CN103160483B - Beta-glucosidase, as well as expression gene and application thereof - Google Patents
Beta-glucosidase, as well as expression gene and application thereof Download PDFInfo
- Publication number
- CN103160483B CN103160483B CN201310125106.XA CN201310125106A CN103160483B CN 103160483 B CN103160483 B CN 103160483B CN 201310125106 A CN201310125106 A CN 201310125106A CN 103160483 B CN103160483 B CN 103160483B
- Authority
- CN
- China
- Prior art keywords
- beta
- glucosidase
- seq
- expression vector
- oligosaccharides
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P19/00—Preparation of compounds containing saccharide radicals
- C12P19/14—Preparation of compounds containing saccharide radicals produced by the action of a carbohydrase (EC 3.2.x), e.g. by alpha-amylase, e.g. by cellulase, hemicellulase
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
- C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
- C12N9/2405—Glucanases
- C12N9/2434—Glucanases acting on beta-1,4-glucosidic bonds
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
- C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
- C12N9/2405—Glucanases
- C12N9/2434—Glucanases acting on beta-1,4-glucosidic bonds
- C12N9/2445—Beta-glucosidase (3.2.1.21)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P19/00—Preparation of compounds containing saccharide radicals
- C12P19/04—Polysaccharides, i.e. compounds containing more than five saccharide radicals attached to each other by glycosidic bonds
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Medicinal Chemistry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Enzymes And Modification Thereof (AREA)
Abstract
The invention relates to beta-glucosidase, as well as an expression gene and an application thereof. The amino acid sequence of the beta-glucosidase is as shown in SEQ ID NO. 1; and the nucleotide sequence of the expression gene of the beta-glucosidase is shown in SEQ ID NO. 2. The beta-glucosidase disclosed by the invention is utilized for producing oligosaccharides; compared with the existing beta-glucosidase, the reaction speed is obviously accelerated, and the optimal enzyme activity temperature of the beta-glucosidase is closest to the normal temperature; in the actual industrial production, the beta-glucosidase is conductive to reducing the production energy consumption; and furthermore, the expression level of the beta-glucosidase disclosed by the invention in a recombinant strain is high, the purification process is simple, and the large-scale industrial production is easy to realize.
Description
Technical field
The present invention relates to a kind of beta-glucosidase and expressing gene and application, particularly a kind of beta-glucosidase and expressing gene thereof and utilize this enzyme to produce the method for oligosaccharides, belonging to biotechnology and technical field of biochemical industry.
Background technology
Oligosaccharides is a kind of oligose be made up of 2-10 monose, its value that has a very wide range of applications.As being widely used in the fields such as food, healthcare products, beverage, medicine, fodder additives at present.All there is large-scale production on the ground such as the U.S., Japan, Europe, and the development and application of China's oligose arises from the mid-90, and development was swift and violent in recent years.Common oligosaccharides comprises malto-oligosaccharide glucose (α-Isosorbide-5-Nitrae glycosidic link combines), gentiobiose glucose (β-1,6 glycosidic links combine), oligose wood sugar (β-Isosorbide-5-Nitrae glycosidic link combines) etc.The technological method of current manufacture gentiobiose mainly comprises following two kinds: 1, extract from natural matter, but this method extraction yield is low, expensive, cannot meet suitability for industrialized production.2, Production by Enzymes gentiobiose, but Production by Enzymes gentiobiose also exists enzymic activity inefficiency, the inconvenient factor of the high grade of enzyme productive expense at present.
Current Production by Enzymes oligosaccharides is using monose as substrate, utilizes Glycosylase to produce oligosaccharides.As Chinese patent literature CN101492661A(application number 200910029055.4) disclose a kind of clone of beta-glucosidase gene, expression and the preparation for gentian oligose, this invention synthesizes beta-glucosidase gene (BGL) SEQID NO:1 by aspergillus niger WX-07 total serum IgE reverse transcription, the CDNA of BGL with plasmid PPIC9K for expression vector, with pichia spp (P.PASTORIS) for expressive host, realize the solubility expression of BGL gene outside born of the same parents; CDNA total length 2523 Nucleotide of BGL, 841 amino acid of encoding, the BGL/PPIC9K of structure transforms P.PASTORIS KM71 and can express BGL enzyme.BGL enzyme has transglycosylation, glucose can be turned glucosides and generate gentian oligose.But enzyme disclosed in the document produces oligosaccharides overlong time used, and efficiency of pcr product is too low, cannot meet production requirement.
Summary of the invention
The present invention is directed to the deficiencies in the prior art, the High-efficient Production of a kind of beta-glucosidase and expressing gene thereof is provided and utilizes this enzyme to produce the method for oligosaccharides.
Summary of the invention
The present invention, by carrying out relevant transformation to the beta-glucosidase produced in Li's Trichoderma strains, finds the output increased of the effect product of its improved beta-glucosidase 3.3 times.And compared with the similar technique of report, produce the time shorten needed for identical output oligosaccharides 4.8 times, final product yield improves 25%.
Detailed Description Of The Invention
Technical solution of the present invention is as follows:
A kind of beta-glucosidase, aminoacid sequence is as shown in SEQ ID NO.1.
An expressing gene for beta-glucosidase, nucleotide sequence is as shown in SEQ ID NO.2.
A kind of recombinant expression vector is by the such as insertion of nucleotide sequence shown in SEQ ID NO.1 expression vector acquisition.
Preferred according to the present invention, described expression vector is pET-32A expression vector.
A kind of reconstitution cell is transformed in cell by above-mentioned recombinant expression vector to obtain.
Preferred according to the present invention, described cell is e. coli bl21 (DE3).
Utilize beta-glucosidase to produce a method for oligosaccharides, step is as follows:
The gene fragment of nucleotide sequence as shown in SEQ ID NO.2 is imported in pET-32A plasmid vector, then proceed in e. coli bl21 (DE3), beta-glucosidase is obtained by affinity chromatography chromatographic separation and purification, then beta-glucosidase is added with glucose be substrate reaction solution in, it is 30 degree in temperature, pH reacts under the condition of 6.0, obtains oligosaccharides.
Beneficial effect
1, utilize beta-glucosidase of the present invention to produce oligosaccharides, compared with existing beta-glucosidase, speed of response is obviously accelerated.
2, the best enzyme of beta-glucosidase of the present invention lives temperature closer to normal temperature, in actual industrialization is produced, is conducive to reducing and produces power consumption.
3, beta-glucosidase of the present invention expression amount in recombinant bacterial strain is high, and purge process is simple, is easy to large-scale industrial production.
Accompanying drawing explanation
Fig. 1 affinitive layer purification albumen result SDS-PAGE collection of illustrative plates;
Wherein: M, marker, 1, the broken liquid of Bacillus coli cells, 2, nickel affinity chromatography post elution peak, 3, anion-exchange chromatography elution peak, 4, anion-exchange chromatography elution peak.
Fig. 2 thin layer chromatography analysis product oligosaccharides composition;
Embodiment
Below by embodiment, technical scheme of the present invention is further elaborated, should be noted that the protection domain of this explanation is not limited only to this.
Trichodermareesei (trichoderma reesei) QM6a purchased from American standard biological product preservation center, culture presevation ATCCNo.13631;
Pet-32A plasmid vector is purchased from Novagen company.
Embodiment 1:
(1) extraction of Trichodermareesei QM6a total serum IgE:
Trichodermareesei QM6a bacterial strain is cultivated 2 days in the MM substratum being added with 2wt% Microcrystalline Cellulose, collects mycelia with filter paper filtering.The mortar that the mycelia of collection puts into precooling is ground, wherein adds certain liquid nitrogen during grinding.The mycelia powder ground to form is moved in 1.5ml centrifuge tube, and adds 1ml RNAiso(purchased from Sheng Gong biotechnology company limited B6402-1) to shake evenly in vibrator, room temperature puts 5min.Then the centrifugal 10min of 12000rpm.Then supernatant is drawn onto in clean 1.5ml centrifuge tube.Then add 160 μ l chloroforms, concussion 15s mixing, room temperature places 5min, 12000rpm, 4 degree of centrifugal 5min.Then suct clearly to new 1.5ml centrifuge tube.And then add 800 μ l Virahols, turn upside down 5 times.Room temperature places 10min, 12000rpm, 4 degree of centrifugal 10min.Abandon supernatant.Add 75% ethanol purge RNA of 1ml precooling, the centrifugal 5min of 7500rpm after concussion.Add 50 μ l DEPC treated waters, dissolve RNA.
MM nutrient media components is as follows: ammonium sulfate 3g, potassium primary phosphate 4.5g, magnesium sulfate 0.18g, Calcium dichloride dihydrate 0.24g urea 1.5g, 1000 × trace element (green vitriol 5g/L, manganese sulfate monohydrate 1.6g/L, Zinc Sulphate Heptahydrate 1.4g/L, cobalt chloride 2g/L) 30 μ l, supply 300ml with water.
(2) clone of beta-glucoside enzyme coding gene:
With Trichodermareesei QM6a total serum IgE for template, reverse transcription is utilized to synthesize cDNA(purchased from takara Reverse Transcription box BK1201):
1. the removal reaction of genomic dna
By following proportions reaction solution:
5×gDNA Eraser Buffer 2μl
gDNA Eraser 1μl
Total RNA 0.5μg
RNAase Free ddH
2O up to10μl
Above-mentioned reaction solution is reacted 2min under 42 degree of conditions.
2. reverse transcription reaction:
By following proportions reaction solution:
5×PrimeScript Buffer2 4μl
PrimeScript RT Enzyme Mix I 1μl
RT Primer Mix 1μl
The reaction solution 10 μ l that 1. step is prepared
RNase Free ddH
2O up to20μl
By above-mentioned reaction solution at 37 degree of reaction 15min, then at 85 degree of reaction 5s.
Be that upstream and downstream primer amplification goes out bgl gene with F, R:
Primers F: CCGGAATTCATGCCCGAGTCGCTAGCTCTGCCC;
Primer R:CCCAAGCTTTGCCGCCACTTTAACCCTCTGC;
PCR reaction is carried out in 50 μ l systems: 2 × PCR Buffer25 μ l, 2mM dNTPs10 μ l, primers F 1.5 μ l, primer R1.5 μ l, template DNA 1 μ l, KOD FX polysaccharase 1 μ l, adds distilled water and supply 50 μ l.
PCR reaction system: start circulation after 94 degree of sex change 2min, then 98 degree of sex change 10s, 60 degree of annealing 30s, 68 degree extend 90s, after totally 35 circulations, then extend 10min in 68 degree, amplification obtains PCR fragment, rubber tapping is reclaimed, and reclaim fragment and be connected on PET32A plasmid vector, link position is between the multiple clone site EcoR1 and HindIII of plasmid vector.Connect product conversion bacillus coli DH 5 alpha, the LB that converted product is coated containing 100mg/L penbritin is dull and stereotyped, and through 37 degree of overnight incubation, choosing colony, access LB liquid nutrient medium, extracted plasmid after 10 hours.
(3) transformation of beta-glucosidase gene
Beta-glucosidase gene in above-mentioned recombinant plasmid is carried out rite-directed mutagenesis, and mutational site is I177S, I174S.First mutational site I177S.Be that reverse primer carries out rite-directed mutagenesis (test kit derives from Japan and spins company KOD-PLUS-Mutagenesis Kit167300) with F1, R1, sequence is as follows:
F1：AGCTATGGATATGCCACCGGCAGCAACGC；
R1：GGCCTGAATCCAGGGTTCGTTGATGGTG；
1. inverse PCR
By following proportions PCR reaction solution:
10×Buffer 5μl
2mM dNTPs 5μl
F1 1.5μl
R1 1.5μl
Recombinant plasmid (PET32A-BGL) 1 μ l
KOD-PLUS-Mutagenesis Kit 1μl
ddH
2O up to50μl
PCR reaction system: start circulation after 94 degree of sex change 2min, then 98 degree of sex change 10s, 65 degree of annealing 30s, 68 degree extend 7min, totally 5 circulations.
2. DPN I is to the digestion of template plasmid
In above-mentioned reacted reaction solution, add 1 μ lDPN I, react 1 hour under 37 DEG C of conditions;
3. the recirculation of PCR primer
By following proportions reaction solution
Ligation high 5μl
ddH
2O 7μl
2. the reaction solution 2 μ l in
T4Kinase 1μl
Above-mentioned reaction solution is reacted 1 hour under 16 degree of conditions
Transformation of E. coli DH5 α after reaction, the LB that converted product is coated containing 100mg/L penbritin is dull and stereotyped, and through 37 degree of overnight incubation, choosing colony, access LB liquid nutrient medium, extracted plasmid after 10 hours.This plasmid is carried out sequencing.Pick out the plasmid that sudden change is correct.
Suddenly change correct plasmid for template with above-mentioned mutational site I177S, sudden change I174S site, and design inverse PCR primer F2 and R2, picks out the correct plasmid of sudden change by above-mentioned same method.
F2:AGTCAGGCCAGCTATGGATATGCCACCG
R2：CCAGGGTTCGTTGATGGTGATCCAGTTCT
Obtained beta-glucosidase expressing gene is through Hua Da gene biological engineering corporation sequence verification, and nucleotide sequence is as shown in SEQID NO.2.
Then recombinant plasmid is imported in e. coli bl21 (DE3).By the intestinal bacteria enlarged culturing containing recombinant plasmid obtained, be cultured to OD
600add the IPTG that thousandth content is 100mM when being 0.6, induce 16 hours under 16 degree of conditions.Then centrifugal under 7000rpm condition, collecting thalline, is 6.0,50mM PBS buffer solution thalline twice with pH.After ultrasonication, target protein is purified into by the mode of nickel ion affinity chromatograph and anion-exchange chromatography, then respectively by the liquid after fragmentation, the elution peak solution after nickel ion affinity chromatograph and the elution peak solution after anion-exchange chromatography purifying after SDS-PAGE electrophoresis, the enzyme amount that itself and reaction solution add 0.35mg by every 1ml reaction solution as shown in Figure 1, is reacted by result.Reaction conditions is 30 DEG C, and pH is 6.0, and reaction solution composition is add 40% glucose in 10ml system, 500 μ l sodiumazide, the 50mM Sodium phosphate dibasic/sodium dihydrogen phosphate buffer of the pH6.0 of 1mL.React after 10 hours, sample boiling water bath 10min go out enzyme live.Then production concentration and kind is identified by HPLC and thin-layer chromatography (Fig. 2).Its aminoacid sequence is as shown in SEQ ID NO.1.
Embodiment 2:
The beta-glucosidase be purified and wild-type beta-glucosidase are got respectively 100 μ l to join in the Sodium phosphate dibasic/sodium dihydrogen phosphate buffer of the 50mM of the p-nitrophenyl glucoside containing 5mM and (add 10% glycerine), pH is 7.4, temperature is 30 DEG C, reacts 30 minutes.By 10% sodium bicarbonate 150 μ l termination reaction.Get appropriate volume and measure OD value in 420nm light wave strong point, draw its hydrolyzing activity.Bradford test kit (Shanghai raw work biotechnology SK3041-1) is used to measure its protein concn.Enzyme is lived and is defined as follows: per minute transforms and produces 1mM pNP is a Ge Meihuo unit (U).Result is as shown in table 1.
Table 1
Embodiment 3:
Condition in example 2 is optimized, make to turn glycosyl activity and reach higher level. set different temperature respectively, pH value optimizes the transglycosylation of beta-glucosidase of the present invention. show that in condition be pH5.0 by experiment, when temperature is 30 degree, turn glycosyl activity the highest, and reach maximum at 72 hours. with this understanding respectively with 60%, 70%, 80% glucose concn is substrate, obtains the vertex of 72 hours, as shown in table 2.
Table 2
| Glucose concn (mg/100mL) | 60 | 70 | 80 |
| Oligosaccharides yield (mg/mL) | 45.237 | 56.615 | 64.743 |
Embodiment 4:
The enzyme amount that target protein after purifying and reaction solution add 0.35mg by every 1ml reaction solution is reacted.Reaction conditions is 30 DEG C, and pH is 6.0, and reaction solution composition is add 40% glucose in 10ml system, 500 μ l sodiumazide, the 50mM Sodium phosphate dibasic/sodium dihydrogen phosphate buffer of the pH6.0 of 1mL.Step of reaction timing sampling, sample boiling water bath 10min go out enzyme live.Result is as table 3.
Table 3
Claims (2)
1. a beta-glucosidase, is characterized in that, described aminoacid sequence is as shown in SEQ ID NO.1.
2. an expressing gene for beta-glucosidase, is characterized in that, described nucleotide sequence is as shown in SEQ ID NO.2.
3
.a kind of recombinant expression vector is by the such as insertion of nucleotide sequence shown in SEQ ID NO.2 expression vector acquisition.
4
.recombinant expression vector as claimed in claim 3, is characterized in that, described expression vector is pET-32A expression vector.
5
.a kind of reconstitution cell is transformed in cell by the recombinant expression vector described in claim 3 or 4 to obtain.
6
.reconstitution cell as claimed in claim 5, is characterized in that, described cell is e. coli bl21 (DE3).
7
.utilize beta-glucosidase to produce a method for oligosaccharides, it is characterized in that, described step is as follows:
The gene fragment of nucleotide sequence as shown in SEQ ID NO.2 is imported in pET-32A plasmid vector, then proceed in e. coli bl21 (DE3), beta-glucosidase is obtained by affinity chromatography chromatographic separation and purification, then beta-glucosidase is added with glucose be substrate reaction solution in, it is 30 degree in temperature, pH reacts under the condition of 6.0, obtains oligosaccharides.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310125106.XA CN103160483B (en) | 2013-04-11 | 2013-04-11 | Beta-glucosidase, as well as expression gene and application thereof |
| PCT/CN2014/073502 WO2014166326A1 (en) | 2013-04-11 | 2014-03-17 | β-GLUCOSIDASE AND EXPRESSION GENE AND USAGE THEREOF |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310125106.XA CN103160483B (en) | 2013-04-11 | 2013-04-11 | Beta-glucosidase, as well as expression gene and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103160483A CN103160483A (en) | 2013-06-19 |
| CN103160483B true CN103160483B (en) | 2015-03-18 |
Family
ID=48584018
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310125106.XA Active CN103160483B (en) | 2013-04-11 | 2013-04-11 | Beta-glucosidase, as well as expression gene and application thereof |
Country Status (2)
| Country | Link |
|---|---|
| CN (1) | CN103160483B (en) |
| WO (1) | WO2014166326A1 (en) |
Families Citing this family (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103160483B (en) * | 2013-04-11 | 2015-03-18 | 山东大学 | Beta-glucosidase, as well as expression gene and application thereof |
| CN104232606B (en) * | 2014-08-29 | 2017-12-05 | 山东大学 | The β glucuroides and its expressing gene of a kind of transformation and application |
| CN107988186A (en) * | 2017-12-06 | 2018-05-04 | 南京林业大学 | A kind of Cold tolerance endo beta-1,4-glucanase and its expressing gene and application |
| EP3802815A1 (en) | 2018-06-05 | 2021-04-14 | Teknologian Tutkimuskeskus VTT Oy | Beta glucosidase with high glucose tolerance, high thermal stability and broad ph activity spectrum |
| CN115772476A (en) * | 2021-09-08 | 2023-03-10 | 山东大学 | Application of filamentous fungus recombinant strain in cellulase production field |
| CN115976074B (en) * | 2022-10-18 | 2024-09-10 | 内蒙古农业大学 | Application of AsBgluc gene in improving drought tolerance of plants |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102220302A (en) * | 2011-05-20 | 2011-10-19 | 安徽大学 | Beta-glucosidase mutant, recombined expression plasmid and converted engineering strain |
| CN102517307A (en) * | 2011-12-29 | 2012-06-27 | 山东大学 | Beta-glucosidase Mut1b as well as expressed gene and application thereof |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7005289B2 (en) * | 2001-12-18 | 2006-02-28 | Genencor International, Inc. | BGL5 β-glucosidase and nucleic acids encoding the same |
| CN102154344B (en) * | 2011-02-09 | 2012-06-06 | 天津大学 | Gene for coding beta-glucosidase, recombinant expression vector, recombinant saccharomyces cerevisiae expression strain and application |
| CN102220369B (en) * | 2011-05-11 | 2012-10-10 | 天津大学 | Recombinant vector and recombinant bacterium of Trichoderma reesei beta-glucosaccharase gene BGL1, and expression of Trichoderma reesei beta-glucosaccharase gene BGL1 in recombinant bacterium |
| CN103160483B (en) * | 2013-04-11 | 2015-03-18 | 山东大学 | Beta-glucosidase, as well as expression gene and application thereof |
-
2013
- 2013-04-11 CN CN201310125106.XA patent/CN103160483B/en active Active
-
2014
- 2014-03-17 WO PCT/CN2014/073502 patent/WO2014166326A1/en active Application Filing
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102220302A (en) * | 2011-05-20 | 2011-10-19 | 安徽大学 | Beta-glucosidase mutant, recombined expression plasmid and converted engineering strain |
| CN102517307A (en) * | 2011-12-29 | 2012-06-27 | 山东大学 | Beta-glucosidase Mut1b as well as expressed gene and application thereof |
Non-Patent Citations (1)
| Title |
|---|
| 一株里氏木霉产纤维素酶的条件及酶系的优化;曹健等;《郑州工程学院学报》;20030331;第24卷(第1期);10-14 * |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2014166326A1 (en) | 2014-10-16 |
| CN103160483A (en) | 2013-06-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103160483B (en) | Beta-glucosidase, as well as expression gene and application thereof | |
| CN103074315B (en) | Lipase LIP, gene and application thereof | |
| CN104560927A (en) | Mutated arginine deiminase as well as preparation method and application thereof | |
| CN106191084A (en) | The clone of a kind of α L rhamnosidase gene, express and apply | |
| CN102002465B (en) | Acidic belta-mannase VMAN, gene thereof and application | |
| CN104726435B (en) | β -glucosidase mutant, recombinant expression plasmid thereof and transformed engineering strain | |
| CN104232606A (en) | Improved beta-glucosidase as well as expression gene and application thereof | |
| CN110643622A (en) | Alginate lyase gene and application thereof | |
| CN103952326A (en) | Recombinant pichia pastoris bacterial strain for co-expressing inulin excision enzyme and incision enzyme as well as construction method and application of bacterial strain | |
| CN103695323B (en) | Stable and high-yield strain for alpha-transglucosidase | |
| CN103695383B (en) | Aspergillus niger strain for efficiently expressing alpha-transglucosidase | |
| CN104357425A (en) | Novel alpha-galactosidase NGAL, and gene and application thereof | |
| CN101906405A (en) | Cloning of inulin ftructotransferase and efficient expression thereof | |
| CN102382807B (en) | Novel glucoamylase VGA (video graphics array), gene thereof and application thereof | |
| CN113373168B (en) | Bacterial-derived alpha-L-rhamnosidase gene, gene expression and application thereof | |
| CN113528490B (en) | Chitinase, coding gene and application thereof | |
| CN102586208B (en) | Protein with Beta-N-acetamido glucosaminidase activity as well as encoding gene and application thereof | |
| CN109402090B (en) | Beta-1,3 endoglucanase with immune enhancing activity and derived from scapharca broughtonii and encoding polynucleotide thereof | |
| CN104087604A (en) | Genetic expression sequence of inulin fructotransferase | |
| CN102363773B (en) | Novel beta-glucanase GLU, novel high temperature resistant beta-glucanase VGLU, and genes and applications of novel beta-glucanase GLU and novel high temperature resistant beta-glucanase VGLU | |
| CN103290039B (en) | Alpha-amylase derived from animal feces metagenome and gene of the alpha-amylase | |
| CN106978410B (en) | Bifunctional glucanase with chitosan hydrolysis activity, gene, vector, engineering bacterium and application thereof | |
| CN101838637B (en) | Wide-temperature applicability acidic dextranase AGL9A, and gene and application thereof | |
| CN104651338A (en) | Acidic temperature-resistance B-seminase as well as gene and application thereof | |
| CN101824401B (en) | Glucanase and coding nucleic acid and expression thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| EE01 | Entry into force of recordation of patent licensing contract | ||
| EE01 | Entry into force of recordation of patent licensing contract |
Application publication date: 20130619 Assignee: Jiangsu Lianhai Biological Technology Co., Ltd. Assignor: Shandong University Contract record no.: 2018370000016 Denomination of invention: Beta-glucosidase, as well as expression gene and application thereof Granted publication date: 20150318 License type: Common License Record date: 20180516 |
|
| EE01 | Entry into force of recordation of patent licensing contract | ||
| EE01 | Entry into force of recordation of patent licensing contract |
Application publication date: 20130619 Assignee: RONGCHENG HUIHAI CHUANGDA BIOTECHNOLOGY Co.,Ltd. Assignor: SHANDONG University Contract record no.: X2020370000007 Denomination of invention: Beta-glucosidase, as well as expression gene and application thereof Granted publication date: 20150318 License type: Common License Record date: 20200508 |