CN103290052A - Improved adenovirus vector system, preparation and application of its virus particle - Google Patents
Improved adenovirus vector system, preparation and application of its virus particle Download PDFInfo
- Publication number
- CN103290052A CN103290052A CN2013100587656A CN201310058765A CN103290052A CN 103290052 A CN103290052 A CN 103290052A CN 2013100587656 A CN2013100587656 A CN 2013100587656A CN 201310058765 A CN201310058765 A CN 201310058765A CN 103290052 A CN103290052 A CN 103290052A
- Authority
- CN
- China
- Prior art keywords
- carrier
- ires
- adenovirus
- gfp
- reorganization
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses an improved adenovirus vector system and a virus preparation method. The system takes a pDONR221 vector as an initial vector to make improvement, and multiple cloning sites and an IRES-GFP fragment are inserted. The system combines enzyme digestion connection and recombination reaction technologies, can efficiently construct a vector, and also reduces the reagent cost. The invention also discloses an improved method of purification following after enzyme digestion of the virus vector. The method abandons traditional purification methods adopting phenol, chloroform and isoamyl alcohol, and uses a conventional DNA recovery column or direct heat inactivation method. The method is simple and feasible, shortens the operation time, reduces the material cost, and has no need for toxic phenol and chloroform reagents. The adenovirus system combining the two aspects has improved preparation efficiency and reduced cost, and still maintains high efficiency in infected cells.
Description
Technical field
The invention belongs to biological technical field, particularly preparation and the application of a kind of improved adenovirus system and virion thereof.
Background technology
Adenovirus (adenovirus, Ad) development as expression vector originates in early 1960s, at that time the virologist observe the adenoviral gene group can with monkey viroid 40(SV40) genomic hybridization, illustrate that the adenoviral gene group can carry the heterology gene.After this adenovirus progressively develops into a kind of important carrier system.
The characteristics of adenovirus carrier are the transgene efficiency height, and experiment in vitro has the transduction efficiency above 90% usually; Whether transducible dissimilar human tissue cell is not limit by somatoblast by target cell; Enter and be not incorporated into the host cell gene group in the cell, only moment expresses, and is safe.Thereby adenovirus carrier is having increasing application aspect the gene therapy clinical trial, becomes the virus vector of after retroviral vector widespread use and tool prospect.Using the widest adenovirus carrier at present is serum 5 type adenovirus.
The strategy that makes up at present the recombinant adenovirus system mainly contains in cell/bacterium two kinds of recombination methods and external direct recombination method.The former is representative with the Ad-easy system of Stratagene company, and recombining reaction carries out in cell or bacterial body, needs loaded down with trivial details screening step, could obtain correct recombinant vectors; The latter uses the vitro recombination method, is representative with the Adeno-X system of Clontech and the Virapower system of Invitrogen company.The Adeno-X system adopts twice enzyme to cut method of attachment, because viral genome is grown (greater than 36K), success ratio is low, and test kit is expensive when still connecting for the second time.The Virapower system of Invitrogen company has used the method for twice reorganization at the external recombinant vectors of finishing, but two kinds of reorganization need two kinds of recombinases, and cost is very high, and recombinase usually causes recombination efficiency instability to occur to temperature sensitive.
The carrier that vitro recombination is finished generally need carry out the PacI enzyme and cut before packaging virus, and adopts classical phenol: chloroform: the primary isoamyl alcohol purifying, and this method length consuming time, organic efficiency is not high, and the operator is had the risk of chemical hazard.
For making adenovirus system 1) in the vector construction process, reach efficient and reduce unstable, lower reagent cost; 2) in finishing the purge process that makes up after enzyme is cut, the purifying rate of recovery can be improved, the use of poisonous chemical reagent can be avoided again, purifying mode after we have improved adenovirus system and enzyme and cut, improved efficient, reduced cost, obtained good virion and prepared effect.
Summary of the invention
The object of the invention provides a kind of improved adenovirus system and viral preparation method, and this system combines enzyme and cuts connection and recombining reaction technology, and efficiently carrier construction has reduced reagent cost again; Another object of the present invention provides follow-up virus vector enzyme cut after, the a kind of of purifying improves one's methods, this method has been abandoned traditional phenol: chloroform: the primary isoamyl alcohol method, and use conventional DNA to reclaim post or direct heating deactivation method, simple, improved efficient, utilize this two adenovirus systems that the aspect combines, preparation efficiency improves, and cost reduces.
