CN107384896A - A kind of enzymatic compositions for preparing rare ginsenoside and its application - Google Patents
A kind of enzymatic compositions for preparing rare ginsenoside and its application Download PDFInfo
- Publication number
- CN107384896A CN107384896A CN201710685211.7A CN201710685211A CN107384896A CN 107384896 A CN107384896 A CN 107384896A CN 201710685211 A CN201710685211 A CN 201710685211A CN 107384896 A CN107384896 A CN 107384896A
- Authority
- CN
- China
- Prior art keywords
- ginsenoside
- beta
- rare
- rare ginsenoside
- glucosidase
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
- C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
- C12N9/2405—Glucanases
- C12N9/2434—Glucanases acting on beta-1,4-glucosidic bonds
- C12N9/2445—Beta-glucosidase (3.2.1.21)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
- C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
- C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
- C12N9/2468—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1) acting on beta-galactose-glycoside bonds, e.g. carrageenases (3.2.1.83; 3.2.1.157); beta-agarase (3.2.1.81)
- C12N9/2471—Beta-galactosidase (3.2.1.23), i.e. exo-(1-->4)-beta-D-galactanase
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P33/00—Preparation of steroids
- C12P33/20—Preparation of steroids containing heterocyclic rings
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
- C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
- C12Y302/01021—Beta-glucosidase (3.2.1.21)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
- C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
- C12Y302/01023—Beta-galactosidase (3.2.1.23), i.e. exo-(1-->4)-beta-D-galactanase
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
- C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
- C12Y302/01037—Xylan 1,4-beta-xylosidase (3.2.1.37)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
- C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
- C12Y302/01055—Alpha-N-arabinofuranosidase (3.2.1.55)
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Medicinal Chemistry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Enzymes And Modification Thereof (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
A kind of enzymatic compositions for preparing rare ginsenoside and its application, the rare ginsenosides such as ginsenoside C K are prepared applied to conversion multicomponent ginsenoside.It is characterized in that a kind of Thermophilic Bacteria source can disposably cut off the β glucuroides of upper two glycosyls of ginsenoside parent nucleus 3, rare component C Y, C Mc and C Mx are obtained, its molar yield is above 96%.Another step, cut off arabopyranose, arabinofuranose and the xylose in respective 20 outsides of foregoing three kinds of products respectively again by 3 species specific glycoside hydrolases, obtain final product rare ginsenoside C K, molar yield is also above 98%.The invention provides a kind of new rare ginsenoside syntheti c route, and Efficient Conversion multicomponent ginsenoside Rb2, Rc and Rb3 it can obtain rare ginsenoside C K simultaneously.
Description
Technical field
The invention belongs to enzyme engineering, health products and biomedicine field, and in particular to a kind of rare ginsenoside for preparing
Enzymatic compositions and its application.
Background technology
Ginseng is the traditional rare traditional Chinese medicine in China, is all widely used in antifatigue and strengthen immunity for a long time
Etc., while it has the features such as bioactivity is extensive, pharmacological action uniqueness, is particularly its significant active anticancer, it is anti-ageing
Old activity, it is set to have become the focus of concern, but its complex chemical composition, cause obstacle for its further investigation.With
The development of modern medicine analytical technology, the principle active component of ginseng have been successfully parsed, wherein main component ginsenoside quilt
The main bioactive substance of ginseng is considered, further investigations have shown that ginsenoside list is planted in more than 180 in separated identification
In body, 5 kinds of a fairly large number of saponin(es of glycosyl (ginsenoside Rb1, Rb2, Rc, Re and Rg1) account for more than the 80% of total saposins, and medicine
More excellent rare ginsenoside (Rh1, Rh2, C-K, Rg2, the F1 and Rg3) content of reason activity is very low, at the same glycosyl quantity compared with
It is few.Meanwhile there are some researches show the anticancer property of ginsenoside is significantly increased with the reduction of glycosidic bond quantity, particularly
Ginseng saponin C-K and Rh2, the rare ginsenoside of other glycosyl negligible amounts also have more excellent pharmacological activity.
Rare ginsenoside C-K, which has, suppresses tumor cell proliferation, Adhesion, Invasion and transfer, promotes withering for tumour cell
Die, improve the physiological actions such as human body immune function, while rare ginsenoside C-Y, C-Mc and C-Mx equally have excellent medicine
Reason activity, there are the potentiality of exploitation patent medicine and health products.But rare saponin(e C-K contents in plant are very low, direct extraction process
Complexity, cost is too high, and rare ginsenoside C-Y, C-Mc and C-Mx can not even be extracted directly from ginseng and obtained.But ginseng
Saponin(e Rb2 and Rc are that several ginsenosides of content highest, ginsenoside Rb3 are in sanchi leaf ginsenoside in general ginsenoside
Content highest component.They have similar mother nucleus structure to rare ginsenoside C-Y, C-Mc and C-Mx, and difference is only that
The sugar side chains (Fig. 1) at both ends.If it can optionally cut off the sugar side chains and 20 outsides of Rb2, Rc and Rb3 on 3
Arabopyranose base and arabinofuranosidase glycosyl and xylosyl, it is possible to selectively obtain rare ginsenoside C-Y, C-
Mc, C-Mx and C-K.
