CN107384896B - Enzyme composition for preparing rare ginsenoside and application thereof - Google Patents

Abstract

The invention provides an enzyme composition for preparing rare ginsenoside and application thereof, which are applied to the preparation of rare ginsenoside such as ginsenoside C-K and the like by converting multicomponent ginsenoside and is characterized in that a thermophilic bacteria source can remove β -glucosidase of two glycosyl groups on 3 site of ginsenoside mother nucleus at one time to obtain rare components C-Y, C-Mc and C-Mx, the molar conversion rates of the rare components C-Y, C-Mc and C-Mx are higher than 96%, and in the next step, arabinopyranose, arabinofuranose and xylose outside 20 sites of the three products are respectively removed by 3 specific glycosidase to obtain the final product rare ginsenoside C-K, and the molar conversion rates of the rare ginsenoside C-K are also higher than 98%.

Description

Enzyme composition for preparing rare ginsenoside and application thereof

Technical Field

The invention belongs to the fields of enzyme engineering, health products and biological medicines, and particularly relates to an enzyme composition for preparing rare ginsenoside and application thereof.

Background

Ginseng is a traditional and rare Chinese medicinal material in China, is widely applied to aspects of fatigue resistance, immunity enhancement and the like for a long time, has the characteristics of wide biological activity, unique pharmacological action and the like, particularly has obvious anticancer activity and anti-aging activity, and becomes a focus of attention increasingly, but has complex chemical components and causes obstacles for the deep research of the ginseng. With the development of modern pharmaceutical analysis technology, the main active ingredients of ginseng have been successfully analyzed, wherein ginsenoside is regarded as the main bioactive substance of ginseng, further research shows that in more than 180 ginsenoside monomers which are separated and identified, 5 kinds of saponin with high glycosyl content (ginsenoside Rb1, Rb2, Rc, Re and Rg1) account for more than 80% of total saponin, and rare ginsenoside with more excellent pharmacological activity (Rh1, Rh2, C-K, Rg2, F1 and Rg3) has low content and low glycosyl content. Meanwhile, researches show that the anticancer property of the ginsenoside is obviously improved along with the reduction of the number of glycosidic bonds, and particularly, the ginsenoside C-K and Rh2 have more excellent pharmacological activity as well as other rare ginsenosides with less glycosyl groups.

The rare ginsenoside C-K has the physiological effects of inhibiting the proliferation, adhesion invasion and metastasis of tumor cells, promoting the apoptosis of the tumor cells, improving the immune function of an organism and the like, and meanwhile, the rare ginsenoside C-Y, C-Mc and C-Mx also have excellent pharmacological activity and have the potential of developing patent drugs and health care products. However, the content of rare saponins C-K in plants is very low, the direct extraction process is complex, the cost is too high, and the rare ginsenosides C-Y, C-Mc and C-Mx can not be extracted from ginseng directly. However, ginsenoside Rb2 and Rc are some ginsenosides with the highest content in total saponins of panax ginseng, and ginsenoside Rb3 is the component with the highest content in ginsenoside in panax notoginseng leaves. They have similar mother nucleus structures to the rare ginsenosides C-Y, C-Mc and C-Mx, and only differ in the glycosyl side chains at both ends (FIG. 1). If the Rb2, Rc and Rb3 can be selectively cut off the glycosyl side chain at the 3-position and the arabinopyranosyl, arabinofuranosyl and xylosyl outside the 20-position, the rare ginsenosides C-Y, C-Mc, C-Mx and C-K can be selectively obtained.

The invention discloses a method for producing CK by converting ginsenoside Rb1 by using β -glucosidase from bifidobacterium, wherein the conversion rate is only 68%, in addition, a small number of patents relate to the conversion of multi-component ginsenoside Rb1, Rb2 and Rc to generate CK but has certain limitations in practical application, in addition, a small number of patents relate to the conversion of multi-component ginsenoside Rb1, Rb2 and Rc to generate CK but also has certain limitations in practical application, in addition, CN 105925654 discloses a method for producing CK by combining ginsenoside Rb1 to convert ginsenoside Rb1, the invention also discloses a method for producing CK by using multi-component ginsenoside Rb 382, wherein catalysts used by the method have complex enzyme, tungsten, iron zinc and other multiple metal elements, the like, the method can convert multi-component ginsenoside Rb to produce rare ginsenoside Rb, and the like, and the optimum reaction temperature of the multi-component ginsenoside Rb1 is greatly improved, the invention also has the problems of difficulty in the purification of multi-component ginsenoside Rb3 and the degradation of multi-component ginsenoside Rb 4642, the optimum degradation of ginsenoside Rb is difficult to obtain the most effective and the most effective degradation of ginsenoside Rb 4642.

Disclosure of Invention

The technical problem to be solved is as follows: the invention provides an enzyme composition for preparing rare ginsenoside and application thereof.

The technical scheme is that the enzyme composition for preparing rare ginsenoside consists of β -glucosidase, β -galactosidase, arabinofuranosidase and β -xylosidase.

The β -glucosidase is derived from Dictyoglycous thermophilum DSM3960 β -glucosidase Dth 3.

The β -galactosidase is derived from Thermotoga petrophila DSM13995 β -galactosidase Tpegal, and has α -arabinopyranosidase activity.

The α -arabinofuranosidase is derived from Thermotoga thermomarum DSM 5069 α -arabinofuranosidase TthFase.

The β -xylosidase is derived from Thermotoga petrophila DSM13995 β -xylosidase TpeXyl.

The application of the enzyme composition in preparing rare ginsenoside.

The application comprises adding β -glucosidase into ginsenoside Rb2, Rc, Rb3 or mixture of three saponins, reacting at pH5.0 and 85 deg.C to obtain corresponding rare ginsenoside C-Y, C-Mc, C-Mx or mixture thereof, adding β -galactosidase, α -arabinofuranosidase and β -xylosidase into each reaction system, and reacting at pH5.0 and 85 deg.C to obtain corresponding rare ginsenoside C-K.

Has the advantages that: 1. the invention firstly converts the multi-component ginsenoside into rare ginsenosides C-Y, C-Mc and C-Mx by a recombinase one-step method, because the two glycosyl groups at the 3 th site of the ginsenoside parent nucleus are selectively hydrolyzed and the glucosyl group at the inner side of the 20 th site of the ginsenoside C-K is not hydrolyzed, no reaction by-product is generated, and the temperature of a reaction system is only required to be changed to greatly separate out the product according to the obvious difference between the target product and the substrate solubility, and the molar conversion rate of the enzymatic conversion is more than 96 percent.

