes, 94 ℃ 30 seconds, 60 ℃ 30 seconds, 68 ℃ of 4 circulations in 30 seconds; Last 68 ℃ 5 minutes at one 50 μ L reactive system puReTaq Ready-To-Go PCR Beads (Amersham-Pharmacia Biotech, Piscatawah carry out in NJ).Mir-122 target box and mir-142-3p target box respectively contain 4 copies.
Then, miRNA target sequence via the PCR overlapping clone to the pH22[AAV2 helper plasmid, contain AAV2 duplicate field (nonstructural gene) and AAV2 bagging area (structure gene) plasmid)] [Diao Yong etc., the biotechnology journal, 2008,24 (11): 1949-1954] Bae I and Spe I site form AAVmir helper plasmid (Fig. 1).HAAVmir122 or HAAVmir142 plasmid design single restriction endonuclease Sph I/Age I site or the annealing generation of Nde I/Sph I site at oligonucleotide sequence respectively.
＜embodiment 2 〉Contain the preparation of microRNA binding sequence recombinant adenoviral vector
PAAV2-CMV-LacZ and AAV2-ApoE-hAAT-hFIX carrier [are permitted Ruian, Chen Ling, Xiao Wei owner and are compiled " molecular gene pharmacology " BJ University Press by the preparation of three plasmid co-transfection methods of former report; Medical science press of Peking University 2008, Beijing].Recombinant adeno-associated virus HAAVmir, the HAAVmirl22 or the HAAVmir142 plasmid that contain the microRNA binding sequence, adenoviral replication function helper plasmid, with pAAV-CMV-LacZ vector plasmid or goal gene carrier such as pAAV-ApoE-hAAT-hFIX vector plasmid cotransfection to HEK293 cell (ATCC, Manassas, VA), HEK 293 strains are incubated at 10% bovine serum (FBS, HyClone, Logan, DMEM nutrient solution UT) (Invitrogen, Carlsbad, CA); Nutrient solution contain penicillin (100U/ml) (Invitrogen, Carlsbad, CA) and Streptomycin sulphate (100 μ g/ml) (Invitrogen, Carlsbad, CA) at 37 ℃, the 5%CO2 incubator.Cell cultures is 850cm in surface-area
2In the rolling bottle, when cell density reaches 70%, above-mentioned three plasmids are used calcium phosphate precipitation method rotaring redyeing 293 cell with the ratio of 1:1:1, after 16 hours nutrient solution is replaced by fresh serum-free DMEM nutrient solution.Transfection is collecting cell after 72 hours, with centrifugal collection supernatant behind the ultrasonic degradation cell, with the calcium chloride protein precipitation, collects supernatant behind the recentrifuge, with dnase digestion genome and plasmid DNA, uses the PEG8000 precipitation then, and 4 ℃ are spent the night, centrifugal back collecting precipitation.The recombinant adenoviral vector that is obtained is via twice cesium chloride ultracentrifugation.After carrier after the collection was fully dialysed via the PBS solution of 5% D-sorbitol, the purity of carrier and gene titre were dyed (Applied Biosystems, Forster city, CA) detection with real time PCR by silver.
＜
Embodiment 3MicroRNA target HAAVmir type helper plasmid is to the packing effect measuring of adenovirus carrier
In order to verify that microRNA helper plasmid HAAVmir still can support the AAV2 carrier in 293 cell internal packings, the present invention adopts the HEK293 strain to be incubated at 10% bovine serum (FBS, HyClone, Logan, DMEM nutrient solution UT) (Invitrogen, Carlsbad, CA); Nutrient solution contain penicillin (100U/ml) (Invitrogen, Carlsbad, CA) and Streptomycin sulphate (100 μ g/ml) (Invitrogen, Carlsbad, CA) at 37 ℃, 5% CO2 incubator.The calcium phosphate precipitation method is adopted in transfection.Helper plasmid HAAVmir is packed the AAV2 carrier, and with pAAV2-CMV-lacZ as reporter gene.Cells transfected was gathered in the crops after 3 days, and adenovirus carrier is via twice cesium chloride ultracentrifugation, and the purity of carrier and gene titre are dyed (Applied Biosystems, Forster city, CA) detection with real time PCR by silver.Detect with Western blot method, the result shows that novel pH22mir duplicates to packaging gene the AAV2 carrier and expresses similar to original helper plasmid pH22 (Fig. 2 A).The gradient centrifugation method shows makes the output of AAV2 carrier package also roughly the same (Fig. 2 B) by two kinds of pH22mir and pH22 helper plasmid.