At present, chemical method and biotransformation method can convert multicomponent ginsenoside production rare ginsenoside.Wherein
Biotransformation method has the features such as reaction condition is gentle, and specificity is good and gained great popularity.Comprehensive document patent both domestic and external, at present
The research of conversion ginsenoside multicomponent generation rare ginsenoside is concentrated mainly in the conversion of multicomponent ginsenoside Rb1,
Such as invent CN 103805581 and disclose a kind of beta -glycosidase mutant and be only capable of completely converting ginsenoside Rb1 production CK, production
Rate is only 0.24g/L/h；Invention CN 105296587 also discloses a kind of beta-glucosidase enzymatic conversion from Bifidobacterium
Ginsenoside Rb1 produces CK, and its conversion ratio is only 68%；In addition, there is small part patent to be related to multicomponent ginsenoside Rb1, Rb2
CK is converted into Rc but certain limitation in terms of practical application be present, is such as invented CN 105925654 and is disclosed one kind again
The method that synthase joint heteropoly acid conversion ginsenoside Rb1 produces CK, but its catalyst heteropoly acid used is with silicon, tungsten, iron
It is unfriendly to environment with the Determination of multiple metal elements such as zinc, and it is indefinite to be related to the deactivation prob of catalyst, compound enzyme component, source
The problems such as unstable so that its technological parameter is difficult to control completely.And although CN 104480127 is invented also to ginsenoside
Rb1, Rb2 and Rc have carried out converting and obtaining CK, but its reaction is more on fractional hydrolysis ginsenoside parent nucleus diverse location
Individual glycosyl, therefore a variety of intermediate products in its reaction product be present, this is that later separation purifying brings difficulty.Therefore, find
Energy is efficient, selective degradation ginsenoside multicomponent production rare ginsenoside CK glycoside hydrolase becomes research key,
The enzyme of simultaneous selection should have similar or approximate optimal reaction pH and temperature, and can guarantee that under the same conditions can be more high
Effect ground carries out Synergistic degradation.
The content of the invention
The technical problem of solution：The invention provides a kind of enzymatic compositions for preparing rare ginsenoside and its application.
Technical scheme：Prepare the enzymatic compositions of rare ginsenoside, by beta-glucosidase, beta galactosidase, I
Primary furanoside enzyme and xylobiase composition.
Above-mentioned beta-glucosidase is from the beta-glucosidases of Dictyoglomus thermophilum DSM 3960
Enzyme Dth3.
Above-mentioned beta galactosidase is from Thermotoga petrophila DSM13995 beta galactosidases
Tpegal, and Tpegal has α-arabopyranose glycosides enzymatic activity.
Above-mentioned α-arabinofuranosidase is from the α of Thermotoga thermarum DSM 5069-Arabic furan
Mutter glycosidase TthFase.
Above-mentioned xylobiase is from Thermotoga petrophila DSM13995 xylobiases TpeXyl.
Application of the above-mentioned enzymatic compositions in rare ginsenoside is prepared.
Above-mentioned application concretely comprises the following steps：Added respectively into the mixture of ginsenoside Rb2, Rc, Rb3 or three kinds of saponin(es
Beta-glucosidase, reacted under the conditions of pH 5.0,85 DEG C of temperature, obtain respectively corresponding rare ginsenoside C-Y, C-Mc,
C-Mx or the mixture of three；Correspondingly add beta galactosidase, α-arabinofuranose into each reaction system respectively again
Glycosides enzyme and xylobiase add three kinds of enzymes in the reaction system that three kinds of saponin(es mix jointly, in pH 5.0,85 DEG C of temperature
Under the conditions of react, obtain corresponding rare ginsenoside C-K.
Beneficial effect：1. first passage recombinase one-step conversion multicomponent ginsenoside of the present invention generates rare ginseng soap
Glycosides C-Y, C-Mc and C-Mx, because of its 3 disaccharide base of selective hydrolysis ginsenoside parent nucleus, and ginseng saponin C-K are not hydrolyzed 20
The glucosyl group of position inner side, reactionless accessory substance, and according to target product and substrate solubility significant difference, it is only necessary to change reaction
System temperature may be such that product largely separates out, and the molar yield of enzymatic conversion method is more than 96%.
2. the beta-glucosidase provided by the invention for being applied to hydrolysis 3 disaccharide bases of ginsenoside derives from
Dictyoglomus thermophilum DSM3960, the optimal reactive temperature of the enzyme is 85 DEG C, and temperature stability is preferable.
3. provided by the invention be applied to the three of hydrolysis ginsenoside C-Y, C-Mc and C-Mx generation rare ginsenoside C-K
Kind of glucosides enzyme specificity is strong, specifically can hydrolyze respectively hydrolysis ginsenoside C-Y, C-Mc and C-Mx 20 outsides I
Primary pyranose, arabinofuranosidase glycosyl and xylosyl, and the glucosyl group of its 20 inner sides, mole of enzymatic conversion method are not hydrolyzed
Conversion ratio is more than 98%.
4. beta-glucosidase provided by the invention, beta galactosidase, arabinofuranosidase and xylobiase
With similar optimal reaction pH and reaction temperature, pH and temperature need not be adjusted during final goal product C-K is obtained
Degree.
5. the invention provides a kind of method for efficiently, environmentally friendlyly preparing rare ginsenoside, the rare ginseng soap of preparation
Glycosides keeps original bioactivity completely.
Brief description of the drawings
Fig. 1 is multicomponent ginsenoside Rb2 of the present invention, Rc and Rb3 conversion schematic diagram；
Fig. 2 is beta-glucosidase Dth3 of the present invention optimal reactive temperature and is best suitable for reaction pH；
Fig. 3 is that ginsenoside Rb2, Rc and Rb3 of the present invention are converted into the anti-of rare ginsenoside C-Y, C-Mc and C-Mx
Answer course figure；
Fig. 4 is the HPLC figures that C-Y, C-Mc and C-Mx of the present invention are converted into C-K.
Embodiment
In order to make the purpose , technical scheme and advantage of the present invention be clearer, it is right below in conjunction with drawings and Examples
The present invention is described in further detail.It should be appreciated that the specific embodiments described herein are merely illustrative of the present invention,
It is not used to limit invention.
Below in conjunction with the accompanying drawings and specific embodiment is further described to the application principle of the present invention.