Technical scheme of the present invention is as follows:
The object of the invention provides a kind of improved adenovirus system and viral preparation method, and this system combines enzyme and cuts connection and recombining reaction technology, and efficiently carrier construction has reduced reagent cost again; Another object of the present invention provides follow-up virus vector enzyme cut after, the a kind of of purifying improves one's methods, this method has been abandoned traditional phenol: chloroform: the primary isoamyl alcohol method, and use conventional DNA to reclaim post or direct heating deactivation method, simple, improved efficient, utilize this two adenovirus systems that the aspect combines, preparation efficiency improves, and cost reduces.
Technical scheme of the present invention is as follows:
One of technical scheme of the present invention is: a kind of adenovirus system, it is to be that initial carrier improves with the pDONR221 carrier, has inserted multiple clone site and IRES-GFP fragment.
Wherein, preferred, described multiple clone site is followed successively by: NotI, and XbaI, BglII,, XhoI, SacI, EcoRI, PstI, SalI, SacII, SmaI, BamHI.
The present invention is divided into initial with skeleton portion among the carrier pDONR221 of Invitrogen company, multiple clone site and IRES-GFP fragment in the connection, make carrier energy high expression level goal gene, simultaneously GFP albumen being arranged again is spike, has overcome the defective that does not have the GFP tracing protein in the original carrier.
When the design multiple clone site, fully assessed other sequence information on the carrier, add single restriction enzyme site: NotI, XbaI, BglII,, XhoI, SacI, EcoRI, PstI, SalI, SacII, SmaI, BamHI is conducive to clone with the method that simple enzyme is cut, connected.The sequence information of restriction enzyme site is as follows:
5'-GCG?GCC?GCT?TCT?AGA?CTC?AGA?TCT?CGA?GCT?CAA?GCT?TCG?AAT?TCT?GCA?GTC?GACGGT?ACC?GCG?GGC?CCG?GGA?TCC-3'。
Wherein, preferred, described adenovirus carrier is got by the method preparation that may further comprise the steps:
1) getting the pIRES-EGFP carrier is template, adopt following two primers to carry out pcr amplification, obtain the MCS-IRES-GFP fragment, in the described primer, article one, the nucleotide sequence of primer is shown in SEQ ID NO.1, and the nucleotide sequence of another primer is shown in SEQ IDNO.2;
2) above-mentioned MCS-IRES-GFP fragment and carrier pDONR221 are carried out BP reorganization, the carrier pDONR-MCS-IRES-GFP of acquisition;
3) carrier pDONR-MCS-IRES-GFP and carrier pAd/CMV/V5-DEST are carried out the LR reorganization, obtain final carrier pAd/MCS-IRES-GFP.
Wherein, described BP reorganization is this area routine, refers to the specificity reorganization that attB site and attP site take place.The preferred BP recombination system of Invitrogen that uses of described BP reorganization carries out the BP reorganization.Described LR reorganization is this area routine, refers to the specificity reorganization that attL site and attR site take place.The preferred LR recombination system of Invitrogen that uses of described LP reorganization carries out the LR reorganization.
Two of technical scheme of the present invention is: a kind of recombinant adenoviral vector, it is the recombinant adenoviral vector that has inserted exogenous genetic fragment in the multiple clone site of described adenovirus carrier.
Three of technical scheme of the present invention is: a kind of method of described recombinant adenoviral vector packaging virus, comprise transfection 293A cell after the recombinant adenoviral vector linearizing, comprising:
1) described recombinant adenoviral vector is carried out endonuclease reaction with the PacI restriction enzyme;
2) with the endonuclease reaction liquid purifying of step 1) gained and reclaim enzyme and cut product and be applied to transfection; Perhaps with the endonuclease reaction liquid intensification deactivation of step 1) gained, directly apply to transfection then.
Preferably, in the step 1), the consumption of described recombinant adenoviral vector is 0.01-1 μ g/ μ l, and the consumption of PacI enzyme is 0.01-1U/ μ l; Preferred, the enzyme amount of cutting of described adenovirus carrier is 5-20 μ g, and the consumption of PacI enzyme is 5-20U, and the endonuclease reaction volume is 20 μ l-100 μ l.