＜
Embodiment 4MicroRNA target HAAVmir type helper plasmid detects adenovirus carrier transfectional cell efficient
For the AAV2 that verifies the microRNA helper plasmid HAAVmir packaging that contains the cell-specific target site at intracellular transfection effect and biological function, the present invention adopts helper plasmid HAAVmir to pack the AAV2 carrier, and with pAAV2-CMV-lacZ as reporter gene.The HeLa cell grows to covering after 80%, 24 hour at 6-hole culture dish bed board until cell, with AAV2-CMV-LacZ or HAAV2mir-CMV-LacZ carrier with virus titer MOI=1,000 and 10,000 dosage are added into culture dish, and histological stain carried out after after the transfection 48 hours.The HeLa cell is fixed 5 minutes with 2% Formalin/0.2% glutaraldehyde/PBS under 4 ℃.PBS solution is given a baby a bath on the third day after its birth time, in the 5mM Tripotassium iron hexacyanide/5mM yellow prussiate of potash/2mMMgCl2/1mg/mlX-Gal/PBS solution, and 37 ℃ of dyeing of spending the night.Histological stain the results are shown in Figure 3A.Transfection efficiency is so that (the LacZ cell count in 5 visuals field of getting at random under NY) is calculated for Nikon, Melville, and it the results are shown in Fig. 3 B at the DIAPHOT200 of 20X microscope.The result shows that AAV2-CMV-lacZ (mir) and AAV2-CMV-lacZ obtain similar transfection effect.Thereby microRNA does not influence the adenovirus carrier transfection efficiency of isolated cells in helper plasmid.
＜embodiment 5 〉MicroRNA target HAAVmir type helper plasmid is to adenovirus carrier transfection in vivo
In order to verify the intravital transfection effect of the AAV2 biological function of the microRNA helper plasmid HAAVmir packaging that contains the cell-specific target site, the present invention has investigated their muscle transfection efficiency in the mouse body.Animal model adopts the Jackson laboratory, and (Bar Harbor, adult C57BL/J6 mouse (25g) ME) do not have infection, normally carry out under the experimental mouse keeping condition in children's hospital of university.AAV2-CMV-LacZ or HAAV2mir-CMV-LacZ virus vector are with 5 * 10
11Vg/ position dosed administration injects the preceding muscle of left tibia of 4 all C57BL/J6 mouse.Muscle is in the back sampling of administration 4 week, and with the OCT embedding medium (Sakura Finetek, Torrance, CA) embedding, 20 μ m section back X-gal dyes.Expression after the lacZ dyeing shows AAV-CMV-lacZ (mir) carrier lacZ expression intensity and original vector expression (Fig. 3 C) about the same.
＜embodiment 6 〉The biological function of microRNA target HAAVmir type helper plasmid in gene therapy
For biological function in the AAV2 body of verifying the microRNA helper plasmid HAAVmir packaging that contains the cell-specific target site, the present invention adopts people's factor IX (hFIX) gene, with AAV2-ApoE-hAAT-hFIX and HAAV2-ApoE-hAAT-hFIX (mir) carrier to the hemophilia B mouse tail with 1 * 10
12V.g./intravenous injection, with the level of ELISA human body FIX in blood plasma, per two weeks collect a C57BL/J6 mouse Citrated serum sample and analyze, assay plate is with mouse-anti people FIX monoclonal antibody (Sigma, Saint Luis, MO) bag quilt, contain the PBS sealing of 5% dried milk, and clean with 0.05%Tween-20/PBS, hatch with the mice plasma sample after the dilution, with affinity purification HRP-conjugated goat-anti-hFIX antibody (Enzyme researchlaboratories, South Bend, IN) measure after the 1:2000 dilution proportion, after the last washing together, with freshly prepared O-phenylenediamine (Sigma, Saint Luis, MO) solution is added into each test hole, with OD
450nmPH-value determination pH hFIX content.Typical curve is with people's factor IX (Wyeth, Philadelphia, PA) formulation of corresponding purifying.The result shows (Fig. 4), presents typical A AV with the expression of the carrier factor IX of AAVmir preparation and expresses profile, slowly rises in 4-6 week, and reaching the peak at last is 1000ng/ml.Thereby can reach a conclusion, the carrier with having the preparation of AAVmir helper plasmid has characteristic and the potentiality identical with traditional carrier.