First, the present invention has screened the beta-glucosidase of a variety of separate sources difference families, includes and derives from
The GH1 families of Thermotoga thermarum DSM 5069, the GH3 families of Thermotoga thermarum DSM 5069,
The GH1 families of Thermotoga petrophila DSM 13995, the GH3 families of Thermotoga petrophila DSM 13995
Race, Aspergillus niger NL-1 GH3 families, Dictyoglomus thermophilum DSM3960 etc., and determine
Beta-glucosidase Dth3 from Dictyoglomus thermophilum DSM3960 has multicomponent ginsenoside
Rb2, Rc, Rb3 are converted into rare ginsenoside C-Y, C-Mc and C-Mx.
Secondly, 3 kinds of glycoside hydrolases are this method provide, further can turned rare ginsenoside C-Y, C-Mc and C-Mx
Metaplasia is into rare ginsenoside C-K, by it was found that β-half from Thermotoga petrophila DSM13995
Lactoside enzyme Tpegal, Thermotoga thermarum DSM 5069 arabinofuranosidase TthFase, and source
In Thermotoga petrophila DSM13995 xylobiase TpeXyl respectively to C-Y, C-Mc and C-Mx have compared with
High selectivity, hydrolysis 20 corresponding arabopyranose glycosides, arabinofuranosidase glucosides and xyloside that can be single-minded, final product
All it is rare ginsenoside C-K.
Embodiment 1：Extremely heat-resisting beta-glucosidase Dth3 recombinant bacteriums structure, expression and purifying
1.1 Dictyoglomus thermophilum culture
Dictyoglomus thermophilum are purchased from DSMZ DSMZs (www.dsmz.de) numbering
DSM3960.Its culture medium prescription is：10g/L soluble starches, 3g/L dusty yeasts, 5g/L tryptones, 5g/L meat extracts,
10g/L MESs, 10mg/L iron sulfate heptahydrates, 1mg/L resazurins, it is 7.2 to adjust pH, boils and rushes nitrogen, except deoxidation
After gas, culture medium loads the sterilizing of anaerobism bottle under anaerobic.It is inoculated with syringe according to 0.5% inoculum concentration, 85 DEG C of static trainings
24h is supported, collects cell.
The extraction of 1.2 genomic DNAs
(1) quiescent culture Dictyoglomus thermophilum 24h, take 30mL bacterium solutions 4, and 000g centrifugations 10min is received
Collect cell.
(2) thalline is resuspended with 9.5mL TE buffer solutions, adds the lauryl sodium sulfate of 0.5mL 10% (SDS) and 50 μ L eggs
White enzyme K (20mg/mL), is well mixed, 37 DEG C of insulation 1h.
(3) 1.8mL 5mol/L NaCl, 1.5mL cetyltriethylammonium bromides (CTAB)/NaCl is added, is mixed, 65
DEG C incubate 20min.
(4) isometric chloroform/isoamyl alcohol is added, is mixed, 6,000g centrifugation 10min.
(5) to prevent shearing force from causing genomic DNA to be broken, supernatant is transferred in another centrifuge tube with thick mouth suction pipe, added
Enter isometric phenol/chloroform/isoamyl alcohol to mix, 6,000g centrifugation 10min.
(6) in another centrifuge tube, 0.6 times of volume isopropanol is added, gently rocks to the thread DNA precipitations of white and clearly may be used
See.
(7) it is with suction pipe that DNA is wound on it, cleaned in 70% alcohol.
(8) DNA is scraped from suction pipe with sterile toothpick, be transferred in 1.5mL centrifuge tubes.
(9) air-dry at room temperature, add 500 μ L TE buffer solutions.
(10) 50 μ L are taken to detect DNA concentration with nucleic acid-protein detector.
1.3 recombinant plasmid pET-28a-Dth3 structure
Set according to the extremely heat-resisting beta-glucosidase genes (Dth_1949) of known Dictyoglomus thermophilum
Primer is counted, and removes terminator codon；Using the Dictyoglomus thermophilum of extraction genomic DNA as template, use
Primer (the P1 of synthesis:CTAGCTAGCGCACTTAAATACAGGTTTCCTGA；P2:
ATTTGCGGCCGCTTATTTAAGAAACTCTTTCTCCATCTC performing PCR amplification) is entered, the condition of amplification is 95 DEG C, 3min；30
It is secondary circulation (94 DEG C, 10s；58 DEG C, 30s；72 DEG C, 2min50s)；72 DEG C, 10min；Reaction stops, 4 DEG C of insulations.Returned by gel
Kit is received to purify pcr amplification product.Obtain the extremely heat-resisting beta-glucosidases of Dictyoglomus thermophilum
Gene.
The extremely heat-resisting beta-glucosidase genes of Dictyoglomus thermophilum and pET-28a of acquisition are used respectively
Nco I and Not I carry out double digestion, and rubber tapping recovery respectively, and 16 DEG C are connected overnight after concentration, and connection product is converted into large intestine bar
Bacterium Top10F ' competent cells, converted product are applied on LB (addition kanamycins to final concentration 50mg/L) solid medium
37 DEG C are incubated overnight, and are inoculated with several single bacteriums and fall in LB (addition kanamycins to final concentration 50mg/L) fluid nutrient medium and cultivate 8-
After 10 hours, thalline extraction plasmid is collected, digestion verification removes empty plasmid, recombinant plasmid is carried out into determining nucleic acid sequence, obtained
To correct recombinant expression carrier pET20b-bgl.