2. The β -glucosidase applied to hydrolyzing the 3-glycosyl of ginsenoside comes from Dictyoglycous thermophilum DSM3960, the optimal reaction temperature of the enzyme is 85 ℃, and the temperature stability is good.

3. The three glycosidases provided by the invention are highly specific for hydrolyzing the ginsenosides C-Y, C-Mc and C-Mx to generate the rare ginsenosides C-K, can specifically and respectively hydrolyze the arabinopyranosyl, the arabinofuranosyl and the xylosyl at the outer side of the 20 th position of the ginsenosides C-Y, C-Mc and C-Mx, do not hydrolyze the glucosyl at the inner side of the 20 th position, and have the molar conversion rate of enzymatic conversion of more than 98%.

4. The β -glucosidase, β -galactosidase, arabinofuranosidase and β -xylosidase provided by the invention have similar optimal reaction pH and reaction temperature, and the pH and temperature do not need to be adjusted in the process of obtaining the final target product C-K.

5. The invention provides a method for efficiently and environmentally preparing rare ginsenoside, and the prepared rare ginsenoside completely keeps the original biological activity.

Drawings

FIG. 1 is a schematic representation of the conversion of multicomponent ginsenosides Rb2, Rc and Rb3 according to the invention;

FIG. 2 shows the optimum reaction temperature and optimum reaction pH for β -glucosidase Dth3 of the present invention;

FIG. 3 is a reaction process diagram of the conversion of the ginsenosides Rb2, Rc and Rb3 to rare ginsenosides C-Y, C-Mc and C-Mx according to the invention;

FIG. 4 is a graph of HP L C with C-Y, C-Mc and C-Mx converted to C-K in accordance with the present invention.

Detailed Description

In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention will be described in further detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not limiting.

The application of the principles of the present invention will be further described with reference to the accompanying drawings and specific embodiments.

First, the present invention screened various different families of β -glucosidases from different sources, including those derived from Thermotoga thermophilum DSM 5069 GH1 family, Thermotoga thermophilum DSM 5069 GH3 family, Thermotoga petrophila DSM13995 GH1 family, Thermotoga petrophila DSM13995 GH3 family, Aspergillus niger N L-1 GH3 family, Dictyogluctusthermophilum DSM3960 family, etc., and determined that β -glucosidase Dth3 derived from Dictyogluctusthermophilum DSM3960 has the ability to convert multicomponent ginsenosides Rb2, Rc, Rb3 into rare ginsenosides C-Y, C-Mc and C-Mx.

Secondly, the method provides 3 glycoside hydrolases, can further convert rare ginsenosides C-Y, C-Mc and C-Mx into rare ginsenosides C-K, finds that β -galactosidase Tpegal derived from Thermotoga petrophila DSM13995, arabinofuranosidase TthFase derived from Thermotoga thermarum DSM 5069 and β -xylosidase TpeXyl derived from Thermotoga petrophila DSM13995 have higher selectivity for C-Y, C-Mc and C-Mx respectively, can exclusively hydrolyze 20 corresponding arabinopyranoside, arabinofuranoside and xyloside, and the final product is rare ginsenosides C-K.

Example 1 construction, expression and purification of highly thermostable β -glucosidase Dth3 recombinant bacteria

1.1 cultivation of Dictyoglomyus thermophilum

Dictyoglomys thermophilum is purchased from DSMZ strain preservation center (www.dsmz.de) and is numbered as DSM 3960. the formula of the culture medium comprises 10 g/L of soluble starch, 3 g/L of yeast powder, 5 g/L of tryptone, 5 g/L of meat extract, 10 g/L2 of morpholine ethanesulfonic acid, 10 mg/L of iron sulfate heptahydrate, 1 mg/L of resazurin, the pH is adjusted to 7.2, nitrogen is flushed by boiling, after oxygen is removed, the culture medium is filled into an anaerobic bottle under anaerobic condition for sterilization, the injection is used for inoculation according to 0.5 percent of inoculation amount, the culture is carried out for 24 hours at 85 ℃, and cells are collected.

1.2 extraction of genomic DNA

(1) Performing static culture on Dictyoglomonus thermophilum for 24h, centrifuging 30m L bacterial liquid for 10min at 4,000g, and collecting cells.

(2) The cells were resuspended in 9.5m L TE buffer, 0.5m L10% Sodium Dodecyl Sulfate (SDS) and 50. mu. L proteinase K (20mg/m L) were added, mixed well, and incubated at 37 ℃ for 1 h.

(3) 1.8m L5 mol/L NaCl, 1.5m L hexadecyltriethylammonium bromide (CTAB)/NaCl were added, mixed well and incubated at 65 ℃ for 20 min.

(4) Adding equal volume of chloroform/isoamyl alcohol, mixing, and centrifuging at 6,000g for 10 min.

(5) To prevent genomic DNA fragmentation due to shear forces, the supernatant was transferred to another centrifuge tube using a wide-mouthed pipette, mixed with an equal volume of phenol/chloroform/isoamyl alcohol and centrifuged at 6,000g for 10 min.

(6) In another centrifuge tube, 0.6 volume of isopropanol was added and gently shaken until white filamentous DNA precipitate was clearly visible.

(7) The DNA was wound with a pipette and washed in 70% alcohol.

(8) The DNA was scraped from the pipette with a sterile toothpick and transferred to a 1.5m L centrifuge tube.

(9) Air-dried at room temperature, and dissolved in 500. mu. L TE buffer.

(10) 50 μ L was used to detect DNA concentration using a nucleic acid protein detector.

1.3 construction of the recombinant plasmid pET-28a-Dth3

The primers were designed according to the known dictyoglycous thermophilum hyperthermostable β -glucosidase gene (Dth-1949) and the stop codon was removed, and the extracted genomic DNA of dictyoglycous thermophilum was used as a template with the synthesized primer (P1: CTA)GCTAGCGCACTTAAATACAGGTTTCCTGA；P2:ATTTGCGGCCGCTTATTTAAGAAACTCTTTCTCCATCTC) is subjected to PCR amplification under the conditions of 95 ℃ for 3min, 30 cycles (94 ℃, 10 s; 58 ℃, 30 s; 72 ℃, 2min50s), 72 ℃ for 10min, reaction is stopped, heat preservation is carried out at 4 ℃, a PCR amplification product is purified by a gel recovery kit, and the Dictyoglycous thermophilum hyperthermostable β -glucosidase gene is obtained.

The obtained Dictyoglycous thermophilum hyperthermophilum β -glucosidase gene and pET-28a are subjected to double enzyme digestion by using Nco I and Not I respectively, the Nco I and Not I are subjected to gel cutting and recovery respectively, the mixture is connected at 16 ℃ overnight after concentration, a connection product is transformed into escherichia coli Top 10F' competent cells, a transformation product is coated on L B (kanamycin is added to 50 mg/L) solid culture medium and cultured at 37 ℃ overnight, a plurality of single colonies are inoculated into L B (kanamycin is added to 50 mg/L) liquid culture medium and cultured for 8-10 hours, thallus extraction plasmids are collected, no-load plasmids are removed through enzyme digestion verification, and the recombinant plasmids are subjected to nucleic acid sequence determination to obtain the correct recombinant expression vector pET 20B-bgl.

1.4 expression and purification of recombinant hyperthermostable β -glucosidase Dth3

The recombinant plasmid pET-20B-bgl was transformed into E.coli B L21 (DE3) host bacteria (Novagen), cultured overnight at 37 ℃ on L0B plates (L B medium: tryptone 10 g/L, yeast extract 5 g/L5 g/L, agar 15 g/L) containing Kana (50. mu.g/m L), and transformants were picked up in L B medium (100. mu.g/m L Amp) of 200m L (100. mu.g/m L Amp) at 37 ℃ and cultured with shaking at 200rpm until OD was reached₆₀₀Adding isopropyl β -D-thiogalactopyranoside (IPTG) inducer with final concentration of 0.5mM at 0.6 deg.C, performing induction culture at 30 deg.C for 8 hr, and centrifuging the culture solution in high-speed refrigerated centrifugeCentrifuging at 13,000rpm for 15min at 4 deg.C, collecting thallus, removing supernatant, adding sterile water, ultrasonic breaking cells, heat treating at 70 deg.C for 30min, centrifuging the culture solution at 13,000rpm for 15min at 4 deg.C with high speed refrigerated centrifuge, and collecting supernatant as pure enzyme of recombinant thermostable β -glucosidase.

Example 2 construction, expression and purification of highly thermostable β -galactosidase recombinant bacteria

2.1 culture of Thermotoga petrophila

Thermotoga petrophila is purchased from DSMZ culture Collection (www.dsmz.de) and is numbered as DSM 13995. the formula of the culture medium comprises 10 g/L of soluble starch, 3 g/L of yeast powder, 5 g/L of tryptone, 5 g/L of meat extract, 10 g/L2 of morpholine ethanesulfonic acid, 10 mg/L of iron sulfate heptahydrate, 1 mg/L of resazurin, the pH is adjusted to 7.2, nitrogen is flushed by boiling, after oxygen is removed, the culture medium is filled into an anaerobic bottle for sterilization under anaerobic conditions, the culture medium is inoculated by an injector according to 0.5 percent inoculation, the culture medium is statically cultured for 24 hours at 85 ℃, and cells are collected.

2.2 extraction of genomic DNA

(1) The Thermotoga petrophila is cultured for 24h in a standing way, and 30m L bacterial liquid is taken, 4,000g is centrifuged for 10min, and cells are collected.

(2) The cells were resuspended in 9.5m L TE buffer, 0.5m L10% Sodium Dodecyl Sulfate (SDS) and 50. mu. L proteinase K (20mg/m L) were added, mixed well, and incubated at 37 ℃ for 1 h.

(3) 1.8m L5 mol/L NaCl, 1.5m L hexadecyltriethylammonium bromide (CTAB)/NaCl were added, mixed well and incubated at 65 ℃ for 20 min.

(4) Adding equal volume of chloroform/isoamyl alcohol, mixing, and centrifuging at 6,000g for 10 min.

(5) To prevent genomic DNA fragmentation due to shear forces, the supernatant was transferred to another centrifuge tube using a wide-mouthed pipette, mixed with an equal volume of phenol/chloroform/isoamyl alcohol and centrifuged at 6,000g for 10 min.

(6) In another centrifuge tube, 0.6 volume of isopropanol was added and gently shaken until white filamentous DNA precipitate was clearly visible.

(7) The DNA was wound with a pipette and washed in 70% alcohol.

(8) The DNA was scraped from the pipette with a sterile toothpick and transferred to a 1.5m L centrifuge tube.

(9) Air-dried at room temperature, and dissolved in 500. mu. L TE buffer.

(10) 50 μ L was used to detect DNA concentration using a nucleic acid protein detector.

2.3 construction of recombinant plasmid pET-20b-gal

Primers were designed according to the known Thermotoga petriphilippine β -glucosidase gene (Tpe _1557) and stop codons were removed, and the extracted genomic DNA of the Thermotoga petriila was used as a template with synthetic primers (P3: CC 1557)CATATGCTCGGAGTCTGTTACTATCCT；P4:CGCTCGAGGTGTTCGTTTTCCCTCCATATC) is carried out by PCR amplification under the conditions of 95 ℃ for 3min, 30 cycles (94 ℃, 30 s; 58 ℃, 30 s; 72 ℃, 1min30s), 72 ℃ for 10min, reaction is stopped, heat preservation is carried out at 4 ℃, a PCR amplification product is purified by a gel recovery kit, and the Thermotogaptoprophilum heat-resistant β -glucosidase gene is obtained.

Obtaining Thermotoga petrophila hyperthermostable β -glucosidase gene and pET-20B, performing double enzyme digestion by Nde I and Xho I respectively, tapping and recovering the gel respectively, concentrating the gel, connecting the gel at 16 ℃ overnight, transforming the connection product into escherichia coli Top 10F' competent cells, coating the transformation product on L B (adding ampicillin to the final concentration of 100 mg/L) solid culture medium to perform overnight culture at 37 ℃, inoculating a plurality of single colonies to L B (adding ampicillin to the final concentration of 100 mg/L) liquid culture medium to perform culture for 8-10 hours, collecting thalli to extract plasmids, verifying enzyme digestion to remove idle plasmids, and performing nucleic acid sequence determination on the recombinant plasmids to obtain the correct recombinant expression vector pET 20B-gal.

2.4 expression and purification of recombinant hyperthermostable β -galactosidase

The recombinant plasmid pET-20B-gal was transformed into E.coli B L21 (DE3) host bacteria (Novagen), cultured overnight at 37 ℃ on L0B plates (L B medium: tryptone 10 g/L, yeast extract 5 g/L5 g/L, agar 15 g/L) containing Amp (100. mu.g/m L), and transformants were picked up in L B medium (100. mu.g/m L Amp) of 200m L (100. mu.g/m L Amp) and cultured with shaking at 200rpm until OD 37 ℃ reaches OD 200rpm₆₀₀Adding isopropyl β -D-thiogalactopyranoside (IPTG) inducer with final concentration of 0.5mM at 0.6 deg.C, performing induction culture at 30 deg.C for 8 hr, and centrifuging with high-speed refrigerated centrifugeCentrifuging the culture solution at 4 deg.C at 13,000rpm for 15min, collecting thallus, removing supernatant, adding sterile water, ultrasonic breaking cells, heat treating at 70 deg.C for 30min, centrifuging the culture solution at 4 deg.C at 13,000rpm for 15min with high-speed refrigerated centrifuge, and collecting supernatant as pure enzyme of recombinant thermostable β -galactoside.

Example 3: construction, expression and purification of heat-resistant arabinofuranosidase recombinant bacteria

3.1 culture of Thermotoga thermomarum DSM 5069

Thermotoga thermomarum DSM 5069 is available from DSMZ strain collection center (www.dsmz.de) with DSM 5069, and its culture medium formula comprises 5 g/L soluble starch, 1 g/L yeast powder, and 1.5 g/L KH₂PO₄，4.2g/LNa₂HPO₄x 12H₂O，3.4g/L NaCl，1g/L MgSO₄x 7H₂O, 0.76 g/L EDTA, 1m L/L microelement, 0.5 g/L Na₂S·9H₂O, 0.5 g/L Cysteine HCl, 1 mg/L resazurin, adjusting pH to 7.0, boiling with nitrogen, removing oxygen, placing the culture medium in anaerobic bottle under anaerobic condition for sterilization, and trace elements (1000 ×) formula of FeCl₃2.0g/L；H₃BO₃0.05g/L；ZnCl₂0.05g/L；CuCl₂·2H₂O 0.03g/L；MnCl₂·4H₂O 0.05g/L；(NH₄)₂MoO₄0.05g/L；AlKSO₄·2H₂O0.05 g/L.) was inoculated with 0.5% inoculum size using a syringe, and the cells were collected by static culture at 82 ℃ for 24 hours.

3.2 extraction of genomic DNA

(1) Performing static culture on Thermotoga thermomarum DSM 506924 h, centrifuging 4,000g of 30m L bacterial liquid for 10min, and collecting cells.

(2) The cells were resuspended in 9.5m L TE buffer, 0.5m L10% Sodium Dodecyl Sulfate (SDS) and 50. mu. L proteinase K (20mg/m L) were added, mixed well, and incubated at 37 ℃ for 1 h.

(3) 1.8m L5 mol/L NaCl, 1.5m L hexadecyltriethylammonium bromide (CTAB)/NaCl were added, mixed well and incubated at 65 ℃ for 20 min.

(4) Adding equal volume of chloroform/isoamyl alcohol, mixing, and centrifuging at 6,000g for 10 min.

(5) To prevent genomic DNA fragmentation due to shear forces, the supernatant was transferred to another centrifuge tube using a wide-mouthed pipette, mixed with an equal volume of phenol/chloroform/isoamyl alcohol and centrifuged at 6,000g for 10 min.

(6) In another centrifuge tube, 0.6 volume of isopropanol was added and gently shaken until white filamentous DNA precipitate was clearly visible.

(7) The DNA was wound with a pipette and washed in 70% alcohol.

(8) The DNA was scraped from the pipette with a sterile toothpick and transferred to a 1.5m L centrifuge tube.

(9) Air-dried at room temperature, and dissolved in 500. mu. L TE buffer.

(10) 50 μ L was used to detect DNA concentration using a nucleic acid protein detector.

3.3 construction of recombinant plasmid pET-28a-Arf

Primers were designed according to the known Thermotoga thermomarum DSM 5069 hyperthermostable arabinofuranosidase gene (WP013932416.1) and stop codons were removed; using the extracted genomic DNA of Thermotoga thermomarum DSM 5069 as a template, a synthetic primer (P5: ATG)CCATGGCTTACGAAATCAGTGTGAATC；P6:CCGCTCGAGTGATCTTTCTACTTCTATCAC) performing PCR amplification under the condition of 94 ℃ for 3 min; 30 cycles (94 ℃, 30 s; 58 ℃, 30 s; 72 ℃, 1min30 s); 72 ℃ for 5 min; the reaction was stopped and the temperature was maintained at 4 ℃. And purifying the PCR amplification product by using a gel recovery kit. The Thermotoga thermomarum DSM 5069 thermostable arabinofuranosidase gene was obtained.

Obtaining Thermotoga thermomarum DSM 5069 heat-resistant arabinofuranosidase gene and pET-28a, respectively carrying out double enzyme digestion by using Nco I and Xho I, respectively tapping and recovering glue, concentrating, connecting overnight at 16 ℃, transforming the connecting product into escherichia coli Top 10F' competent cells, screening positive clones, and carrying out sequence analysis; selecting the clone with correct sequence to extract plasmid, and obtaining the recombinant plasmid pET-28a-Arf containing the heat-resistant glycosidase gene.

3.4 expression and purification of recombinant highly thermostable arabinofuranosidase

The recombinant plasmid pET-28a-Arf was transformed into E.coli B L21 (DE3) host strain (Novagen) containing Kan (50. mu.l)g/m L) (L B medium: tryptone 10 g/L, yeast extract 5 g/L g/L, agar 15 g/L) was incubated at 37 ℃ overnight, transformants were picked up in 200m L L B medium (50. mu.g/m L Kan) at 37 ℃ and cultured with shaking at 200rpm to OD₆₀₀When the concentration is 0.6, adding an isopropyl β -D-thiogalactopyranoside (IPTG) inducer with the final concentration of 0.01mM, carrying out induction culture at 30 ℃ for 8h, centrifuging the culture solution at 4 ℃ for 15min at 13,000rpm by using a high-speed refrigerated centrifuge, collecting thalli, removing supernatant, adding sterile water, carrying out ultrasonic cell disruption, carrying out heat treatment at 70 ℃ for 30min, centrifuging the culture solution at 13,000rpm for 15min at 4 ℃ by using the high-speed refrigerated centrifuge, and obtaining the supernatant which is the pure enzyme of the recombinant thermostable arabinofuranosidase.

Example 4 construction, expression and purification of highly thermostable β -xylosidase recombinant bacteria

The primers were designed according to the known Thermotoga petriilia hyperthermostable β -glucosidase gene (Tpe _0848), using the extracted genomic DNA of Thermotoga petriilia as a template and a synthetic primer (P7: CATG)CCATGGAACTGTACAGGGATCCTTCG；P8：CCGCTCGAGCTCCTCGCAGGCTTCCGTGAA) is carried out by PCR amplification under the conditions of 95 ℃ for 3min, 30 cycles (94 ℃, 30 s; 58 ℃, 30 s; 72 ℃, 1min30s), 72 ℃ for 10min, reaction is stopped, heat preservation is carried out at 4 ℃, a PCR amplification product is purified by a gel recovery kit, and the Thermotogaptoprophilum heat-resistant β -glucosidase gene is obtained.

The obtained Thermotoga petrophila hyperthermostable β -glucosidase gene and pET-20B are subjected to double digestion by Nde I and Xho I respectively, and are subjected to gel cutting recovery respectively, the obtained products are concentrated and then are connected at 16 ℃ overnight, the connection products are transformed into escherichia coli Top 10F' competent cells, the transformation products are spread on L B (kanamycin is added to 50 mg/L) solid culture medium for overnight culture at 37 ℃, a plurality of single colonies are inoculated into L B (kanamycin is added to 50 mg/L) liquid culture medium for culture for 8-10 hours, bacteria extraction plasmids are collected, no-load plasmids are removed through enzyme digestion verification, and the recombinant plasmids are subjected to nucleic acid sequence determination to obtain the correct recombinant expression vector pET28 a-xyl.

The recombinant plasmid pET28a-xyl is transformed into a host bacterium (Novagen) of Escherichia coli B L21 (DE3) containingL B plates (L B medium: tryptone 10 g/L, yeast extract 5 g/L5 g/L, agar 15 g/L) of kana (50. mu.g/m L) were cultured overnight at 37 ℃ and transformants were picked up in L B medium (100. mu.g/m L Amp) of 200m L and cultured at 37 ℃ with shaking at 200rpm to OD₆₀₀When the concentration is 0.6, adding an isopropyl β -D-thiogalactopyranoside (IPTG) inducer with the final concentration of 0.5mM, carrying out induction culture at 30 ℃ for 8h, centrifuging the culture solution at 4 ℃ for 15min at 13,000rpm by using a high-speed refrigerated centrifuge, collecting thalli, removing supernatant, adding sterile water, carrying out ultrasonic cell disruption, carrying out heat treatment at 70 ℃ for 30min, centrifuging the culture solution at 13,000rpm for 15min at 4 ℃ by using the high-speed refrigerated centrifuge, and obtaining the supernatant which is the pure enzyme of the recombinant extremely heat-resistant β -xyloside.

Example 5 Process parameters for producing corresponding rare ginsenosides by converting ginsenoside Rb2, ginsenoside Rc and ginsenoside Rb3 with recombinase Dth3

5.1 enzyme Activity measurement

The reaction system 200 mu L, 10 mu L20 mmol/L artificial substrates (pNPG, pNPArap, pNParf and pNPX) are added with 100 mu L100 mmol/L citric acid-disodium hydrogen phosphate buffer solution (pH 5.0) and a proper amount of water, the mixture is incubated at 90 ℃ for 2min, then enzyme solutions (diluted to proper times) of 5 mu L corresponding to the respective substrates are added for reaction for 10min, and 600 mu L1M Na is added immediately after the reaction is finished₂CO₃The absorbance was measured at 405nm using a spectrophotometer.

One enzyme activity unit (U) is defined as: the amount of enzyme required to hydrolyze 1mM substrate per minute to release 1. mu. mol of p-nitrophenol under the conditions most suitable for the enzyme reaction.

Enzyme activity was calculated against the standard curve:

enzyme activity (U/m L) ═ c × V₁/(t×V₂)×N

c, calculating the p-nitrophenol content (mu mol/m L) after the enzyme reaction by using a p-nitrophenol standard equation;

V₁the total volume of the reaction system (m L);

t: enzyme and substrate reaction time (min);

V₂volume of enzyme solution (m L) at the time of enzyme reaction;

n: and (5) diluting the enzyme solution by multiple times.

5.2 determination of optimum reaction temperature

The enzyme activity was measured at intervals of 5 ℃ in the range of 70-90 ℃ separately at 50 mmol/L citric acid-disodium hydrogen phosphate buffer, pH5.0, and the optimum reaction temperature for the two very thermostable glycosidases was found to be 90 ℃ (FIG. 2).

5.3 determination of optimum reaction pH

The enzyme activities were measured at 85 ℃ under different pH conditions (3.5-7.0, 50 mmol/L citric acid-disodium hydrogen phosphate buffer), and the optimum reaction pH was found to be 5.0 for the two thermostable glycosidases (FIG. 2).

5.4 transformation of multicomponent ginsenosides Rb2, Rc and Rb3 by recombinant enzymes

Ginsenoside Rb2, Rc and Rb3 all had a concentration of 2mM (about 2.16 g/L), conversion conditions were 85 deg.C, pH5.050 mmol/L citric acid-disodium hydrogen phosphate buffer, samples were taken at different time points and tested by HP L C-E L SD, and ginsenoside Rb2, Rc and Rb3 could be converted to rare ginsenosides C-Y, C-Mc and C-Mx within 60min by adding β -glucosidase to 0.64U/m L, respectively, with molar yields of greater than 96% (FIG. 3).

Example 6: process parameters for generating rare ginsenoside C-K by converting ginsenoside C-Y, C-Mc and C-Mx by recombinases Tpegal, TthFase and Tpexyl respectively

The concentrations of ginsenosides C-Y, C-Mc and C-Mx were both 2mM (about 1.5 g/L), the conversion conditions were 85 ℃ and pH 5.050mmol/L citric acid-disodium hydrogen phosphate buffer, samples were taken at different time points and detected by HP L C-E L SD, after adding β -galactosidase Tpegal to 10U/m L, α -arabinofuranosidase TthFase to 1.2U/m L and β -xylosidase Tpexyl to 1U/m L, respectively, the corresponding ginsenoside substrates could be converted to rare ginsenosides C-K within 60min, with molar yields of greater than 98% (FIG. 4).

In conclusion, the invention discloses a process for efficiently generating corresponding rare ginsenosides C-Y, C-Mc and C-Mx by converting multi-component ginsenosides Rb2, Rb3 and Rc through a one-step method under appropriate conditions, and further adding 3 glycosidases for further conversion to produce ginsenoside CK, wherein the process has novelty in a process route, compared with the commonly known β -glucosidase for hydrolyzing two glycosyl groups at 3 site of a ginsenoside mother nucleus one by one at present, β -glucosidase for selectively and directly hydrolyzing ginsenoside Rb2, Rb3 and 3-disaccharide group at 3 site of the mother nucleus is not seen.

SEQUENCE LISTING

<110> Nanjing university of forestry

<120> an enzyme composition for preparing rare ginsenoside and its application

<130>

<160>8

<170>PatentIn version 3.3

<210>1

<211>32

<212>DNA

<213> Artificial sequence

<400>1

ctagctagcg cacttaaata caggtttcct ga 32

<210>2

<211>39

<212>DNA

<213> Artificial sequence

<400>2

atttgcggcc gcttatttaa gaaactcttt ctccatctc 39

<210>3

<211>29

<212>DNA

<213> Artificial sequence

<400>3

cccatatgct cggagtctgt tactatcct 29

<210>4

<211>30

<212>DNA

<213> Artificial sequence

<400>4

cgctcgaggt gttcgttttc cctccatatc 30

<210>5

<211>30

<212>DNA

<213> Artificial sequence

<400>5

atgccatggc ttacgaaatc agtgtgaatc 30

<210>6

<211>30

<212>DNA

<213> Artificial sequence

<400>6

ccgctcgagt gatctttcta cttctatcac 30

<210>7

<211>30

<212>DNA

<213> Artificial sequence

<400>7

catgccatgg aactgtacag ggatccttcg 30

<210>8

<211>30

<212>DNA

<213> Artificial sequence

<400>8

ccgctcgagc tcctcgcagg cttccgtgaa 30

Claims (1)

1. A method for preparing rare ginsenoside C-K with enzyme composition is characterized by taking ginsenoside Rb2, Rc and Rb3 with concentration of 2mM, converting at 85 deg.C and pH5.050 mmol/L citric acid-disodium hydrogen phosphate buffer, detecting with HP L C-E L SD, adding L2-glucosidase Dth3 to 0.64U/m L, converting ginsenoside Rb2, Rc and Rb3 into rare ginsenoside C-Y, C-Mc and C-Mx within 60min, taking ginsenoside C-Y, C-Mx with concentration of 2mM, converting at 85 deg.C, pH5.050 mmol/L citric acid-disodium hydrogen phosphate buffer, detecting with HP L C-E L SD, adding β -galactosidase Tpegal to 10U/m L, adding L-alafuranosidase to Ttfaee to 1.2U/m and adding corresponding ginsenoside Tspy 639/K substrate to 599U 599K 599;

the enzyme composition consists of β -glucosidase, β -galactosidase, arabinofuranosidase and β -xylosidase, wherein the β -glucosidase is derived fromDictyoglomus thermophilumDSM3960 β -glucosidase Dth3, which comprises the following steps:Dictyoglomus thermophilumthe product is purchased from DSMZ strain collection center with the number of DSM 3960;

the culture medium comprises 10 g/L soluble starch, 3 g/L yeast powder, 5 g/L tryptone, 5 g/L meat extract, 10 g/L2-morpholine ethanesulfonic acid, 10 mg/L heptahydrate ferric sulfate, 1 mg/L resazurin, pH adjusted to 7.2, boiling for flushing nitrogen, removing oxygen, placing the culture medium into an anaerobic bottle under anaerobic condition for sterilization, inoculating with 0.5% inoculation amount by using an injector, statically culturing at 85 ℃ for 24h, collecting cells, and statically culturing for 24hDictyoglomus thermophilum24h, collecting cells by centrifuging 4,000g of 30m L bacterial solution for 10min, re-suspending the bacteria with 9.5m L TE buffer solution, adding 0.5m L% sodium dodecyl sulfate and 50 mu L mg/m L proteinase K, mixing uniformly, keeping the temperature at 37 ℃ for 1h, adding 1.8m L mol/L NaCl and 1.5m L hexadecyl triethyl ammonium bromide/NaCl, mixing uniformly, incubating at 65 ℃ for 20min, adding equal volume of chloroform/isoamyl alcohol, mixing uniformly, centrifuging 6,000g for 10min, transferring the supernatant into another centrifuge tube with a coarse mouth pipette to prevent shearing force from causing genome DNA breakage, adding equal volume of phenol/chloroform/isoamyl alcohol to mix uniformly, centrifuging for 10min at 6000g, adding 0.6 times volume of isopropanol into another centrifuge tube, shaking slightly until white filamentous DNA precipitate is clear, winding the DNA onto the centrifuge tube with a pipette, washing with 70% alcohol, scraping the DNA from the pipette with a sterile toothpick, transferring the DNA into a 4931.5 m 2 centrifuge tube, adding dry ethanol, dissolving the buffer solution at room temperature, dissolving the DNA in L mu TE buffer solution, detecting the concentration of 50 mu protein with 50 mu wind, and detecting the concentration of the DNA with TE buffer solutionDictyoglomus thermophilumHighly heat-resistant β -grapeDesigning a primer by using a glycosidase gene Dth-1949, and removing a stop codon; to extractDictyoglomus thermophilumThe genomic DNA of (1) was used as a template, and a synthetic primer P1: CTA was used GCTAGC GCACTTAAATACAGGTTTCCTGA; P2: ATTT GCGGCCGC TTATTTAAGAAACTCTTTCTCCATCTC performing PCR amplification at 95 deg.C for 3 min; 30 times of circulation, wherein the flow of each circulation is 94 ℃ for 10 s; at 58 ℃ for 30 s; 72 ℃, 2min50 s; 72 ℃ for 10 min; stopping the reaction, and keeping the temperature at 4 ℃; purifying PCR amplification products by a gel recovery kit; to obtainDictyoglomus thermophilumHighly thermostable β -glucosidase gene obtainedDictyoglomus thermophilumHeat resistant β -glucosidase gene and pET-28a are double digested with Nco I and Not I separately, and cut separately to recover glue, concentrated and connected at 16 deg.c overnight, the connected product is transformed into colibacillus Top 10F' competent cell, the transformed product is spread onto L B solid culture medium with kanamycin added to the final concentration of 50 mg/L and cultured at 37 deg.c overnight, several single colonies are inoculated into L B liquid culture medium with kanamycin added to the final concentration of 50 mg/L to culture for 8-10 hr, thallus extracting plasmid is collected, no-load plasmid is eliminated through enzyme digestion verification, the recombinant plasmid is determined in nucleic acid sequence to obtain correct recombinant expression vector pET20B-bgl, the expression and purification of heat resistant recombinant glucosidase Dth3, the recombinant plasmid pET-20B-bgl is transformed into colibacillus B L DE 63321 DE3 host strain, the yeast extract is cultured on L B plate containing 50 ug/m L Kana transformant at 37 deg.C, the yeast extract is cultured at 356 g/19 g, the yeast extract is cultured on agar medium at 35 rpm, the agar medium is inoculated at L g/3615 g, the agar medium is inoculated into agar 16 g/3615 g, the yeast extract of agar 16 g/L g₆₀₀When the concentration is 0.6, adding an isopropyl β -D-thiogalactopyranoside inducer with the final concentration of 0.5mM, carrying out induction culture at 30 ℃ for 8h, centrifuging the culture solution at 13000rpm for 15min by using a high-speed refrigerated centrifuge, collecting thalli, removing supernatant, adding sterile water, carrying out ultrasonic cell disruption, carrying out heat treatment at 70 ℃ for 30min, centrifuging the culture solution at 13000rpm for 15min by using the high-speed refrigerated centrifuge at 4 ℃, and obtaining the supernatant which is the pure enzyme of the recombinant thermostable β -glucosidase;

the β -galactosidase is derived fromThermotoga petrophilaDSM13995 β -galactosidase Tpegal, wherein Tpegal has α -arabinopyranosidase activity, and the preparation method comprises:Thermotoga petrophilathe culture medium is purchased from DSMZ strain collection center and is numbered DSM13995, and the formula of the culture medium comprises 10 g/L soluble starch, 3 g/L yeast powder, 5 g/L tryptone, 5 g/L meat extract, 10 g/L2-morpholine ethanesulfonic acid, 10 mg/L heptahydrate ferric sulfate, 1 mg/L resazurin, adjusting pH to 7.2, boiling and flushing nitrogen, removing oxygen, placing the culture medium into an anaerobic bottle for sterilization under anaerobic condition, inoculating by using an injector according to 0.5 percent of inoculation amount, performing static culture at 85 ℃ for 24 hours, collecting cells, and performing static cultureThermotoga petrophila24h, collecting cells by centrifuging 4,000g of 30m L bacterial solution for 10min, re-suspending the bacteria with 9.5m L TE buffer solution, adding 0.5m L% sodium dodecyl sulfate and 50 mu L mg/m L proteinase K, mixing uniformly, keeping the temperature at 37 ℃ for 1h, adding 1.8m L mol/L NaCl and 1.5m L hexadecyl triethyl ammonium bromide/NaCl, mixing uniformly, incubating at 65 ℃ for 20min, adding equal volume of chloroform/isoamyl alcohol, mixing uniformly, centrifuging 6,000g for 10min, transferring the supernatant into another centrifuge tube with a coarse mouth pipette to prevent shearing force from causing genome DNA breakage, adding equal volume of phenol/chloroform/isoamyl alcohol to mix uniformly, centrifuging for 10min at 6000g, adding 0.6 times volume of isopropanol into another centrifuge tube, shaking slightly until white filamentous DNA precipitate is clear, winding the DNA onto the centrifuge tube with a pipette, washing with 70% alcohol, scraping the DNA from the pipette with a sterile toothpick, transferring the DNA into a 4931.5 m 2 centrifuge tube, adding dry ethanol, dissolving the buffer solution at room temperature, dissolving the DNA in L mu TE buffer solution, detecting the concentration of 50 mu protein with 50 mu wind, and detecting the concentration of the DNA with TE buffer solutionThermotoga petrophilaDesigning primer of heat-resistant β -glucosidase gene Tpe-1557, removing stop codon, extractingThermotoga petrophilaThe genomic DNA of (1) was used as a template with the synthesized primer P3: CC CATATG CTCGGAGTCTGTTACTATCCT ;P4: CG CTCGAG GTGTTCGTTTTCCCTCCATATC performing PCR amplification at 95 deg.C for 3 min; 30 times of circulation, wherein the flow of each circulation is 94 ℃ for 30 s; at 58 ℃ for 30 s; 72 deg.C, 1min30 s; 72 ℃ for 10 min; stopping the reaction, and keeping the temperature at 4 ℃; purifying the PCR amplification product by a gel recovery kit to obtainThermotoga petrophilaHighly thermostable β -glucosidase gene obtainedThermotoga petrophilaThe heat-resistant β -glucosidase gene and pET-20B are double digested with Nde I and Xho I separately, and cut separately to recover, concentrated and connected at 16 deg.c overnight, the connected product is transformed into competent colibacillus Top 10F' cell, the transformed product is spread onto L B solid culture medium with final concentration of 100 mg/L for overnight culture at 37 deg.c, inoculated with several single bacteria and dropped into 852B liquid culture medium with final concentration of 100 mg/L for 8-10 hr, thallus extracting plasmid is collected, no-load plasmid is eliminated through enzyme digestion verification, the recombinant plasmid is nucleotide sequence determined to obtain correct recombinant expression vector pET20B-gal, the recombinant plasmid pET-20B-gal is transformed into colibacillus B96321 DE3 host bacteria, the transformant is cultured on L B plate with 100 ug/m L Amp at 6337 deg.c, the transformant is cultured on tryptone peptone 10 g/L, yeast extract 10 g/L g/5 g, and 200 g/24 g/200 rpm, and cultured on agar medium 200 mg/L rpm, and shaken on 638B plate at 638 rpm₆₀₀When the concentration is 0.6, adding an isopropyl β -D-thiogalactopyranoside inducer with the final concentration of 0.5mM, carrying out induction culture at 30 ℃ for 8h, centrifuging the culture solution at 13000rpm for 15min by using a high-speed refrigerated centrifuge, collecting thalli, removing supernatant, adding sterile water, carrying out ultrasonic cell disruption, carrying out heat treatment at 70 ℃ for 30min, centrifuging the culture solution at 13000rpm for 15min at 4 ℃ by using the high-speed refrigerated centrifuge, and obtaining the supernatant which is the pure enzyme of the recombinant hyperthermostable β -galactoside, wherein the α -arabinofuranosidase is derived from pure enzyme of the recombinant hyperthermostable β -galactosideThermotoga thermarumDSM 5069 α -arabinofuranosidase TthFase, which comprises the following steps:Thermotoga thermarumDSM 5069 is purchased from DSMZ culture Collection under No. DSM 5069, and its culture medium comprises 5 g/L soluble starch, 1 g/L yeast powder, and 1.5 g/L KH₂PO₄，4.2 g/L Na₂HPO₄x 12H₂O，3.4 g/LNaCl，1 g/L MgSO₄x 7H₂O, 0.76 g/L EDTA, 1m L/L microelement, 0.5 g/L Na₂S·9H₂O, 0.5 g/L Cysteine HCl, 1 mg/L resazurin, adjusting pH to 7.0, boiling with nitrogen, removing oxygen, placing the culture medium in anaerobic bottle under anaerobic condition for sterilization, and adding 1000 × trace elementsThe method comprises the following steps: FeCl₃2.0 g/L；H₃BO₃0.05 g/L；ZnCl₂0.05g/L；CuCl₂·2H₂O 0.03 g/L；MnCl₂·4H₂O 0.05g/L；(NH₄)₂MoO₄0.05g/L；AlKSO₄·2H₂O0.05g/L, inoculating with 0.5% of the inoculum size, static culturing at 82 deg.C for 24 hr, collecting cells, and static culturingThermotoga thermarumDSM 506924 h, collecting 30m L bacteria solution 4000 g, centrifuging for 10min, resuspending the bacteria with 9.5m L TE buffer solution, adding 0.5m L% sodium dodecyl sulfate and 50 μ L mg/m L proteinase K, mixing well, keeping the temperature at 37 ℃ for 1h, adding 1.8m L mol/L NaCl and 1.5m L hexadecyl triethyl ammonium bromide/NaCl, mixing well, incubating at 65 ℃ for 20min, adding equal volume of chloroform/isoamyl alcohol, mixing well, centrifuging for 10min at 6000g, transferring the supernatant into another centrifuge tube with a large mouth pipette to prevent shearing force from causing genome DNA breakage, adding equal volume of phenol/chloroform/isoamyl alcohol, mixing well, centrifuging for 10min at 6000g, adding 0.6 times volume of isopropanol into another centrifuge tube, shaking slightly until white filamentous DNA precipitate is clear, winding DNA on the centrifuge tube with a pipette, washing with 70% ethanol, scraping DNA from the pipette with an aseptic toothpick, transferring into the centrifuge tube with 1.5m L, drying with air, adding TE buffer solution at room temperature, dissolving the DNA with 586 μm, detecting the concentration of protein with TE 25 μ 25, and detecting the concentration of protein with TE 25 μThermotoga thermarumDSM 5069 heat-resistant arabinofuranosidase gene WP013932416.1 primer design, and remove stop codon; using the extracted genomic DNA of Thermotoga thermomarum DSM 5069 as template and synthetic primer P5: ATG CCATGG CTTACGAAATCAGTGTGAATC；P6:CCG CTCGAG TGATCTTTCTACTTCTATCAC performing PCR amplification at 94 deg.C for 3 min; 30 times of circulation, wherein the flow of each circulation is 94 ℃ for 30 s; at 58 ℃ for 30 s; 72 deg.C, 1min30 s; 72 ℃ for 5 min; stopping the reaction, and keeping the temperature at 4 ℃; purifying the PCR amplification product by a gel recovery kit to obtainThermotoga thermarumDSM 5069 highly thermostable arabinofuranosidase gene; to obtainThermotoga thermarumDSM 5069 heat-resistant arabinofuranosidase gene and pET-28a were double-digested with Nco I and Xho I, respectively, and cleavedRecovering glue, concentrating, connecting at 16 deg.C overnight, transforming the connection product into competent cells of Escherichia coli Top 10F', screening positive clones, analyzing the sequence, selecting the correct sequence of clones to extract plasmids to obtain recombinant plasmid pET-28a-Arf containing thermostable glycosidase gene, transforming the recombinant plasmid pET-28a-Arf into Escherichia coli B L21 DE3 host bacteria, culturing at 37 deg.C overnight on L0B plate containing Kan50 μ g/m L, wherein the L B plate is prepared from tryptone 10 g/L, yeast extract 5 g/L5 g/L, agar 15 g/L, selecting transformant to L B culture medium of 200m L50 μ g/m L Kan, culturing at 37 deg.C and 200rpm until OD is OD₆₀₀When the concentration is 0.6, adding an isopropyl β -D-thiogalactopyranoside inducer with the final concentration of 0.01mM, carrying out induction culture at 30 ℃ for 8h, centrifuging the culture solution at 13000rpm for 15min by using a high-speed refrigerated centrifuge, collecting thalli, removing supernatant, adding sterile water, carrying out ultrasonic cell disruption, carrying out heat treatment at 70 ℃ for 30min, centrifuging the culture solution at 13000rpm for 15min by using the high-speed refrigerated centrifuge at 4 ℃, and obtaining the supernatant which is the pure enzyme of the recombinant heat-resistant arabinofuranosidase;

the β -xylosidase is derived fromThermotoga petrophilaDSM13995 β -xylosidase TpeXyl, obtainable according to the known methodThermotoga petrophilaHighly thermostable β -glucosidase gene Tpe _0848 primer designed to extractThermotoga petrophilaUsing the genomic DNA of (a) as a template, with the synthetic primer P7: CATG (computer-aided tool TG) CCATGG AACTGTACAGGGATCCTTCG；P8：CCG CTCGAG CTCCTCGCAGGCTTCCGTGAA performing PCR amplification at 95 deg.C for 3 min; 30 times of circulation, wherein the flow of each circulation is 94 ℃ for 30 s; at 58 ℃ for 30 s; 72 deg.C, 1min30 s; 72 ℃ for 10 min; stopping the reaction, and keeping the temperature at 4 ℃; purifying the PCR amplification product by a gel recovery kit to obtainThermotoga petrophilaHighly thermostable β -glucosidase gene obtainedThermotoga petrophilaThe thermostable β -glucosidase gene and pET-20B were double-digested with Nde I and Xho I, respectively, and the gel was recovered, concentrated and ligated overnight at 16 ℃, the ligation product was transformed into E.coli Top 10F' competent cells, and the transformation product was spread on L B solid medium with kanamycin to a final concentration of 50 mg/LCulturing at 37 deg.C overnight, inoculating several single colonies to L B liquid culture medium with kanamycin to final concentration of 50 mg/L, culturing for 8-10 hr, collecting thallus to extract plasmid, enzyme digestion to remove unloaded plasmid, determining nucleic acid sequence of recombinant plasmid to obtain correct recombinant expression vector pET28a-xyl, transforming Escherichia coli B L021 DE3 host bacterium into recombinant plasmid pET28a-xyl, culturing at 37 deg.C overnight on L2B plate containing 50 μ g/m L1 kana, said L B plate has the formula of tryptone 10 g/L, yeast extract 5 g/L5 g/L, agar 15 g/L, selecting transformant to L B culture medium of 200m L100 μ g/m L Amp, culturing at 37 deg.C and 200rpm until OD is OD₆₀₀When the concentration is 0.6, adding an isopropyl β -D-thiogalactopyranoside inducer with the final concentration of 0.5mM, carrying out induction culture at 30 ℃ for 8h, centrifuging the culture solution at 13000rpm for 15min by using a high-speed refrigerated centrifuge, collecting thalli, removing supernatant, adding sterile water, carrying out ultrasonic cell disruption, carrying out heat treatment at 70 ℃ for 30min, centrifuging the culture solution at 13000rpm for 15min by using the high-speed refrigerated centrifuge at 4 ℃, and obtaining the supernatant which is the pure enzyme of the recombinant thermostable β -xyloside.

Images