＜embodiment 7 〉The detection that microRNA target HAAVmir type helper plasmid is expressed at intracellular protein
In order to detect AAVmir type helper plasmid in the proteic expression of cell internal packing, the present invention selects pCMV-CAP plasmid vector [the Karen A.Vincent et al J of Virology of a high expression level for use, 1997, p.1897-1905], contain 4 copy mir122 and mir142 at pCMV-HAAV2mir carrier 3 ' end, the pCMV-CAPmir122 carrier contains 4 copy mir122, and carrier pCMV-CAPmir142 contains 4 copy mir142..With pCMV-AAV2 (contrast), pCMV-HAAV2mir, pCMV-HAAV2mir122 and pCMV-HAAV2mir142 respectively transfection to HEK293 cell and HHL5 liver cell line (available from ATCC, Manassas, VA).After the transfection 72 hours, collecting cell adopts packaging protein and the green fluorescent protein of AAV in the Westernblot method pair cell lysate to analyze.With the cell cracking of radioimmunity preliminary precipitation solution (50mmol/L Tris-HCl pH7.4,150mmol/LNaCl, 1mmol/L, 1mmol/LEDTA, 1%Triton X-100,1%SDS), the supersound process genomic dna,, add 4X sample solution and reductive agent (Invitrogen, Carlsbad then, CA) heating is 5 minutes, (Pierce, Rockford IL) measure by manufacturer specification protein concn with the bright orchid of Kao Masi (Bradford) albumen testing cassete.50 microgram protein samples via the 4-12% gradient electrophoresis (Invitrogen, Carlsbad, CA), (Invitrogen, Carlsbad CA) carry out Westernblot and analyze to change film then, film phosphate buffered saline buffer (the Invitrogen that contains 5% dried milk/0.05% Tween 20, Carlsbad CA) handles after 1 hour mouse anti-AAV packaging protein antibody (American research product, Belmont, MA) with the 1:50 dilution, after the interpolation, overnight incubation.Film after phosphate buffered saline buffer is washed with sheep anti-mouse antibody (1:1000 dilution, Sigma, St.Louis, MO), and with chemical luminous substrate (Amersham-Pharmacia Biotech, Piscatawah NJ) detects.Adopt mouse anti EGFP antibody (Invitrogen, Carlsbad, CA) Westernblot analyzes the proteic expression of EGFP, the results are shown in Figure 5A and Fig. 5 B, show at 293 cell strain pCMV-HAAV2mir, pCMV-HAAV2mir122 and pCMV-HAAV2mir142 carrier and pCMV-AAV2 contrast, packaging protein expression amount basically identical, and in the HHL5 liver cell, pCMV-HAAV2mir, the proteic expression of pCMV-HAAV2mir122 carrier package significantly reduces, the recombinant adenoviral expressing vector that utilizes HAAV2mir of the present invention to make up is described, can in liver cell and hematopoietic cell, suppress the expression of packaging protein in target ground, thereby reduce the cytotoxicity of potential t cell activation.
＜embodiment 8The hydrokinetics detection of protein expression in animal body of microRNA target HAAVmir type helper plasmid
In order to detect the expression of packaging protein in animal body of HAAVmir type helper plasmid, the present invention adopts the hydrodynamic force science study method, in 5 to 10 seconds, inject the 0.125mL/g body weight respectively and contain 100 microgram pCMV-HAAV2mir to the animal afterbody,, pCMV-HAAV2mir122,, pCMV-HAAV2mir142 or 30 microgram pCMV-AAV2 plasmids physiological saline, mouse was put to death the liver sampling with carbonic acid gas in 24 hours behind injection dynamic metabolism dosage.Liver organization is stored in-80 ℃ of refrigerators with liquid nitrogen after freezing, carries out Westernblot and analyzes, and detection method is shown in embodiment 7.The result shows, accepts almost not have in the mouse liver of pCMV-HAAV2mir, pCMV-HAAV2mir122 carrier the expression of packaging protein, estimates that packaging protein is expressed to reduce about 10,000 times (Fig. 6 A, Fig. 6 B).Illustrate that the constructed microRNA target series in liver cell of the present invention is enough to suppress in position the expression of packaging protein.