The 1.4 extremely heat-resisting beta-glucosidase Dth3 of restructuring expression and purifying
Recombinant plasmid pET-20b-bgl is converted into e. coli bl21 (DE3) Host Strains (Novagen), is containing Kana
LB flat boards (the LB culture mediums of (50 μ g/mL)：Tryptone 10g/L, yeast extract 5g/L, NaCl 5g/L, agar 15g/L)
It is upper to pass through 37 DEG C of overnight incubations, choose transformant 37 DEG C of (100 μ g/mL Amp) into 200mL LB culture mediums, 200rpm vibration trainings
Support to OD600For 0.6 when, add final concentration of 0.5mM isopropyl ss-D- Thiogalactopyranosides (IPTG) derivant, 30 DEG C
Fiber differentiation 8h, with high speed freezing centrifuge by nutrient solution at 4 DEG C, with 13,000rpm centrifuge 15min, collect thalline, go
Reset and add into sterilized water, ultrasonic disruption cell, subsequent 70 DEG C of heat treatment 30min, with high speed freezing centrifuge by nutrient solution at 4 DEG C
Under, 15min is centrifuged with 13,000rpm, supernatant is the pure enzyme for recombinating extremely heat-resisting beta-glucosidase.
Structure, expression and the purifying of the pole thermostable beta-galactosidase recombinant bacterium of embodiment 2
2.1 Thermotoga petrophila culture
It is DSM that Thermotoga petrophila, which are purchased from DSMZ DSMZs (www.dsmz.de) numbering,
13995.Its culture medium prescription is：10g/L soluble starches, 3g/L dusty yeasts, 5g/L tryptones, 5g/L meat extracts, 10g/L
MES, 10mg/L iron sulfate heptahydrates, 1mg/L resazurins, it is 7.2 to adjust pH, boils and rushes nitrogen, after removing oxygen,
Culture medium loads the sterilizing of anaerobism bottle under anaerobic.It is inoculated with syringe according to 0.5% inoculum concentration, 85 DEG C of static gas wave refrigerator 24h,
Collect cell.
The extraction of 2.2 genomic DNAs
(1) quiescent culture Thermotoga petrophila 24h, take 30mL bacterium solutions 4, and 000g centrifugations 10min collects thin
Born of the same parents.
(2) thalline is resuspended with 9.5mL TE buffer solutions, adds the lauryl sodium sulfate of 0.5mL 10% (SDS) and 50 μ L eggs
White enzyme K (20mg/mL), is well mixed, 37 DEG C of insulation 1h.
(3) 1.8mL 5mol/L NaCl, 1.5mL cetyltriethylammonium bromides (CTAB)/NaCl is added, is mixed, 65
DEG C incubate 20min.
(4) isometric chloroform/isoamyl alcohol is added, is mixed, 6,000g centrifugation 10min.
(5) to prevent shearing force from causing genomic DNA to be broken, supernatant is transferred in another centrifuge tube with thick mouth suction pipe, added
Enter isometric phenol/chloroform/isoamyl alcohol to mix, 6,000g centrifugation 10min.
(6) in another centrifuge tube, 0.6 times of volume isopropanol is added, gently rocks to the thread DNA precipitations of white and clearly may be used
See.
(7) it is with suction pipe that DNA is wound on it, cleaned in 70% alcohol.
(8) DNA is scraped from suction pipe with sterile toothpick, be transferred in 1.5mL centrifuge tubes.
(9) air-dry at room temperature, add 500 μ L TE buffer solutions.
(10) 50 μ L are taken to detect DNA concentration with nucleic acid-protein detector.
2.3 recombinant plasmid pET-20b-gal structure
Draw according to extremely heat-resisting beta-glucosidase gene (Tpe_1557) designs of known Thermotoga petrophila
Thing, and remove terminator codon；Using the Thermotoga petrophila of extraction genomic DNA as template, with drawing for synthesis
Thing (P3:CCCATATGCTCGGAGTCTGTTACTATCCT；P4:CGCTCGAGGTGTTCGTTTTCCCTCCATATC performing PCR) is entered
Amplification, the condition of amplification is 95 DEG C, 3min；30 circulations (94 DEG C, 30s；58 DEG C, 30s；72 DEG C, 1min30s)；72 DEG C,
10min；Reaction stops, 4 DEG C of insulations.Pcr amplification product is purified by gel reclaims kit.Obtain Thermotoga
The extremely heat-resisting beta-glucosidase genes of petrophila.
Obtain the extremely heat-resisting beta-glucosidase genes of Thermotoga petrophila and pET-20b respectively with Nde I and
Xho I carry out double digestion, and rubber tapping recovery respectively, and 16 DEG C are connected overnight after concentration, and connection product is converted into Escherichia coli
Top10F ' competent cells, converted product are applied on LB (addition ampicillin to final concentration 100mg/L) solid medium
37 DEG C are incubated overnight, and are inoculated with several single bacteriums and fall in LB (addition ampicillin to final concentration 100mg/L) fluid nutrient medium and train
After supporting 8-10 hours, thalline extraction plasmid is collected, digestion verification removes empty plasmid, and recombinant plasmid is carried out into nucleotide sequence survey
It is fixed, obtain correct recombinant expression carrier pET20b-gal.
The expression and purifying of 2.4 restructuring pole thermostable beta-galactosidases
Recombinant plasmid pET-20b-gal is converted into e. coli bl21 (DE3) Host Strains (Novagen), is containing Amp
LB flat boards (the LB culture mediums of (100 μ g/mL)：Tryptone 10g/L, yeast extract 5g/L, NaCl 5g/L, agar 15g/L)
It is upper to pass through 37 DEG C of overnight incubations, choose transformant 37 DEG C of (100 μ g/mL Amp) into 200mL LB culture mediums, 200rpm vibration trainings
Support to OD600For 0.6 when, add final concentration of 0.5mM isopropyl ss-D- Thiogalactopyranosides (IPTG) derivant, 30 DEG C
Fiber differentiation 8h, with high speed freezing centrifuge by nutrient solution at 4 DEG C, with 13,000rpm centrifuge 15min, collect thalline, go
Reset and add into sterilized water, ultrasonic disruption cell, subsequent 70 DEG C of heat treatment 30min, with high speed freezing centrifuge by nutrient solution at 4 DEG C
Under, 15min is centrifuged with 13,000rpm, supernatant is the pure enzyme for recombinating extremely heat-resisting beta galactose glycosides.