Step 2) in, described purifying refers to that conventional enzyme cuts the purifying of product, can adopt conventional column purification method.
Step 2) in, described intensification deactivation, preferred, 65 ℃ of temperature, soaking time 20 minutes.
The present invention adopts the lipofectamine2000 method in the adenovirus particles preparation method, and the concrete steps that a preferred embodiments comprises are
1) gets the 293A cell that is in logarithmic phase, use 0.05% trysinization, after the cell counting, according to every hole 4.5 * 10
5Individual cell is planted in 6 orifice plates, overnight incubation;
2) remove nutrient solution before the transfection in second day, change the 2ml fresh medium;
3) get the plasmid that 2 μ g enzymes cut and add 250 μ l in 37 ℃ of preheating Opti-MEM, mixing;
4) get 5 μ l lipofectamine2000 and add among the 250 μ l Opti-MEM, mixing, room temperature is placed 5min;
5) mix the lipofectamine2000 of plasmid solution and dilution after digested plasmid behind the purifying or the deactivation, room temperature was placed 20 minutes;
6) 500 μ l mixtures are joined in the cell hole mixing.At 37 ℃, cultivate after 5-6 hour in the incubator of 5% CO2, change complete culture solution, continue to put in the incubator and cultivate;
7) after the transfection 48 hours, peptic cell was transferred in the 10cm culture dish, added the 10ml complete culture solution;
8) whether changed to fresh culture in every 2-3 days, observing has pathology (CPE) (generally appear at transfection after 7-10 days) to occur;
9) allow infection continue to take place, (10-13 after generally appearing at transfection days) occur until 80%CPE.Collecting cell and supernatant liquor are to the 15ml centrifuge tube of sterilization.Collecting cell and supernatant liquor are to the 15ml centrifuge tube of sterilization.Multigelation 3 times, centrifugal 10 minutes of 3000g collects supernatant, is stored in-70 ℃ of refrigerators.
But transduction in the gene transfer of adenovirus particles application cell of the present invention and the animal body, simple to operate, the transduction efficiency height can effectively infect various kinds of cell.
Adenovirus carrier of the present invention carries mark green fluorescent protein (GFP) and multiple clone site.
The raw material that the present invention is used or reagent except specifying, equal commercially available getting.
Than prior art, beneficial effect of the present invention is as follows:
1. the present invention has done improvement with pDONR221, newly added multiple clone site, the method that can adopt simple enzyme to cut, connect when novel vector is made up is carried out, saved the BP recombining reaction, only need carry out again being built into the final purpose carrier once step LR recombining reaction, whole process efficiency is higher, the reagent expense reduce near half.
2. in the purge process of the present invention after the carrier enzyme is cut, changed use phenol: chloroform: the method for primary isoamyl alcohol, and adopt conventional PCR purification kit, perhaps adopt direct intensification deactivation method, operating time is shortened greatly, and the organic efficiency raising, can avoid using Harmful chemicals reagent again.
Description of drawings
Below in conjunction with description of drawings feature of the present invention and beneficial effect.
Fig. 1 is original pDONR221 carrier collection of illustrative plates.
Fig. 2 is improved carrier pDONR-MCS-IRES-GFP collection of illustrative plates.
Fig. 3 is carrier pAd/CMV/V5-DEST collection of illustrative plates.
Fig. 4 is the vector construction synoptic diagram of embodiment 1 and 2.
Fig. 5 is the vector construction synoptic diagram of embodiment 3.
Fig. 6 is the vector construction synoptic diagram of embodiment 6 and embodiment 7.
Fig. 7 shows that empty carrier adenopathy toxenzyme cuts back different treatment method gained virus titer relatively.1, phenol-chloroform method; 2, the column purification method; 3, the heat denatured method.
Fig. 8 shows that the adenovirus carrier enzyme of band LacZ foreign gene cuts back different treatment method gained virus titer relatively.1, phenol-chloroform method; 2, the column purification method; 3, the heat denatured method.
Embodiment
Further specify the present invention with embodiment below, but the present invention is not limited.The experimental technique of unreceipted actual conditions in the following example, usually according to normal condition, or the condition of advising according to manufacturer." room temperature " described in the embodiment refers to the temperature of the operation room tested, is generally 25 ℃.