Claims (10)
1, a kind of novel gene fragment HAAVmir, it is characterized in that said gene fragment is made up of recombinant adenoviral vector helper plasmid nonstructural gene duplicate field, structure gene packaging protein gene and cell-targeting specificity microRNA sequence, it can be used as helper plasmid and prepares recombinant viral vector, and thoroughly eliminates the virus vector capsid protein from the source and duplicate with synthetic and remove its contaminating protein in gene therapy is used.
2, the described gene fragment AAVmir of claim 1 is characterized in that recombinant viral vector helper plasmid nonstructural gene duplicate field, is selected from the AAV1 type, AAV2 type, AAV4 type, AAV5 type, AAV8 type, the AAV rep gene of AAV9 or other AAV nonstructural genes.
3, the described gene fragment AAVmir of claim 1 is characterized in that recombinant viral vector helper plasmid viral structural gene packaging protein, is selected from AAV virus packing protein gene, adenovirus protein gene, slow virus protein gene or other viral protein packaging gene.
4, the described gene fragment AAVmir of claim 1, it is characterized in that cell targeted microRNA sequence, be selected from liver cell targeted, the pneumonocyte target, the hematopoietic cell target, or other cell targeted microRNA, as by the hsa-mir-122microRNA of 4 copy liver targets (sequence is: TGGAGTGTGACAATGGTGTTTG) and 4 copy hematopoietic cell specific target tropisms' has-mir-142-3p microRNA (sequence is: TGTAGTGT TTCCTACTTT ATGGA) forms, also be applicable to the microRNA of other organ cell's targets of structure.
5, the recombined glandulae correlation viral vectors of the described gene fragment AAVmir helper plasmid of claim 1, be with gene fragment AAVmir, virus replication function helper plasmid and virus vector with 1:1:1 ratio cotransfection to the HEK293 cell, transfection is collecting cell after 72 hours, and the recombined glandulae correlation viral vectors in the cell pyrolysis liquid obtains via twice cesium chloride ultracentrifugation.
6, the described recombinant adenoviral vector of claim 6, wherein virus vector can be the AAV virus vector, adenovirus carrier, lentiviral vectors, the virus vector of other virus vector and compound or mosaic.
7, claim 6 or 7 described recombined glandulae correlation viral vectors, wherein the AAV virus vector can be AAV1, AAV2, AAV4, AAV5, the AAV virus vector of other types and the AAV virus vector of compound or mosaic type.
8, the described gene fragment AAVmir of claim 1, it can directly apply to cell strain.
9, claim 1 or 9 described gene fragment AAVmir, its cell strain is selected from liver cell line, pneumonocyte strain, muscle cell strain, neuronal cell strain, stem cell strain or other cell strains.
10, the application of the AAV virus vector of the described gene fragment AAVmir recombinant adenoviral vector of claim 1 and compound or mosaic type in preparation molecular medicine and gene therapy.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN200910136134A CN101532024A (en) | 2009-04-30 | 2009-04-30 | New type cell special gene HAAVmir containing microRNA combined sequence for gene treating |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN200910136134A CN101532024A (en) | 2009-04-30 | 2009-04-30 | New type cell special gene HAAVmir containing microRNA combined sequence for gene treating |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN101532024A true CN101532024A (en) | 2009-09-16 |
Family
ID=41102889
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN200910136134A Pending CN101532024A (en) | 2009-04-30 | 2009-04-30 | New type cell special gene HAAVmir containing microRNA combined sequence for gene treating |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101532024A (en) |
Cited By (14)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102002483A (en) * | 2010-07-19 | 2011-04-06 | 中国人民解放军军事医学科学院放射与辐射医学研究所 | Hematopoietic targeted helper adenovirus and application thereof |
| CN102071206A (en) * | 2010-10-22 | 2011-05-25 | 中山大学 | Adeno-associated virus capsid protein gene, corresponding protein and application of protein |
| CN104603272A (en) * | 2012-07-06 | 2015-05-06 | 宝生物工程株式会社 | Cell capable of producing adeno-associated virus vector |
| CN107012171A (en) * | 2011-04-22 | 2017-08-04 | 加利福尼亚大学董事会 | Adeno-associated virus virion and its application method with variant capsids |
| CN107384957A (en) * | 2017-07-07 | 2017-11-24 | 广州派真生物技术有限公司 | The AAV auxiliary package carriers of expression miRNA a kind of and construction method, screening technique and the application of the carrier |
| CN110018302A (en) * | 2019-03-27 | 2019-07-16 | 南京大学 | It is a kind of new to cause pulmonary inflammatory diagnosing and treating reagent by liver diseases |
| CN111557927A (en) * | 2020-04-26 | 2020-08-21 | 天津大学 | Synthesis method of nanoparticles for treating immune hemolytic anemia |
| US10883117B2 (en) | 2015-03-24 | 2021-01-05 | The Regents Of The University Of California | Adeno-associated virus variants and methods of use thereof |
| US11021519B2 (en) | 2015-03-02 | 2021-06-01 | Adverum Biotechnologies, Inc. | Compositions and methods for intravitreal delivery of polynucleotides to retinal cones |
| US11136557B2 (en) | 2013-05-31 | 2021-10-05 | The Regents Of The University Of California | Adeno-associated virus variants and methods of use thereof |
| US11192925B2 (en) | 2016-10-19 | 2021-12-07 | Adverum Biotechnologies, Inc. | Modified AAV capsids and uses thereof |
| US11248214B2 (en) | 2014-03-17 | 2022-02-15 | Adverum Biotechnologies, Inc. | Compositions and methods for enhanced gene expression in cone cells |
| US11554180B2 (en) | 2016-07-29 | 2023-01-17 | The Regents Of The University Of California | Adeno-associated virus virions with variant capsid and methods of use thereof |
| US11680249B2 (en) | 2017-08-28 | 2023-06-20 | The Regents Of The University Of California | Adeno-associated virus capsid variants and methods of use thereof |
-
2009
- 2009-04-30 CN CN200910136134A patent/CN101532024A/en active Pending
Cited By (21)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102002483B (en) * | 2010-07-19 | 2013-04-17 | 中国人民解放军军事医学科学院放射与辐射医学研究所 | Hematopoietic targeted helper adenovirus and application thereof |
| CN102002483A (en) * | 2010-07-19 | 2011-04-06 | 中国人民解放军军事医学科学院放射与辐射医学研究所 | Hematopoietic targeted helper adenovirus and application thereof |
| CN102071206A (en) * | 2010-10-22 | 2011-05-25 | 中山大学 | Adeno-associated virus capsid protein gene, corresponding protein and application of protein |
| CN107012171B (en) * | 2011-04-22 | 2021-07-13 | 加利福尼亚大学董事会 | Adeno-associated virus virions with variant capsids and methods of use thereof |
| CN107012171A (en) * | 2011-04-22 | 2017-08-04 | 加利福尼亚大学董事会 | Adeno-associated virus virion and its application method with variant capsids |
| US11236402B2 (en) | 2011-04-22 | 2022-02-01 | The Regents Of The University Of California | Adeno-associated virus virions with variant capsid |
| CN104603272A (en) * | 2012-07-06 | 2015-05-06 | 宝生物工程株式会社 | Cell capable of producing adeno-associated virus vector |
| US9422576B2 (en) | 2012-07-06 | 2016-08-23 | Takara Bio Inc. | Cell capable of producing adeno-associated virus vector |
| US11634691B2 (en) | 2013-05-31 | 2023-04-25 | The Regents Of The University Of California | Compositions and methods of treatment |
| US11136557B2 (en) | 2013-05-31 | 2021-10-05 | The Regents Of The University Of California | Adeno-associated virus variants and methods of use thereof |
| US11248214B2 (en) | 2014-03-17 | 2022-02-15 | Adverum Biotechnologies, Inc. | Compositions and methods for enhanced gene expression in cone cells |
| US11021519B2 (en) | 2015-03-02 | 2021-06-01 | Adverum Biotechnologies, Inc. | Compositions and methods for intravitreal delivery of polynucleotides to retinal cones |
| US10883117B2 (en) | 2015-03-24 | 2021-01-05 | The Regents Of The University Of California | Adeno-associated virus variants and methods of use thereof |
| US11554180B2 (en) | 2016-07-29 | 2023-01-17 | The Regents Of The University Of California | Adeno-associated virus virions with variant capsid and methods of use thereof |
| US11565001B2 (en) | 2016-07-29 | 2023-01-31 | The Regents Of The University Of California | Adeno-associated virus virions with variant capsid and methods of use thereof |
| US11565000B2 (en) | 2016-07-29 | 2023-01-31 | The Regents Of The University Of California | Adeno-associated virus virions with variant capsid and methods of use thereof |
| US11192925B2 (en) | 2016-10-19 | 2021-12-07 | Adverum Biotechnologies, Inc. | Modified AAV capsids and uses thereof |
| CN107384957A (en) * | 2017-07-07 | 2017-11-24 | 广州派真生物技术有限公司 | The AAV auxiliary package carriers of expression miRNA a kind of and construction method, screening technique and the application of the carrier |
| US11680249B2 (en) | 2017-08-28 | 2023-06-20 | The Regents Of The University Of California | Adeno-associated virus capsid variants and methods of use thereof |
| CN110018302A (en) * | 2019-03-27 | 2019-07-16 | 南京大学 | It is a kind of new to cause pulmonary inflammatory diagnosing and treating reagent by liver diseases |
| CN111557927A (en) * | 2020-04-26 | 2020-08-21 | 天津大学 | Synthesis method of nanoparticles for treating immune hemolytic anemia |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101532024A (en) | New type cell special gene HAAVmir containing microRNA combined sequence for gene treating | |
| Xiang et al. | The effect of CpG sequences on capsid-specific CD8+ T cell responses to AAV vector gene transfer | |
| US20230398236A1 (en) | Optimized mini-dystrophin genes and expression cassettes and their use | |
| Ganaie et al. | Recent advances in replication and infection of human parvovirus B19 | |
| Kamstrup et al. | Immunisation against PCV2 structural protein by DNA vaccination of mice | |
| Mori et al. | Two novel adeno-associated viruses from cynomolgus monkey: pseudotyping characterization of capsid protein | |
| Pavlovic et al. | Clinical and molecular evidence for association of SLE with parvovirus B19. | |
| Sen et al. | Targeted modifications in adeno-associated virus serotype 8 capsid improves its hepatic gene transfer efficiency in vivo | |
| JP7428664B2 (en) | Synthetic liver-tropic adeno-associated virus capsid and its use | |
| Wendtner et al. | Efficient gene transfer of CD40 ligand into primary B-CLL cells using recombinant adeno-associated virus (rAAV) vectors | |
| EA032706B1 (en) | RECOMBINANT ADENO-ASSOCIATED VIRUS DELIVERY OF EXON 2-TARGETED U7snRNA POLYNUCLEOTIDE CONSTRUCTS | |
| CN107002096A (en) | Gene therapy based on AAV | |
| CN104470945A (en) | High-transduction-efficiency raav vectors, compositions, and methods of use | |
| JP7393766B2 (en) | Methods and compositions for antibody evasion viral vectors | |
| Paulk et al. | Bioengineered viral platform for intramuscular passive vaccine delivery to human skeletal muscle | |
| Ertl | Preclinical models to assess the immunogenicity of AAV vectors | |
| Lochrie et al. | Adeno-associated virus (AAV) capsid genes isolated from rat and mouse liver genomic DNA define two new AAV species distantly related to AAV-5 | |
| Maurya et al. | Rational engineering and preclinical evaluation of neddylation and SUMOylation site modified adeno-associated virus vectors in murine models of hemophilia B and leber congenital amaurosis | |
| KR20230034211A (en) | Modified adeno-associated virus 5 capsid and uses thereof | |
| Richmond et al. | The PD-L1/CD86 ratio is increased in dendritic cells co-infected with porcine circovirus type 2 and porcine reproductive and respiratory syndrome virus, and the PD-L1/PD-1 axis is associated with anergy, apoptosis, and the induction of regulatory T-cells in porcine lymphocytes | |
| Vollmers et al. | Distinct host cell fates for human malignant melanoma targeted by oncolytic rodent parvoviruses | |
| Snoussi et al. | Interaction of parvoviruses with the nuclear envelope | |
| Gallez-Hawkins et al. | DNA and low titer, helper-free, recombinant AAV prime-boost vaccination for cytomegalovirus induces an immune response to CMV-pp65 and CMV-IE1 in transgenic HLA A* 0201 mice | |
| US20220010335A1 (en) | Prokaryotic-eukaryotic hybrid viral vector for delivery of large cargos of genes and proteins into human cells | |
| Sasaki et al. | In search of adeno-associated virus vectors with enhanced cardiac tropism for gene therapy |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20090916 |