Embodiment 3：Structure, expression and the purifying of extremely heat-resisting arabinofuranosidase recombinant bacterium
3.1 Thermotoga thermarum DSM 5069 culture
Thermotoga thermarum DSM 5069 are purchased from DSMZ DSMZs (www.dsmz.de).Numbering
For：DSM 5069.Its culture medium prescription is：5g/L soluble starches, 1g/L dusty yeasts, 1.5g/L KH2PO4, 4.2g/L
Na2HPO4 x 12H2O, 3.4g/L NaCl, 1g/L MgSO4 x 7H2O, 0.76g/L EDTA, 1mL/L trace element, 0.5g/L
Na2S·9H2O, 0.5g/L Cysteine HCl, 1mg/L resazurins, it is 7.0 to adjust pH, boils and rushes nitrogen, after removing oxygen, training
Foster base loads the sterilizing of anaerobism bottle under anaerobic.Micro- (1000 ×) formula：FeCl32.0g/L；H3BO3 0.05g/
L；ZnCl20.05g/L；CuCl2·2H2O 0.03g/L；MnCl2·4H2O 0.05g/L；(NH4)2MoO40.05g/L；
AlKSO4·2H2O 0.05g/L.) be inoculated with syringe according to 0.5% inoculum concentration, 82 DEG C of static gas wave refrigerator 24h, collect cell.
The extraction of 3.2 genomic DNAs
(1) 24h of quiescent culture Thermotoga thermarum DSM 5069,30mL bacterium solutions 4,000g centrifugations are taken
10min collects cell.
(2) thalline is resuspended with 9.5mL TE buffer solutions, adds the lauryl sodium sulfate of 0.5mL 10% (SDS) and 50 μ L eggs
White enzyme K (20mg/mL), is well mixed, 37 DEG C of insulation 1h.
(3) 1.8mL 5mol/L NaCl, 1.5mL cetyltriethylammonium bromides (CTAB)/NaCl is added, is mixed, 65
DEG C incubate 20min.
(4) isometric chloroform/isoamyl alcohol is added, is mixed, 6,000g centrifugation 10min.
(5) to prevent shearing force from causing genomic DNA to be broken, supernatant is transferred in another centrifuge tube with thick mouth suction pipe, added
Enter isometric phenol/chloroform/isoamyl alcohol to mix, 6,000g centrifugation 10min.
(6) in another centrifuge tube, 0.6 times of volume isopropanol is added, gently rocks to the thread DNA precipitations of white and clearly may be used
See.
(7) it is with suction pipe that DNA is wound on it, cleaned in 70% alcohol.
(8) DNA is scraped from suction pipe with sterile toothpick, be transferred in 1.5mL centrifuge tubes.
(9) air-dry at room temperature, add 500 μ L TE buffer solutions.
(10) 50 μ L are taken to detect DNA concentration with nucleic acid-protein detector.
3.3 recombinant plasmid pET-28a-Arf structure
According to the extremely heat-resisting arabinofuranosidase gene (WP of known Thermotoga thermarum DSM 5069
013932416.1) primer is designed, and removes terminator codon；With the Thermotoga thermarum DSM's 5069 of extraction
Genomic DNA is template, with the primer (P5 of synthesis:ATGCCATGGCTTACGAAATCAGTGTGAATC；P6:
CCGCTCGAGTGATCTTTCTACTTCTATCAC performing PCR amplification) is entered, the condition of amplification is 94 DEG C, 3min；30 circulations (94
DEG C, 30s；58 DEG C, 30s；72 DEG C, 1min30s)；72 DEG C, 5min；Reaction stops, 4 DEG C of insulations.Pass through gel reclaims kit pair
Pcr amplification product is purified.Obtain the extremely heat-resisting arabinofuranosidase bases of Thermotoga thermarum DSM 5069
Cause.
Obtain the extremely heat-resisting arabinofuranosidase genes of Thermotoga thermarum DSM 5069 and pET-28a
Double digestion, and rubber tapping recovery respectively are carried out with Nco I and Xho I respectively, 16 DEG C are connected overnight after concentration, and connection product is converted
Escherichia coli Top10F ' competent cells, screening positive clone, carry out sequence analysis；Select sequence and correctly clone extraction matter
Grain, obtain the recombinant plasmid pET-28a-Arf containing extremely heat-resisting glycosidase genes.
The expression and purifying of the 3.4 extremely heat-resisting arabinofuranosidases of restructuring
Recombinant plasmid pET-28a-Arf is converted into e. coli bl21 (DE3) Host Strains (Novagen), is containing Kan
LB flat boards (the LB culture mediums of (50 μ g/mL)：Tryptone 10g/L, yeast extract 5g/L, NaCl 5g/L, agar 15g/L)
It is upper to pass through 37 DEG C of overnight incubations, choose transformant 37 DEG C of (50 μ g/mL Kan) into 200mL LB culture mediums, 200rpm vibration trainings
Support to OD600For 0.6 when, add final concentration of 0.01mM isopropyl ss-D- Thiogalactopyranosides (IPTG) derivant, 30 DEG C
Fiber differentiation 8h, with high speed freezing centrifuge by nutrient solution at 4 DEG C, with 13,000rpm centrifuge 15min, collect thalline, go
Reset and add into sterilized water, ultrasonic disruption cell, subsequent 70 DEG C of heat treatment 30min, with high speed freezing centrifuge by nutrient solution at 4 DEG C
Under, 15min is centrifuged with 13,000rpm, supernatant is the pure enzyme for recombinating extremely heat-resisting arabinofuranosidase.
Embodiment 4：Extremely heat-resisting xylobiase recombinant bacterium structure, expression and purifying
Draw according to extremely heat-resisting beta-glucosidase gene (Tpe_0848) designs of known Thermotoga petrophila
Thing, using the Thermotoga petrophila of extraction genomic DNA as template, with the primer (P7 of synthesis：
CATGCCATGGAACTGTACAGGGATCCTTCG；P8：CCGCTCGAGCTCCTCGCAGGCTTCCGTGAA performing PCR amplification) is entered,
The condition of amplification is 95 DEG C, 3min；30 circulations (94 DEG C, 30s；58 DEG C, 30s；72 DEG C, 1min30s)；72 DEG C, 10min；Instead
It should stop, 4 DEG C of insulations.Pcr amplification product is purified by gel reclaims kit.Obtain Thermotoga
The extremely heat-resisting beta-glucosidase genes of petrophila.
Obtain the extremely heat-resisting beta-glucosidase genes of Thermotoga petrophila and pET-20b respectively with Nde I and
Xho I carry out double digestion, and rubber tapping recovery respectively, and 16 DEG C are connected overnight after concentration, and connection product is converted into Escherichia coli
Top10F ' competent cells, converted product are applied to 37 on LB (addition kanamycins to final concentration 50mg/L) solid medium
DEG C it is incubated overnight, is inoculated with several single bacteriums and falls in LB (addition kanamycins to final concentration 50mg/L) fluid nutrient medium and cultivate 8-10
After hour, thalline extraction plasmid is collected, digestion verification removes empty plasmid, recombinant plasmid is carried out into determining nucleic acid sequence, obtained
Correct recombinant expression carrier pET28a-xyl.
Recombinant plasmid pET28a-xyl is converted into e. coli bl21 (DE3) Host Strains (Novagen), is containing kana
LB flat boards (the LB culture mediums of (50 μ g/mL)：Tryptone 10g/L, yeast extract 5g/L, NaCl 5g/L, agar 15g/L)
It is upper to pass through 37 DEG C of overnight incubations, choose transformant 37 DEG C of (100 μ g/mL Amp) into 200mL LB culture mediums, 200rpm vibration trainings
Support to OD600For 0.6 when, add final concentration of 0.5mM isopropyl ss-D- Thiogalactopyranosides (IPTG) derivant, 30 DEG C
Fiber differentiation 8h, with high speed freezing centrifuge by nutrient solution at 4 DEG C, with 13,000rpm centrifuge 15min, collect thalline, go
Reset and add into sterilized water, ultrasonic disruption cell, subsequent 70 DEG C of heat treatment 30min, with high speed freezing centrifuge by nutrient solution at 4 DEG C
Under, 15min is centrifuged with 13,000rpm, supernatant is the pure enzyme for recombinating extremely heat-resisting β-xyloside.
Embodiment 5:Recombinase Dth3 conversions ginsenoside Rb2, Rc and Rb3 generate the technique ginseng of corresponding rare ginsenoside
Number
5.1 enzyme activity determination
The μ L of reaction system 200, in 10 μ L 20mmol/L artificial substrates (pNPG, pNPArap, pNPArf and pNPX) plus
Enter 100 μ L 100mmol/L citrate-phosphate disodium hydrogen buffer solutions (pH 5.0) and appropriate water, be first incubated 2min at 90 DEG C,
Add enzyme liquid (being diluted to suitable multiple) the reaction 10min that 5 μ L correspond to respective substrate.Reaction is added immediately 600 μ after terminating
L 1M Na2CO3, its light absorption value is determined under 405nm with spectrophotometer.
One enzyme-activity unit (U) is defined as：In the case where enzyme is best suitable for reaction condition, hydrolysis 1mM substrates per minute discharge 1 μm of ol
Enzyme amount needed for p-nitrophenol.
Reference standard curve, calculate enzyme activity：
Enzyme activity (U/mL)=c × V1/(t×V2)×N
c：Content of p-nitrophenol (μm ol/mL) after the enzyme reaction calculated by p-nitrophenol normal equation；
V1：Reaction system cumulative volume (mL)；
t：The enzyme-to-substrate reaction time (min)；
V2：The volume (mL) of enzyme liquid during enzyme reaction；
N：Enzyme liquid extension rate.
The measure of 5.2 optimal reactive temperatures
In the range of 70-90 DEG C, every 5 DEG C, enzyme activity is determined respectively.Buffer as 50mmol/L citrate-phosphate disodium hydrogens
Buffer solution, pH 5.0, the optimal reactive temperature for finding two kinds of extremely heat-resisting glycosidases is 90 DEG C (Fig. 2).
5.3 optimal reaction pH measure
Under the conditions of different pH (3.5-7.0,50mmol/L citrate-phosphate disodium hydrogen buffer solution), 85 DEG C are surveyed respectively
Determine enzyme activity, the optimal reaction pH for finding two kinds of extremely heat-resisting glycosidases is 5.0 (Fig. 2).
The conversion situation of 5.4 restructuring enzymatic conversion multicomponent ginsenoside Rb2s, Rc and Rb3
The concentration of ginsenoside Rb2, Rc and Rb3 are 2mM (about 2.16g/L), and conversion condition is 85 DEG C, pH 5.0
50mmol/L citrate-phosphate disodium hydrogen buffer solutions, different time points is separately sampled, is detected by HPLC-ELSD.Point
Not Tian Jia beta-glucosidase it is dilute as that can be converted into ginsenoside Rb2, Rc and Rb3 in 60min after 0.64U/mL
There are ginsenoside C-Y, C-Mc and C-Mx, molar yield is all higher than as 96% (Fig. 3).
Embodiment 6：Recombinase Tpegal, TthFase, Tpexyl convert ginsenoside C-Y, C-Mc and C-Mx generation respectively
Rare ginsenoside C-K technological parameter
Ginsenoside C-Y, C-Mc and C-Mx concentration are 2mM (about 1.5g/L), and conversion condition is 85 DEG C, pH
5.050mmol/L citrate-phosphate disodium hydrogen buffer solutions, different time points is separately sampled, is examined by HPLC-ELSD
Survey.Beta galactosidase Tpegal to 10U/mL, addition α-arabinofuranosidase TthFase to 1.2U/ are being added respectively
After mL and addition xylobiase Tpexyl to 1U/mL, corresponding ginsenoside substrate can be converted into 60min rare
Ginseng saponin C-K, molar yield are all higher than as 98% (Fig. 4).
In summary, multicomponent ginsenoside is converted under appropriate conditions by one-step method the invention discloses a set of
Rb2, Rb3 and Rc can efficiently generate corresponding rare ginsenoside C-Y, C-Mc and C-Mx technique, and then add 3 kinds of sugar
The technique that glycosides enzyme further converts production Ginsenoside compound K.This method has novelty on process route, contrasts existing at present
Report it is common for one by one hydrolyze ginsenoside 3 two glycosyls of parent nucleus beta-glucosidase, have no with selectivity directly
The beta-glucosidase of 3 disaccharide bases on hydrolysis ginsenoside Rb2, Rb3 and Rc parent nucleus.The technology has advance, because its is right
Rb2, Rb3 and Rc hydrolysis are one-step method, without reaction intermediate, according to substrate and the significant difference of product solubility,
Change temperature is only needed to separate out substrate so that the separating-purifying in product later stage is more simple.Meanwhile present invention also offers
Three species specific glycoside hydrolases convert C-Y, C-Mc and C-Mx or cooperate with the mixture for converting this three to prepare C-K's respectively
Method.
SEQUENCE LISTING
<110>Nanjing Forestry University
<120>A kind of enzymatic compositions for preparing rare ginsenoside and its application
<130>
<160> 8
<170> PatentIn version 3.3
<210> 1
<211> 32
<212> DNA
<213>Artificial sequence
<400> 1
ctagctagcg cacttaaata caggtttcct ga 32
<210> 2
<211> 39
<212> DNA
<213>Artificial sequence
<400> 2
atttgcggcc gcttatttaa gaaactcttt ctccatctc 39
<210> 3
<211> 29
<212> DNA
<213>Artificial sequence
<400> 3
cccatatgct cggagtctgt tactatcct 29
<210> 4
<211> 30
<212> DNA
<213>Artificial sequence
<400> 4
cgctcgaggt gttcgttttc cctccatatc 30
<210> 5
<211> 30
<212> DNA
<213>Artificial sequence
<400> 5
atgccatggc ttacgaaatc agtgtgaatc 30
<210> 6
<211> 30
<212> DNA
<213>Artificial sequence
<400> 6
ccgctcgagt gatctttcta cttctatcac 30
<210> 7
<211> 30
<212> DNA
<213>Artificial sequence
<400> 7
catgccatgg aactgtacag ggatccttcg 30
<210> 8
<211> 30
<212> DNA
<213>Artificial sequence
<400> 8
ccgctcgagc tcctcgcagg cttccgtgaa 30
Claims (7)
1. prepare the enzymatic compositions of rare ginsenoside, it is characterised in that by beta-glucosidase, beta galactosidase, Arab
Furanoside enzyme and xylobiase composition.
2. the enzymatic compositions of rare ginsenoside are prepared according to claim 1, it is characterised in that the beta-glucosidase
For fromDictyoglomus thermophilumThe beta-glucosidase Dth3 of DSM 3960.
3. the enzymatic compositions of rare ginsenoside are prepared according to claim 1, it is characterised in that the beta galactosidase
For fromThermotoga petrophilaDSM13995 beta galactosidase Tpegal, and Tpegal have α-I
Primary pyranoside enzymatic activity.
4. the enzymatic compositions of rare ginsenoside are prepared according to claim 1, it is characterised in that the α-arabinofuranosidase
Glycosidase be fromThermotoga thermarum5069 α of DSM-arabinofuranosidase TthFase.
5. the enzymatic compositions of rare ginsenoside are prepared according to claim 1, it is characterised in that the xylobiase is
Derive fromThermotoga petrophilaDSM13995 xylobiases TpeXyl.
6. application of any enzymatic compositions of claim 1 ~ 5 in rare ginsenoside is prepared.
7. application according to claim 6, it is characterised in that step is：Respectively to ginsenoside Rb2, Rc, Rb3 or three kinds
Beta-glucosidase is added in the mixture of saponin(e, is reacted under the conditions of pH 5.0,85 DEG C of temperature, is obtained respectively corresponding rare
Ginsenoside C-Y, C-Mc, C-Mx or the mixture of three；Correspondingly add beta galactose glycosides into each reaction system respectively again
Enzyme, α-arabinofuranosidase and xylobiase add three kinds of enzymes in the reaction system that three kinds of saponin(es mix jointly,
Reacted under the conditions of pH 5.0,85 DEG C of temperature, obtain corresponding rare ginsenoside C-K.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710685211.7A CN107384896B (en) | 2017-08-11 | 2017-08-11 | Enzyme composition for preparing rare ginsenoside and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710685211.7A CN107384896B (en) | 2017-08-11 | 2017-08-11 | Enzyme composition for preparing rare ginsenoside and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107384896A true CN107384896A (en) | 2017-11-24 |
| CN107384896B CN107384896B (en) | 2020-07-31 |
Family
ID=60355418
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710685211.7A Active CN107384896B (en) | 2017-08-11 | 2017-08-11 | Enzyme composition for preparing rare ginsenoside and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107384896B (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108384769A (en) * | 2018-02-05 | 2018-08-10 | 南京林业大学 | A kind of high temperature resistant complex enzyme and its application |
| CN109061001A (en) * | 2018-09-14 | 2018-12-21 | 长沙都正生物科技有限责任公司 | The detection method of ginsenoside |
| CN111117988A (en) * | 2020-01-18 | 2020-05-08 | 南京林业大学 | Amino acid mutant of thermophilic xylosidase and application thereof |
| CN112481280A (en) * | 2020-12-10 | 2021-03-12 | 湖南工程学院 | Method for preparing rare ginsenoside CK by gene combination transformation and application |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1229086A (en) * | 1999-03-17 | 1999-09-22 | 金凤燮 | Method for preparing rare ginsengoside using enzymatic method to modify ginsenoside glycoside |
| CN105695553A (en) * | 2016-04-08 | 2016-06-22 | 南京林业大学 | Method using enzymatic method to prepare rare ginsenoside 20(S)-Rg3 |
-
2017
- 2017-08-11 CN CN201710685211.7A patent/CN107384896B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1229086A (en) * | 1999-03-17 | 1999-09-22 | 金凤燮 | Method for preparing rare ginsengoside using enzymatic method to modify ginsenoside glycoside |
| CN105695553A (en) * | 2016-04-08 | 2016-06-22 | 南京林业大学 | Method using enzymatic method to prepare rare ginsenoside 20(S)-Rg3 |
Non-Patent Citations (3)
| Title |
|---|
| KU，S.: "Finding and producing probiotic glycosylases for the biocatalysis of ginsenosides: a mini review", 《MOLECULES》 * |
| ROSSI M等: "Potential impact of probiotic consumption on the bioactivity of dietary phytochemicals", 《J AGRIC FOOD CHEM》 * |
| ZHENG-ZHENG ZOU等: "A new thermostable β-glucosidase mined from Dictyoglomus thermophilum: Properties and performance in octyl glucoside synthesis at high temperatures", 《BIORESOURCE TECHNOLOGY》 * |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108384769A (en) * | 2018-02-05 | 2018-08-10 | 南京林业大学 | A kind of high temperature resistant complex enzyme and its application |
| CN108384769B (en) * | 2018-02-05 | 2021-09-10 | 南京林业大学 | High-temperature-resistant complex enzyme and application thereof |
| CN109061001A (en) * | 2018-09-14 | 2018-12-21 | 长沙都正生物科技有限责任公司 | The detection method of ginsenoside |
| CN111117988A (en) * | 2020-01-18 | 2020-05-08 | 南京林业大学 | Amino acid mutant of thermophilic xylosidase and application thereof |
| CN111117988B (en) * | 2020-01-18 | 2022-10-14 | 南京林业大学 | Amino acid mutant of thermophilic xylosidase and application thereof |
| CN112481280A (en) * | 2020-12-10 | 2021-03-12 | 湖南工程学院 | Method for preparing rare ginsenoside CK by gene combination transformation and application |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107384896B (en) | 2020-07-31 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107384896A (en) | A kind of enzymatic compositions for preparing rare ginsenoside and its application | |
| CN106190937B (en) | A method of the building "-rock algae lactose of recombination bacillus coli biosynthesis 2 | |
| CN106995829A (en) | A kind of method that enzymatic conversion method barren wort total chromocor prepares epimedium aglucone | |
| CN104611313B (en) | A kind of β glucuroides and preparation method and application | |
| Mu et al. | Current studies on sucrose isomerase and biological isomaltulose production using sucrose isomerase | |
| Wang et al. | Bioconversion of ginsenosides Rb1, Rb2, Rc and Rd by novel β-glucosidase hydrolyzing outer 3-O glycoside from Sphingomonas sp. 2F2: cloning, expression, and enzyme characterization | |
| CN104762281B (en) | A kind of α rhamnosidases and its preparation method and application | |
| CN107641621A (en) | The method that a kind of glucosides enzymatic compositions and enzyme process prepare epimedium aglucone | |
| CN106190938B (en) | A kind of method of the recombination bacillus coli and biosynthesis 3 '-saliva lactose of building | |
| CN102492757B (en) | Method for improving taste quality of stevioside by using beta-cyclodextrin glucosyltransferase | |
| CN110066760B (en) | Recombinant escherichia coli for expressing alpha-L-rhamnosidase and application thereof | |
| Guo et al. | Enzymatic synthesis of 6′-sialyllactose, a dominant sialylated human milk oligosaccharide, by a novel exo-α-sialidase from Bacteroides fragilis NCTC9343 | |
| CN108467858A (en) | A kind of alpha-L-Rhamnosidase and its application | |
| CN105802897A (en) | D-psicose-3-epimerase producing strain and application thereof | |
| Mazzaferro et al. | Functional and biotechnological insights into diglycosidases | |
| CN106754595A (en) | One plant of recombinant bacterium and its application in catalysis content rebaudioside-A generation rebaudioside D | |
| CN104328098B (en) | A kind of beta-glucosidase and the preparation method and application thereof | |
| Xie et al. | Biochemical characterization of a novel hyperthermophilic α-l-rhamnosidase from Thermotoga petrophila and its application in production of icaritin from epimedin C with a thermostable β-glucosidase | |
| CN106119319B (en) | Recombinate method of the alpha-L-Rhamnosidase crude extract for being catalyzed directionally hydrolyzing flavonoid glycoside in micro passage reaction | |
| CN105695553A (en) | Method using enzymatic method to prepare rare ginsenoside 20(S)-Rg3 | |
| CN108384769A (en) | A kind of high temperature resistant complex enzyme and its application | |
| CN105695552A (en) | Method using enzymatic method to prepare rare ginsenoside Rh1 | |
| Zhou et al. | Discovery and characterization of a novel α-L-fucosidase from the marine-derived Flavobacterium algicola and its application in 2′-fucosyllactose production | |
| CN102888416B (en) | Beta-glycosidase gene for coding glycosyl hydrolase family and application thereof | |
| Karnišová Potocká et al. | Apiose-relevant glycosidases |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |