CN103290052B - A kind of adenovirus system of improvement and the Synthesis and applications of virion thereof - Google Patents

Abstract

The invention discloses a kind of adenovirus system of improvement and viral preparation method, it improves for starting vector with pDONR221 carrier, inserts multiple clone site and IRES-GFP fragment.This system combines enzyme and cuts connection and recombining reaction technology, can efficient carrier construction, again reduces reagent cost.The invention also discloses after subsequent viral carrier enzyme cuts, improving one's methods of purifying, the method has abandoned traditional phenol: chloroform: primary isoamyl alcohol method of purification, and uses conventional DNA to reclaim post or direct heating deactivation method, simple, shorten the operating time, reduce material cost, and without the need to using poisonous phenol, chloroform reagent, utilize the adenovirus system that this two aspects combine, preparation efficiency improves, and cost reduces, and still keeps efficient in infected cell.

Description

A kind of adenovirus system of improvement and the Synthesis and applications of virion thereof

Technical field

The invention belongs to biological technical field, particularly a kind of adenovirus system of improvement and the Synthesis and applications of virion thereof.

Background technology

Adenovirus (adenovirus, Ad) development as expression vector originates in early 1960s, at that time virologist observe adenoviral gene group can with monkey viroid 40(SV40) genomic hybridization, illustrate that adenoviral gene group can carry heterologous gene.After this adenovirus progressively develops into a kind of important carrier system.

The feature of adenovirus carrier is that transgene efficiency is high, and experiment in vitro has the transduction efficiency more than 90% usually; Transducible dissimilar human tissue cell, by target cell whether by somatoblast is limit; Enter in cell and be not incorporated into host cell gene group, only Transient Expression, security is high.Thus, adenovirus carrier has had increasing application in Gene Therapy Clinical Trials, becomes widespread use after retroviral vector and the virus vector of most prospect.The widest adenovirus carrier of current utilization is Serotype 5 adenovirus.

The strategy of current structure recombinant adenovirus system mainly contains recombination method and external direct recombination method two kinds in cell/bacterium.The former is with the Ad-easy system of Stratagene company for representative, and recombining reaction carries out in cell or bacterial body, needs loaded down with trivial details screening step, could obtain correct recombinant vectors; The latter applies vitro recombination method, with the Virapower system of the Adeno-X system of Clontech and Invitrogen company for representative.Adeno-X system adopts twice enzyme to cut method of attachment, but due to viral genome longer (being greater than 36K) when second time connects, success ratio is low, and test kit is expensive.The method that the Virapower system of Invitrogen company employs twice restructuring completes recombinant vectors in vitro, but two kinds of restructuring needs, two kinds of recombinases, cost is very high, and recombinase is to temperature sensitive, usually causes recombination efficiency to occur unstable.

The carrier that vitro recombination completes, before packaging virus, generally needs to carry out PacI enzyme and cuts, and adopts classical phenol: chloroform: primary isoamyl alcohol purifying, the method length consuming time, organic efficiency is not high, and has the risk of chemical hazard to operator.

For making adenovirus system 1) in vector construction process, reach efficient and reduce unstable, lowering reagent cost; 2) complete build enzyme cut after purge process in, the purifying rate of recovery can be improved, the use of toxic chemical can be avoided again, we improve adenovirus system and enzyme cut after way of purification, improve efficiency, reduce cost, obtain good virion and prepare effect.

Summary of the invention

The object of the invention is to provide a kind of adenovirus system of improvement and viral preparation method, and this system combines enzyme and cuts connection and recombining reaction technology, can efficient carrier construction, again reduces reagent cost; Another object of the present invention is to provide after subsequent viral carrier enzyme cuts, the one of purifying is improved one's methods, the method has abandoned traditional phenol: chloroform: primary isoamyl alcohol method, and use conventional DNA to reclaim post or direct heating deactivation method, simple, improve efficiency, utilize the adenovirus system that this two aspects combine, preparation efficiency improves, and cost reduces.

Technical scheme of the present invention is as follows:

The object of the invention is to provide a kind of adenovirus system of improvement and viral preparation method, and this system combines enzyme and cuts connection and recombining reaction technology, can efficient carrier construction, again reduces reagent cost; Another object of the present invention is to provide after subsequent viral carrier enzyme cuts, the one of purifying is improved one's methods, the method has abandoned traditional phenol: chloroform: primary isoamyl alcohol method, and use conventional DNA to reclaim post or direct heating deactivation method, simple, improve efficiency, utilize the adenovirus system that this two aspects combine, preparation efficiency improves, and cost reduces.

Technical scheme of the present invention is as follows:

One of technical scheme of the present invention is: a kind of adenovirus system, and it improves for starting vector with pDONR221 carrier, inserts multiple clone site and IRES-GFP fragment.

Wherein, preferably, described multiple clone site is followed successively by: NotI, XbaI, BglII, XhoI, SacI, EcoRI, PstI, SalI, SacII, SmaI, BamHI.

The present invention is divided into initial with skeleton portion in Invitrogen company carrier pDONR221, multiple clone site and IRES-GFP fragment in connection, make carrier energy high expression level goal gene, have again GFP albumen to be spike simultaneously, overcome the defect not having GFP tracing protein in original carrier.

When designing multiple clone site, fully have evaluated other sequence information on carrier, adding single restriction enzyme site: NotI, XbaI, BglII,, XhoI, SacI, EcoRI, PstI, SalI, SacII, SmaI, BamHI, be conducive to simple enzyme cut, the method that connects clones.The sequence information of restriction enzyme site is as follows:

5'-GCGGCCGCTTCTAGACTCAGATCTCGAGCTCAAGCTTCGAATTCTGCAGTCGACGGTACCGCGGGCCCGGGATCC-3'。

Wherein, preferably, described adenovirus carrier, prepared by the method comprised the following steps and obtain:

1) getting pIRES-EGFP carrier is template, adopt following two primers to carry out pcr amplification, obtain MCS-IRES-GFP fragment, in described primer, article one, the nucleotide sequence of primer is as shown in SEQIDNO.1, and the nucleotide sequence of another primer is as shown in SEQIDNO.2;

2) above-mentioned MCS-IRES-GFP fragment and carrier pDONR221 are carried out BP restructuring, the carrier pDONR-MCS-IRES-GFP of acquisition;

3) carrier pDONR-MCS-IRES-GFP and carrier pAd/CMV/V5-DEST is carried out LR restructuring, obtain final carrier pAd/MCS-IRES-GFP.

Wherein, described BP restructuring is that this area is conventional, refers to the specificity restructuring that attB site and attP site occur.Described BP restructuring preferably uses the BP recombination system of Invitrogen to carry out BP restructuring.Described LR restructuring is that this area is conventional, refers to the specificity restructuring that attL site and attR site occur.Described LP restructuring preferably uses the LR recombination system of Invitrogen to carry out LR restructuring.

Two of technical scheme of the present invention is: a kind of recombinant adenoviral vector, and it is the recombinant adenoviral vector inserting exogenous genetic fragment in the multiple clone site of described adenovirus carrier.

Three of technical scheme of the present invention is: a kind of method of described recombinant adenoviral vector packaging virus, comprises transfection 293A cell after recombinant adenoviral vector linearizing, comprising:

1) described recombinant adenoviral vector PacI restriction enzyme is carried out endonuclease reaction;

2) the endonuclease reaction liquid purifying of step 1) gained is reclaimed digestion products and is applied to transfection; Or by the endonuclease reaction liquid intensification deactivation of step 1) gained, then directly apply to transfection.

Preferably, in step 1), the consumption of described recombinant adenoviral vector is 0.01-1 μ g/ μ l, and the consumption of PacI enzyme is 0.01-1U/ μ l; Preferred, the enzyme amount of cutting of described adenovirus carrier is 5-20 μ g, and the consumption of PacI enzyme is 5-20U, and endonuclease reaction volume is 20 μ l-100 μ l.

Step 2) in, described purifying refers to the purifying of conventional digestion products, can adopt conventional column purification method.

Step 2) in, described intensification deactivation, preferably, temperature 65 DEG C, soaking time 20 minutes.

The present invention adopts lipofectamine2000 method in adenovirus particles preparation method, and the concrete steps that a preferred embodiments comprises are

1) get the 293A cell being in logarithmic phase, use 0.05% trysinization, after cell counting, according to every hole 4.5 × 10 ⁵individual cell, plants in 6 orifice plates, overnight incubation;

2) remove nutrient solution before transfection in second day, change 2ml fresh medium;

3) get the plasmid that 2 μ g enzymes cut and add 250 μ l in 37 DEG C of preheating Opti-MEM, mixing;

4) getting 5 μ llipofectamine2000 adds in 250 μ lOpti-MEM, mixing, and room temperature places 5min;

5) mix the lipofectamine2000 of plasmid solution and dilution after digested plasmid after purifying or deactivation, room temperature places 20 minutes;

6) 500 μ l mixtures are joined in cell hole, mixing.At 37 DEG C, after cultivating 5-6 hour in the incubator of the CO2 of 5%, change complete culture solution, continue to put in incubator and cultivate;

7) after transfection 48 hours, peptic cell was transferred in 10cm culture dish, adds 10ml complete culture solution;

8) often within 2-3 days, change to fresh culture, observe and whether have pathology (CPE) to occur (the general 7-10 days occurred after transfection);

9) infection is allowed to continue to occur, until 80%CPE occurs (general appearance 10-13 days after transfection).Collecting cell and supernatant liquor are to the 15ml centrifuge tube of sterilizing.Collecting cell and supernatant liquor are to the 15ml centrifuge tube of sterilizing.Multigelation 3 times, centrifugal 10 minutes of 3000g, collects supernatant, is stored in-70 DEG C of refrigerators.

Adenovirus particles of the present invention can transduction in the gene transfer of application cell and animal body, and simple to operate, transduction efficiency is high, effectively can infect various kinds of cell.

Adenovirus carrier of the present invention carries mark green fluorescent protein (GFP) and multiple clone site.

The raw material that the present invention is used or reagent except special instruction, all commercially.

Compared to prior art, beneficial effect of the present invention is as follows:

1. pDONR221 has been done improvement by the present invention, newly add multiple clone site, the method simple enzyme can be adopted when novel vector is built to cut, connecting is carried out, eliminate BP recombining reaction, only need to carry out a step LR recombining reaction again and just can be built into final object carrier, whole process efficiency is higher, and reagent expense reduces nearly half.

2. in the purge process of the present invention after carrier enzyme is cut, change use phenol: chloroform: the method for primary isoamyl alcohol, and adopt conventional PCR purification kit, or adopt direct intensification deactivation method, operating time is shortened greatly, and organic efficiency improves, can avoid again using Harmful chemicals reagent.

Accompanying drawing explanation

Below in conjunction with accompanying drawing, characteristic sum beneficial effect of the present invention is described.

Fig. 1 is original pDONR221 Vector map.

Fig. 2 is improved carrier pDONR-MCS-IRES-GFP collection of illustrative plates.

Fig. 3 is carrier pAd/CMV/V5-DEST collection of illustrative plates.

Fig. 4 is the vector construction schematic diagram of embodiment 1 and 2.

Fig. 5 is the vector construction schematic diagram of embodiment 3.

Fig. 6 is the vector construction schematic diagram of embodiment 6 and embodiment 7.

Fig. 7 shows empty carrier adenopathy toxenzyme and cuts rear different treatment method gained virus titer and compare.1, phenol-chloroform method; 2, column purification method; 3, heat denatured method.

The adenovirus carrier enzyme that Fig. 8 shows band LacZ foreign gene is cut rear different treatment method gained virus titer and is compared.1, phenol-chloroform method; 2, column purification method; 3, heat denatured method.

Embodiment

Further illustrate the present invention by embodiment below, but the present invention is not limited.The experimental technique of unreceipted actual conditions in the following example, usually conveniently condition, or according to the condition that manufacturer advises." room temperature " described in embodiment refers to the temperature of carrying out the operation room tested, and is generally 25 DEG C.

Embodiment 1

The MCS-IRES-GFP fragment of amplification, specific as follows:

Design and synthesize 2 PCR primer, sequence is as follows:

5’-GGGGACAAGTTTGTACAAAAAAGCAGGCTGCGGCCGCTTCTAGACTCAGATCTCGAGCT-3’（SEQIDNO.1）;

5’–GGGGACCACTTTGTACAAGAAAGCTGGGTCTTACTTGTACAGCTCGTCCAT-3’(SEQIDNO.2)。

Getting pIRES-EGFP carrier (purchased from Clontech) is template, is primer amplification with above-mentioned 2 oligonucleotide chains, obtains the DNA fragmentation of MCS-IRES-GFP.Should namely containing multiple clone site NotI, XbaI, BglII from pIRES-EGFP carrier increases this fragment of getting off, XhoI, SacI, EcoRI, PstI, SalI, SacII, SmaI, BamHI.

1) volume of each component in PCR system

Component	Volume
		Ultrapure water	37.8μl
10XPCR damping fluid	5μl
		Magnesium ion (25mM)	3μl
dNTPs(25mM)	0.4μl
		Upstream primer (10 μMs)	1μl
Downstream primer (10 μMs)	1μl
		Taq enzyme (5U/ μ l)	0.3μl
DNA profiling	1.5μl
		Total system	50μl

PCR reaction conditions:

1.: 95 DEG C, 2 minutes;

2. (30 circulations): 95 DEG C, 30 seconds, 55 DEG C, 30 seconds, 72 DEG C, 60 seconds;

3.: 72 DEG C, 10 minutes;

2) PCR primer AxygenPCR cleaning agents box is purified.

Embodiment 2

By pDONR221 carrier (Invitrogen, Fig. 1) reconstruct into pDONR-MCS-IRES-GFP carrier, comprise the MCS-IRES-GFP fragment purification of above-mentioned amplification, carry out BP restructuring with pDONR221, the carrier called after pDONR-MCS-IRES-GFP(of acquisition is shown in Fig. 2).Specific as follows:

The BP recombination system (the BP recombination kit of Invitrogen company) of Invitrogen company is used object fragment to be recombinated on carrier pDONR221.According to the form below preparation BP recombining reaction system:

PCR primer	2μl
		PDONR221 plasmid	1μl
BP clonaseⅡenzyme mix	2μl
		TE damping fluid (pH8.0)	5μl

25 DEG C are reacted 1 hour.

Add the Proteinase K of 1 μ l, 37 DEG C are reacted 10 minutes.

Get the bacillus coli DH 5 alpha competent cell that 5 μ l recombining reaction liquid transform 50 μ l.

Screening positive clone sequence verification, retain the BP recombinant plasmid that sequence verification is correct.

Vector construction process schematic is shown in Fig. 4.

Embodiment 3

PDONR-MCS-IRES-GFP carrier embodiment 2 prepared and pAd/CMV/V5-DEST carrier (purchased from Invitrogen, Fig. 3) carry out LR restructuring, obtain final recombinant vectors pAd/MCS-IRES-GFP.Specific as follows:

The LR recombination system (the LR recombination kit of Invitrogen company) of Invitrogen company is used to carry out LR restructuring.According to the form below preparation LR recombining reaction system:

BP recombinant plasmid	1μl
		pAd CMV/V5-DEST	1μl
LR clonaseⅡenzyme mix	2μl
		TE damping fluid (pH8.0)	6μl

25 DEG C are reacted 1 hour.

Add the Proteinase K of 1 μ l, 37 DEG C are reacted 10 minutes.

Get the DH5 α competent cell that 5 μ l recombining reaction liquid transform 50 μ l.

Screening positive clone sequence verification, retain the LR recombinant plasmid that sequence verification is correct.

Vector construction process schematic is shown in Fig. 5.

Embodiment 4

Endonuclease reaction: PacI enzyme cuts carrier pAd/MCS-IRES-GFP, reaction system is 1 × enzyme cutting buffering liquid, 5-20 μ g recombinant vectors, 5-20UPacI enzyme, cumulative volume 20-100 μ l.

The recovery of digestion products: adopt conventional PCR cleaning agents box (purchased from Axygen), to specifications by digestion products according to 3 times of volumes with damping fluid, purification column is added to after mixing, 10000g1 minute centrifugal, add cleaning buffer solution 600 μ l, centrifugal 1 minute of twice, 10000g, 12000g centrifugal 1 minute removing raffinate, adds 30 μ l water elution DNA liquid again.The quantitative DNA concentration of ultraviolet spectrophotometer.

Or by the liquid of endonuclease reaction 65 DEG C of incubations 20 minutes, directly get required DNA and measure transfection 293A cell.

Embodiment 5

Adenovirus is packed:

1) get cell state good, be in the 293A cell of logarithmic phase, use 0.05% trysinization, after cell counting, according to every hole 4.5 × 10 ⁵individual cell, plants in 6 orifice plates, 37 DEG C, 5%CO ₂incubator in overnight incubation;

2) remove nutrient solution before transfection in second day, change 2ml fresh medium;

3) get plasmid that the aforementioned enzyme of 2 μ g cuts (be that the obtained enzyme of embodiment 4 cuts back to close product, or endonuclease reaction liquid) and add the Opti-MEM(of 250 μ l through 37 DEG C of preheatings purchased from Invitrogen) in, mixing;

4) 5 μ llipofectamine2000(are got purchased from Invitrogen) add in 250ulOpti-MEM, mixing, room temperature places 5min;

5) mix the lipofectamine2000 of plasmid solution and dilution after digested plasmid after purifying or deactivation gently, room temperature places 20 minutes;

6) 500 μ l mixtures are joined in cell hole, wave and culture plate, mixing.At 37 DEG C, after cultivating 5-6 hour in the incubator of the CO2 of 5%, change complete culture solution, continue to put in incubator and cultivate;

7) after transfection 48 hours, peptic cell was transferred in 10cm culture dish, adds 10ml perfect medium;

8) often within 2-3 days, change to fresh culture, observe and whether have pathology (CPE) to occur (the general 7-10 days occurred after transfection);

9) infection is allowed to continue to occur, until 80%CPE occurs (general appearance 10-13 days after transfection).Collecting cell and supernatant liquor are to the 15ml centrifuge tube of sterilizing.Multigelation 3 times, centrifugal 10 minutes of 3000g, collects supernatant, is stored in-70 DEG C of refrigerators, is adenopathy venom.After measured, after the carrier package virus adopting Column methods to obtain, titre is about 1E9pfu/ml, and the virus titer that the carrier package adopting heating method sex change and save purification step goes out is about 4E8pfu/ml(titer determination with reference to classical cell spot method, with reference to Invitrogen specification sheets).

The titre results of the virus using the method for other routines to pack is shown in Fig. 7.The phenol-chloroform method of purification (see Invitrogen product description) that contrast is classical, adopts the titre of column purification method virus preparation higher; The heating denaturalization that same contrast the present invention simplifies, still successfully can pack out virus, and titre change is little, but whole step compares conventional phenol-chloroform method of purification, saves time, avoids the use of toxic chemical, be conducive to environmental protection, also cost saving.

Embodiment 6

Using escherichia coli lacz gene as foreign gene, test carrier pDONR-MCS-IRES-GFP of the present invention, first LacZ PCR method is amplified, and be cloned into pDONR-MCS-IRES-GFP carrier, the LacZ carrier for template is pLenti6.3/V5/GW-LacZ(Invitrogen Products).Vector construction process schematic is shown in Fig. 6.

Concrete steps are as follows

1.PCR amplification foreign gene LacZ:

1) one couple of PCR primers amplification LacZ gene is designed,

Upstream primer LacZ-F(is containing XhoI site):

5’-TTATTCTCGAGACCATGATAGATCCCGTCGTTTTACA-3’；

Downstream primer LacZ-R(is containing EcoRI site):

5’-TTATTGAATTCTTAGTAGTTTTTTGACACCAGACCAACTG-3’。

2) PCR reaction conditions:

The volume of each component in PCR system:

Component	Volume
		Ultrapure water	37.8μl
10XPCR damping fluid	5μl
		Magnesium ion (25mM)	3μl
dNTPs(25mM)	0.4μl
		Upstream primer LacZ-F(10 μM)	1μl
Downstream primer LacZ-R(10 μM)	1μl
		Taq enzyme (5U/ μ l)	0.3μl
DNA profiling	1.5μl
		Total system	50μl

PCR response procedures:

1.: 95 DEG C, 2 minutes;

2. (30 circulations): 95 DEG C, 30 seconds, 55 DEG C, 30 seconds, 72 DEG C, 3 minutes;

3.: 72 DEG C, 10 minutes;

3) PCR primer AxygenPCR cleaning agents box is purified;

4) XhoI and EcoRI enzyme cuts this fragment, and the enzyme system of cutting is: 10 times of damping fluid 2 μ l, purified pcr product 2 μ g, XhoI and EcoRI Mei Ge 10 unit, cumulative volume 20 μ l;

5) XhoI and EcoRI enzyme cuts the carrier pDONR-MCS-IRES-GFP of this patent transformation, purifies equally with AxygenPCR cleaning agents box;

6) ligation: enzyme is cut PCR primer 0.2 μ g after purifying, enzyme cuts rear carrier 0.1 μ g, adds 10 × T4 ligase enzyme damping fluid 2 μ l, T4 ligase enzyme 1 μ l, cumulative volume 20 μ l, 16 DEG C 4 hours;

7) transformation of E. coli, chooses single bacterium colony, and extracting plasmid, send sequence verification, and the carrier choosing correct sequence carries out LR recombining reaction.

Embodiment 7

LR recombination to construct contains final adenovirus carrier and the virus packaging of LacZ gene.

1. pDONR-MCS-IRES-GFP carrier and the pAd/CMV/V5-DEST carrier (purchased from Invitrogen) of insertion LacZ gene embodiment 6 prepared carry out LR restructuring, and obtain final recombinant vectors pAd/LacZ-IRES-GFP, concrete steps are with embodiment 3.

2.PacI enzyme cuts pAd/LacZ-IRES-GFP carrier and purification process, and concrete steps are with embodiment 4.

3. adenovirus packaging: concrete steps are with embodiment 5.Adopt the virus titer of column purification method carrier package to be about 8.6E8pfu/ml, and the titre adopting easy thermally denature and directly pack is 4E8pfu/ml, contrasts classical phenol: the titre of chloroform method of purification is that 4.5E8pfu/ml(is shown in Fig. 8).The cell spot method that titer determination reference is classical, with reference to Invitrogen specification sheets.

Embodiment 8

Adenovirus infection object cell (object cell is Hela cell (purchased from Chinese Academy of Sciences's Shanghai cell bank):

1. object cell is at virus infection kind the day before yesterday 96 orifice plate, plants plate amount: 2.0 × 10 ⁴cells/well;

2. infecting the same day, changing to fresh configuration substratum in 96 orifice plates: 50 μ l/ holes, add adenopathy venom (embodiment 5,7 is prepared and obtained) with MOI=0-100 scope, mixing is placed on cell culture incubator;

3. virus adds rear 6 hours, changes to fresh substratum, 37 DEG C, 5%CO in 96 orifice plates ₂incubator in continue cultivate.Result is infected in observation in 48-96 hour, and as more than MOI=20, cell is by the positive rate more than 90% of virus infection, and the adenovirus vigor of reflection preparation is better, can be applied to the gene transfer of cell completely.

Should be understood that those skilled in the art can make various changes or modifications the present invention after having read foregoing of the present invention, these equivalent form of values fall within the application's appended claims limited range equally.

Claims (4)

1. a method for recombinant adenoviral vector packaging virus, comprises transfection 293A cell after recombinant adenoviral vector linearizing, it is characterized in that, comprising:

1) recombinant adenoviral vector PacI restriction enzyme multiple clone site being inserted exogenous genetic fragment carries out endonuclease reaction, and wherein said recombinant adenoviral vector improves for starting vector with pDONR221 carrier, inserts multiple clone site and IRES-GFP fragment, described multiple clone site is followed successively by: NotI, XbaI, BglII, XhoI, SacI, EcoRI, PstI, SalI, SacII, SmaI, BamHI;

2) by step 1) the endonuclease reaction liquid purifying of gained reclaim digestion products and be applied to transfection; Or by step 1) the endonuclease reaction liquid intensification deactivation of gained, then directly apply to transfection, the method for wherein said endonuclease reaction liquid purifying is column purification method.

2. the method for claim 1, is characterized in that, step 1) in, the consumption of described recombinant adenoviral vector is 0.01-1 μ g/ μ l, and the consumption of PacI enzyme is 0.01-1U/ μ l; Step 2) described in intensification deactivation temperature 65 DEG C, soaking time 20 minutes.

3. the method for claim 1, is characterized in that, step 1) described in adenovirus carrier prepared by the method that comprises the following steps and obtain:

1) getting pIRES-EGFP carrier is template, adopt following two primers to carry out pcr amplification, obtain MCS-IRES-GFP fragment, in described primer, article one, the nucleotide sequence of primer is as shown in SEQIDNO.1, and the nucleotide sequence of another primer is as shown in SEQIDNO.2;

2) by step 1) described in MCS-IRES-GFP fragment and carrier pDONR221 carry out BP restructuring, obtain carrier pDONR-MCS-IRES-GFP;

3) carrier pDONR-MCS-IRES-GFP and carrier pAd/CMV/V5-DEST is carried out LR restructuring, obtain final carrier pAd/MCS-IRES-GFP.

4. method as claimed in claim 3, is characterized in that, step 2) described in BP restructuring use the BP recombination system of Invitrogen to carry out BP restructuring; Step 3) described in LR restructuring use the LR recombination system of Invitrogen to carry out LR restructuring.