The MCS-IRES-GFP fragment of amplification, specific as follows:
Design and synthesize 2 PCR primers, sequence is as follows:
5’-GGGGACAAGTTTGTACAAAAAAGCAGGCTGCGGCCGCTTCTAGACTCAGATCTCGAGCT-3’（SEQID?NO.1）;
5’–GGGGACCACTTTGTACAAGAAAGCTGGGTCTTACTTGTACAGCTCGTCCAT-3’(SEQ?ID?NO.2)。
Getting pIRES-EGFP carrier (available from Clontech) and be template, is primer amplification with above-mentioned 2 oligonucleotide chains, obtains the dna fragmentation of MCS-IRES-GFP.Should from this fragment that the pIRES-EGFP carrier increases, namely contain multiple clone site NotI, XbaI, BglII,, XhoI, SacI, EcoRI, PstI, SalI, SacII, SmaI, BamHI.
1) volume of each component in the PCR system
| Component | Volume |
| Ultrapure water | 37.8μl |
| The 10XPCR damping fluid | 5μl |
| Magnesium ion (25mM) | 3μl |
| dNTPs(25mM) | 0.4μl |
| Upstream primer (10 μ M) | 1μl |
| Downstream primer (10 μ M) | 1μl |
| Taq enzyme (5U/ μ l) | 0.3μl |
| Dna profiling | 1.5μl |
| Total system | 50μl |
The PCR reaction conditions:
1.: 95 ℃, 2 minutes;
2. (30 circulations): 95 ℃, 30 seconds, 55 ℃, 30 seconds, 72 ℃, 60 seconds;
3.: 72 ℃, 10 minutes;
2) PCR product Axygen PCR cleaning agents box purifying.
With pDONR221 carrier (Invitrogen, Fig. 1) reconstruct into the pDONR-MCS-IRES-GFP carrier, comprise the MCS-IRES-GFP fragment purification with above-mentioned amplification, carry out the BP reorganization with pDONR221, the carrier called after pDONR-MCS-IRES-GFP(of acquisition sees Fig. 2).Specific as follows:
The BP recombination system (the BP recombination kit of Invitrogen company) of use Invitrogen company is recombinated the purpose fragment on the carrier pDONR221.According to the form below preparation BP recombining reaction system:
| The PCR product | 2μl |
| The pDONR221 plasmid | 1μl |
| BP?clonaseⅡenzyme?mix | 2μl |
| TE damping fluid (pH8.0) | 5μl |
25 ℃ were reacted 1 hour.
The Proteinase K that adds 1 μ l, 37 ℃ were reacted 10 minutes.
Get the bacillus coli DH 5 alpha competent cell that 5 μ l recombining reaction liquid transform 50 μ l.
Screening positive clone and sequence verification keep the correct BP recombinant plasmid of sequence verification.
Vector construction process synoptic diagram is seen Fig. 4.
PDONR-MCS-IRES-GFP carrier and the pAd/CMV/V5-DEST carrier of embodiment 2 preparations (available from Invitrogen, Fig. 3) are carried out the LR reorganization, obtain final recombinant vectors pAd/MCS-IRES-GFP.Specific as follows:
Use the LR recombination system (the LR recombination kit of Invitrogen company) of Invitrogen company to carry out the LR reorganization.According to the form below preparation LR recombining reaction system:
| The BP recombinant plasmid | 1μl |
| pAd?CMV/V5-DEST | 1μl |
| LR?clonaseⅡenzyme?mix | 2μl |
| TE damping fluid (pH8.0) | 6μl |
25 ℃ were reacted 1 hour.
The Proteinase K that adds 1 μ l, 37 ℃ were reacted 10 minutes.
Get the DH5 α competent cell that 5 μ l recombining reaction liquid transform 50 μ l.
Screening positive clone and sequence verification keep the correct LR recombinant plasmid of sequence verification.
Vector construction process synoptic diagram is seen Fig. 5.
Embodiment 4
Endonuclease reaction: the PacI enzyme is cut carrier pAd/MCS-IRES-GFP, and reaction system is 1 * enzyme cutting buffering liquid, 5-20 μ g recombinant vectors, 5-20U PacI enzyme, cumulative volume 20-100 μ l.
Enzyme is cut the recovery of product: adopt PCR cleaning agents box (available from Axygen) commonly used, to specifications enzyme is cut product according to 3 times of volumes with damping fluid, add to purification column behind the mixing, 10000g1 minute centrifugal, add cleaning buffer solution 600 μ l, centrifugal 1 minute of twice, 10000g, 12000g removed raffinate in centrifugal 1 minute again, added 30 μ l water elution DNA liquid.The quantitative DNA concentration of ultraviolet spectrophotometer.
Perhaps with the liquid of endonuclease reaction 65 ℃ of incubations 20 minutes, directly get required DNA amount transfection 293A cell.
Embodiment 5
The adenovirus packing:
1) it is good to get cell state, is in the 293A cell of logarithmic phase, uses 0.05% trysinization, after the cell counting, according to every hole 4.5 * 10
5Individual cell is planted in 6 orifice plates, and 37 ℃, 5%CO
2Incubator in overnight incubation;
2) remove nutrient solution before the transfection in second day, change the 2ml fresh medium;
3) get the plasmid that the aforementioned enzyme of 2 μ g cuts (be that the enzyme that embodiment 4 makes cuts back to close product, or endonuclease reaction liquid) add 250 μ l through the Opti-MEM(of 37 ℃ of preheatings available from Invitrogen) in, mixing;
4) get 5 μ l lipofectamine2000(available from Invitrogen) add among the 250ul Opti-MEM, mixing, room temperature is placed 5min;
5) mix the lipofectamine2000 of plasmid solution and dilution after digested plasmid behind the purifying or the deactivation gently, room temperature was placed 20 minutes;
6) 500 μ l mixtures are joined in the cell hole wave and culture plate, mixing.At 37 ℃, cultivate after 5-6 hour in the incubator of 5% CO2, change complete culture solution, continue to put in the incubator and cultivate;
7) after the transfection 48 hours, peptic cell was transferred in the 10cm culture dish, added the 10ml perfect medium;
8) whether changed to fresh culture in every 2-3 days, observing has pathology (CPE) (generally appear at transfection after 7-10 days) to occur;
9) allow infection continue to take place, (10-13 after generally appearing at transfection days) occur until 80%CPE.Collecting cell and supernatant liquor are to the 15ml centrifuge tube of sterilization.Multigelation 3 times, centrifugal 10 minutes of 3000g collects supernatant, is stored in-70 ℃ of refrigerators, is the adenopathy venom.After measured, titre is about 1E9pfu/ml after the carrier package virus that employing column purification method obtains, and adopt the heating method sex change and save the about 4E8pfu/ml(titer determination of virus titer that the carrier package of purification step goes out with reference to the cell spot method of classics, with reference to the Invitrogen specification sheets).
Use the titre of the virus of other conventional method packings to the results are shown in Figure 7.The phenol-chloroform method of purification (referring to the Invitrogen product description) that contrast is classical adopts the titre of column purification method virus preparation higher; The thermally denature method that same contrast the present invention simplifies still can successfully be packed out virus, and the titre variation is little, but whole steps is compared conventional phenol-chloroform method of purification, saves time, and has avoided the use of poisonous chemical reagent, is conducive to environmental protection, also cost saving.
With escherichia coli lacz gene as foreign gene, test carrier pDONR-MCS-IRES-GFP of the present invention, at first LacZ is amplified with PCR method, and be cloned into the pDONR-MCS-IRES-GFP carrier, the LacZ carrier that is used for template is pLenti6.3/V5/GW-LacZ(Invitrogen company product).Vector construction process synoptic diagram is seen Fig. 6.
Concrete steps are as follows
1.PCR amplification foreign gene LacZ:
1) design one couple of PCR primers amplification LacZ gene,
Upstream primer LacZ-F(contains the XhoI site):
5’-TTATTCTCGAGACCATGATAGATCCCGTCGTTTTACA-3’；
Downstream primer LacZ-R(contains the EcoRI site):
5’-TTATTGAATTCTTAGTAGTTTTTTGACACCAGACCAACTG-3’。
2) PCR reaction conditions:
The volume of each component in the PCR system:
| Component | Volume |
| Ultrapure water | 37.8μl |
| The 10XPCR damping fluid | 5μl |
| Magnesium ion (25mM) | 3μl |
| dNTPs(25mM) | 0.4μl |
| Upstream primer LacZ-F(10 μ M) | 1μl |
| Downstream primer LacZ-R(10 μ M) | 1μl |
| Taq enzyme (5U/ μ l) | 0.3μl |
| Dna profiling | 1.5μl |
| Total system | 50μl |
The PCR response procedures:
1.: 95 ℃, 2 minutes;
2. (30 circulations): 95 ℃, 30 seconds, 55 ℃, 30 seconds, 72 ℃, 3 minutes;
3.: 72 ℃, 10 minutes;
3) PCR product Axygen PCR cleaning agents box purifying;
4) XhoI and EcoRI enzyme are cut this fragment, and the enzyme system of cutting is: 10 times of damping fluid 2 μ l, purified pcr product 2 μ g, each 10 unit of XhoI and EcoRI enzyme, cumulative volume 20 μ l;
5) XhoI and EcoRI enzyme are cut the carrier pDONR-MCS-IRES-GFP that this patent is transformed, and use Axygen PCR cleaning agents box purifying equally;
6) ligation: enzyme is cut PCR product 0.2 μ g behind the purifying, and enzyme is cut back carrier 0.1 μ g, adds 10 * T4 ligase enzyme damping fluid, 2 μ l, T4 ligase enzyme 1 μ l, cumulative volume 20 μ l, 16 ℃ 4 hours;
7) transformed into escherichia coli is chosen single bacterium colony, and the extracting plasmid send sequence verification, and the carrier of choosing correct sequence carries out the LR recombining reaction.
Embodiment 7
The LR recombination to construct contains final adenovirus carrier and the virus packing of LacZ gene.
1. the pDONR-MCS-IRES-GFP carrier of the insertion LacZ gene that embodiment 6 is prepared and pAd/CMV/V5-DEST carrier (available from Invi trogen) carry out the LR reorganization, obtain final recombinant vectors pAd/LacZ-IRES-GFP, and concrete steps are with embodiment 3.
2.PacI enzyme is cut pAd/LacZ-IRES-GFP carrier and purification process, concrete steps are with embodiment 4.
3. adenovirus is packed: concrete steps are with embodiment 5.Adopt the virus titer of column purification method carrier package to be about 8.6E8pfu/ml, and adopt easy thermally denature and directly the titre of packing be 4E8pfu/ml, contrast classical phenol: the titre of chloroform method of purification is that 4.5E8pfu/ml(sees Fig. 8).Titer determination is with reference to the cell spot method of classics, with reference to the Invitrogen specification sheets.
Adenovirus infection purpose cell (the purpose cell is Hela cell (available from Chinese Academy of Sciences's Shanghai cell bank):
1. the purpose cell is planted the plate amount: 2.0 * 10 at virus infection kind the day before yesterday 96 orifice plates
4Cells/well;
2. infecting the same day, changing to fresh configuration substratum in 96 orifice plates: 50 μ l/ holes, add adenopathy venom (embodiment 5,7 preparations and) with the MOI=0-100 scope, mixing is placed on cell culture incubator;
3. virus added back about 6 hours, changed to fresh substratum in 96 orifice plates, and 37 ℃, 5%CO
2Incubator in continue to cultivate.The result is infected in observation in 48-96 hour, and when MOI=20 was above, more than 90%, the adenovirus vigor of reflection preparation was better by the positive rate of virus infection for cell, can be applied to the gene transfer of cell fully.
Should be understood that after having read foregoing of the present invention, those skilled in the art can make various changes or modifications the present invention, these equivalent form of values fall within the application's appended claims institute restricted portion equally.
Claims (8)
1. an adenovirus carrier is characterized in that, it is to be that initial carrier improves with the pDONR221 carrier, has inserted multiple clone site and IRES-GFP fragment.
2. adenovirus carrier as claimed in claim 1 is characterized in that, described multiple clone site is followed successively by: NotI, and XbaI, BglII,, XhoI, SacI, EcoRI, PstI, SalI, SacII, SmaI, BamHI.
3. adenovirus carrier as claimed in claim 1 is characterized in that, described adenovirus carrier is got by the method preparation that may further comprise the steps:
1) getting the pIRES-EGFP carrier is template, adopt following two primers to carry out pcr amplification, obtain the MCS-IRES-GFP fragment, in the described primer, article one, the nucleotide sequence of primer is shown in SEQ ID NO.1, and the nucleotide sequence of another primer is shown in SEQID NO.2;
2) the described MCS-IRES-GFP fragment of step 1) and carrier pDONR221 are carried out BP reorganization, the carrier pDONR-MCS-IRES-GFP of acquisition;
3) carrier pDONR-MCS-IRES-GFP and carrier pAd/CMV/V5-DEST are carried out the LR reorganization, obtain final carrier pAd/MCS-IRES-GFP.
4. adenovirus carrier as claimed in claim 3 is characterized in that, described BP reorganization uses the BP recombination system of Invitrogen to carry out the BP reorganization; Described LP reorganization uses the LR recombination system of Invitrogen to carry out the LR reorganization.
5. recombinant adenoviral vector, it is the recombinant adenoviral vector that has inserted exogenous genetic fragment in the multiple clone site of the described adenovirus carrier of claim 1.
6. the method for a recombinant adenoviral vector packaging virus as claimed in claim 5 comprises transfection 293A cell after the recombinant adenoviral vector linearizing, it is characterized in that, comprising:
1) recombinant adenoviral vector as claimed in claim 5 is carried out endonuclease reaction with the PacI restriction enzyme;
2) with the endonuclease reaction liquid purifying of step 1) gained and reclaim enzyme and cut product and be applied to transfection; Perhaps with the endonuclease reaction liquid intensification deactivation of step 1) gained, directly apply to transfection then.
7. method as claimed in claim 6 is characterized in that, in the step 1), the consumption of described recombinant adenoviral vector is 0.01-1 μ g/ μ l, and the consumption of PacI enzyme is 0.01-1U/ μ l; Step 2) the intensification deactivation described in is 65 ℃ of temperature, soaking time 20 minutes.
8. the application of adenovirus carrier as claimed in claim 1 in gene clone or expression.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310058765.6A CN103290052B (en) | 2012-02-24 | 2013-02-25 | A kind of adenovirus system of improvement and the Synthesis and applications of virion thereof |
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210044801 | 2012-02-24 | ||
| CN201210044801.9 | 2012-02-24 | ||
| CN201310058765.6A CN103290052B (en) | 2012-02-24 | 2013-02-25 | A kind of adenovirus system of improvement and the Synthesis and applications of virion thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103290052A true CN103290052A (en) | 2013-09-11 |
| CN103290052B CN103290052B (en) | 2016-02-03 |
Family
ID=49091582
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310058765.6A Active CN103290052B (en) | 2012-02-24 | 2013-02-25 | A kind of adenovirus system of improvement and the Synthesis and applications of virion thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103290052B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107384957A (en) * | 2017-07-07 | 2017-11-24 | 广州派真生物技术有限公司 | The AAV auxiliary package carriers of expression miRNA a kind of and construction method, screening technique and the application of the carrier |
| CN108588101A (en) * | 2018-04-27 | 2018-09-28 | 四川大学 | Build the molecular cloning method of same gene difference expression vector |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1775947A (en) * | 2005-09-08 | 2006-05-24 | 北京多米诺医药研究所 | Recombinant adenovirus capable of expressing tomour specific apoptosis peptide, and its preparing method and use |
| CN102168075A (en) * | 2011-02-28 | 2011-08-31 | 重庆医科大学附属儿童医院 | Recombinant adenovirus carrying rat retinoic acid receptor (RAR) gamma gene and construction method thereof |
-
2013
- 2013-02-25 CN CN201310058765.6A patent/CN103290052B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1775947A (en) * | 2005-09-08 | 2006-05-24 | 北京多米诺医药研究所 | Recombinant adenovirus capable of expressing tomour specific apoptosis peptide, and its preparing method and use |
| CN102168075A (en) * | 2011-02-28 | 2011-08-31 | 重庆医科大学附属儿童医院 | Recombinant adenovirus carrying rat retinoic acid receptor (RAR) gamma gene and construction method thereof |
Non-Patent Citations (3)
| Title |
|---|
| EBIOTECH: "基因组纯化之Qiagen篇 技术是王道", 《生物通技术周刊》, no. 86, 24 June 2011 (2011-06-24) * |
| GUO QING-SONG等: "Combined Transfection of the Three Transcriptional Factors, PDX-1, NeuroD1, and MafA, Causes Differentiation of Bone Marrow Mesenchymal Stem Cells into Insulin-Producing Cells", 《HINDAWI PUBLISHING CORPORATION EXPERIMENTAL DIABETES RESEARCH》, 19 June 2012 (2012-06-19) * |
| 罗红春 等: "SDF-1/RUNX1融合蛋白腺病毒载体的构建及滴度测定", 《重庆医学》, vol. 41, no. 12, 30 April 2012 (2012-04-30), pages 1200 - 1202 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107384957A (en) * | 2017-07-07 | 2017-11-24 | 广州派真生物技术有限公司 | The AAV auxiliary package carriers of expression miRNA a kind of and construction method, screening technique and the application of the carrier |
| CN108588101A (en) * | 2018-04-27 | 2018-09-28 | 四川大学 | Build the molecular cloning method of same gene difference expression vector |
| CN108588101B (en) * | 2018-04-27 | 2022-03-04 | 苏丹 | Molecular cloning method for constructing different expression vectors of same gene |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103290052B (en) | 2016-02-03 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AU2020267249B2 (en) | Genome editing using campylobacter jejuni crispr/cas system-derived rgen | |
| AU779025B2 (en) | Method of producing a recombinant adeno-associated virus, suitable means for producing the same and use thereof for producing a medicament | |
| US5919676A (en) | Adenoviral vector system comprising Cre-loxP recombination | |
| US20160068822A1 (en) | Recombinant virus and preparations thereof | |
| JPH0884589A (en) | Recombined dna virus vector for infection of animal cell | |
| CN107338266B (en) | VIGS silencing system for identifying MmPLDS gene of mulberry, and construction method and application thereof | |
| CN1200149A (en) | Methods and vectors for site-specific recombination | |
| US7132290B2 (en) | Recombinase-based system for combustion of adenovirus vectors | |
| WO2004092397A2 (en) | Tmprss2 regulatory sequences and uses thereof | |
| JP7440045B2 (en) | Nucleic acid-encapsulated AAV hollow particles | |
| US20220186250A1 (en) | Recombinant parvoviral vectors and method of making and use thereof | |
| CN103290052B (en) | A kind of adenovirus system of improvement and the Synthesis and applications of virion thereof | |
| TW202116794A (en) | Synthetic genetic elements for biomanufacture | |
| US8709778B2 (en) | Method of adenoviral vector synthesis | |
| US20100285464A1 (en) | A conserved region of the hiv-1 genome and uses thereof | |
| CN111004800B (en) | CRISPR/Cas9 system targeting HPV subtype 16/18 oncogene E6/E7 | |
| CN110117579A (en) | Express recombinant virus and its construction method and the application of 16 type blue tongue virus VP2 genes | |
| US20020106382A1 (en) | Modified adenovirus and uses thereof | |
| AU752811B2 (en) | Preparation of recombinant adenovirus carrying a rep gene of Adeno-Associated Virus | |
| WO2021223545A1 (en) | Directed evolution method based on primary and secondary replicon of gemini virus | |
| Nakowitsch et al. | Optimization of baculovirus transduction on freestyle TM 293 cells for the generation of influenza B/Lee/40 | |
| Neyns et al. | Characterization of permanent cell lines that contain the AAV2 rep-cap genes on an Epstein-Barr-virus-based episomal plasmid | |
| CN103088062A (en) | Construction of goat beta-lactoglobulin gene targeting plasmid based on adeno-associated virus and targeting method thereof | |
| AU717597C (en) | Methods and vectors for site-specific recombination | |
| JP2014503214A (en) | Means for creating adenoviral vectors for cloning large nucleic acids |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C41 | Transfer of patent application or patent right or utility model | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20160107 Address after: 200233, room 5, building 333, 301 Guiping Road, Shanghai, Xuhui District Applicant after: Shanghai Nobobio Scientific Co., Ltd. Address before: 226601, No. 188, development avenue, Haian County Development Zone, Nantong, Jiangsu Applicant before: Jiangsu Nobobio Scientific Co., Ltd. |
|
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |