CN106754595A - One plant of recombinant bacterium and its application in catalysis content rebaudioside-A generation rebaudioside D - Google Patents

Abstract

The invention discloses one plant of recombinant bacterium and its application in catalysis content rebaudioside-A generation rebaudioside D,Contain tomato source glycosyl transferase UGTSL2 genes and potato source sucrose synthase StSUS1 genes in the recombinant bacterium simultaneously,Tomato is originated into glycosyl transferase UGTSL2 gene clonings between NdeI the and XhoI sites of pRSFDuet 1,Structure obtains recombinant plasmid pRSFDuet SL2,Then potato is originated into sucrose synthase StSUS1 gene clonings between NcoI the and EcoRI sites of pRSFDuet SL2 again,Structure obtains recombinant plasmid pRSFDuet SL2 SUS1,Recombinant plasmid pRSFDuet SL2 SUS1 are transformed into host cell,Obtain recombinant bacterium.Crude enzyme liquid will be taken after recombinant bacterium induced expression, it is added to catalysis content rebaudioside-A generation rebaudioside D in reactant mixture, crude enzyme liquid in reaction using recombinant bacterium after broken, avoid isolating and purifying for enzyme, without making freeze-dried powder, it is not required to add UDP or UDP glucose and any cell-permeant agent or other chemical reagent in reaction solution, environment friendly is more preferably.The yield of rebaudioside D is up to 10.8 g/L.

Description

One plant of recombinant bacterium and its application in catalysis content rebaudioside-A generation rebaudioside D

Technical field

The invention belongs to gene engineering technology field, and in particular to a kind of recombinant bacterium and its catalysis content rebaudioside-A generation Application in rebaudioside D.

Background technology

As people increasingly improve to the concern consciousness of health, consumer gradually decreases to the intake of sucrose, food work Industry is devoted to developing the natural sweetener of low heat value sugariness high.Stevioside extracts from originating in South America Paraguay and Brazil for many years Raw catananche STEVIA REBAUDIANA, with sugariness high（It is 250~300 times of sucrose）, it is low in calories（Only the 1/300 of sucrose）'s Characteristic, has no toxic side effect, without carcinogenic substance, edible safety, to illnesss such as hypertension, diabetes, obesity, heart disease, carious teeth also There is certain pharmacological action and auxiliary curative effect.It is that the third outside cane suger, beet sugar has Development volue and health to push away High natural sucrose substitute, is described as " third place in the world sugar source " in the world., food and drug administration in 1998 （FDA）Be added to stevioside in food and drink by agreement.Switzerland stevioside is listed in national pharmacopeia as syrup, oral liquid or The primary sweetener raw material of lozenge, instead of the tradition acceptable sweeteners such as saccharin sodium.Relative to Japan, the U.S. and Switzerland, European Union Approval uses the time of stevioside more a little later.European Union's official approval in 2008 its as food additives.

Because the demand to stevioside is continuously increased, it is many country include Japan, Singapore, Malaysia, South Korea, in State, Israel, India, Brazil and Australia etc. are all in commercial growth STEVIA REBAUDIANA.The leaf of STEVIA REBAUDIANA contains various days Right sweet taste glucoside such as Stevioside, Lai Baodi A-F, Dul-A and glycosides.Wherein, although rebaudioside D is not stevioside Main glucoside in general glycoside, but bitter taste is substantially less than content rebaudioside-A thereafter（Chemosens Percept. 6(3): 109– 117）.2008, U.S. FDA was signed and issued and has confirmed that content rebaudioside-A can be used as zero calorie sweetener with minimum 95% purity " being commonly referred to be safe "（“GRAS”）Notify.Rebaudioside D is similar to content rebaudioside-A structure, only differs a glucose Base, the toxicity research of the related structural material of steviol glycoside also confirms that rebaudioside D edible safeties, can be used for the neck such as food and medicine Domain (Int. J. Toxicol., 2013,32 (4):261-273.).Therefore, rebaudioside D is that have more than content rebaudioside-A The potential natural sweetener of good taste matter.

The UDP- glycosyl transferases of plant origin can be catalyzed content rebaudioside-A glycosylation generation rebaudioside D, such as UGT91D2 (US2014/0357588A1), EUGT11 (WO/2013/022989A2) and UGTSL2（US2014/0357588A1, Biomolecules 2014,4:374-389) etc..The Transglycosylation that glycosyl transferase is catalyzed by UDP- glycosyl transferases The middle glycosyl donor UDPG for needing to activate, for reduces cost, it will usually using regeneration UDPG regenerating system, UDP and sucrose such as are being added in system, UDPG and fructose are being generated in the presence of sucrose synthase（Biotechnol. Adv.2016,34(2):88-111.）.CN201310353500.9 and CN201410019981.4 are with content rebaudioside-A for patent Rebaudioside D is its intermediate product or is directly used as preparing the substrate of rebaudioside M during preparing rebaudioside M for substrate. Using recombinant cell, it is necessary to add toluene or other cell-permeant agent in reaction system；Or recombinant cell freeze-dried powder is used, and freeze The preparation power consumption of dry powder, high cost；In addition it is required for additionally adding auxiliary substrates of the UDP as UDPG regenerating system.Specially Although the technique in sharp CN201410019981.4 to CN201310353500.9 is optimized but also needs to allotment UDP- sugar The adding proportion of based transferase and sucrose synthase, recombinant bacterium consumption is big, producing enzyme high cost.

The content of the invention

In order to solve the above problems, the present invention provides a kind of recombinant bacterium and its in catalysis content rebaudioside-A generation rebaudioside D In application, the recombinant bacterium of structure can be co-expressed the UDP- glycosyl transferases UGTSL2 in tomato source and the sugarcane in potato source Sugared synthase StSUS1, it is not necessary to separately expression and prepare, also without regulation two kinds of enzymes between proportioning, be applied to synthesize Lay Bao Crude enzyme liquid during enlightening glucoside D directly using recombinant bacterium after broken, is not required to add UDP or UDPG, and cell-permeant Agent or other chemical reagent, simplify technical process, high income.

To achieve these goals, the technical solution adopted by the present invention is：

One plant of recombinant bacterium, contains tomato source glycosyl transferase UGTSL2 genes and potato source sugarcane simultaneously in the recombinant bacterium Sugared synthase StSUS1 genes, the tomato originates glycosyl transferase UGTSL2 gene orders as shown in SEQ.NO.1, what it was encoded The amino acid sequence of tomato source glycosyl transferase UGTSL2 as shown in SEQ.NO.3, potato source sucrose synthase As shown in SEQ.NO.2, the potato of its coding originates sucrose synthase StSUS1 amino acid sequences such as to StSUS1 gene orders Shown in SEQ.NO.4.

Tomato is originated into glycosyl transferase UGTSL2 gene clonings between NdeI the and XhoI sites of pRSFDuet-1, structure Build and obtain recombinant plasmid pRSFDuet-SL2, then again arrive potato source sucrose synthase StSUS1 gene clonings Between NcoI the and EcoRI sites of pRSFDuet-SL2, structure obtains recombinant plasmid pRSFDuet-SL2-SUS1, will recombinate matter Grain pRSFDuet-SL2-SUS1 is transformed into host cell, obtains recombinant bacterium.

Application of the described recombinant bacterium in catalysis content rebaudioside-A generation rebaudioside D.

Crude enzyme liquid will be taken after recombinant bacterium induced expression, be added to catalysis content rebaudioside-A generation Lai Baodi in reactant mixture Glucoside D, the reactant mixture includes content rebaudioside-A, sucrose and sodium phosphate buffer.

The induced expression condition of the recombinant bacterium is：Recombinant bacterium is inoculated into LB culture mediums, in 20 ~ 37 DEG C, 250rpm Shaken cultivation 8h, then will culture bacterium solution by 2% inoculum concentration access inducing culture in, in 200rpm, 20 ~ 37 DEG C culture 2h, treat OD₆₀₀Turn 25 DEG C of Fiber differentiation 22h when reaching 0.2 or so, thalline is collected by centrifugation.

Content rebaudioside-A concentration is 4 ~ 10g/L in the reactant mixture, and sucrose concentration is 30 ~ 50g/L, crude enzyme liquid concentration It is 2 ~ 10g/L, it is 6.4 ~ 8 to use sodium phosphate buffer to adjust pH；Further, it is preferable to content rebaudioside-A concentration is 10g/L, sugarcane Sugared concentration is 30g/L, and crude enzyme liquid concentration is 8g/L, and it is 7.2 to use sodium phosphate buffer to adjust pH.

The reaction temperature is 20 ~ 55 DEG C, and the reaction time is 2 ~ 25 h.

The LB culture medium prescriptions are 0.5g/L dusty yeasts, 0.5g/L sodium chloride, 1g/L tryptones, 0.05g/L Ka Na Mycin.

The Fiber differentiation based formulas be 25g/L dusty yeasts, 15g/L tryptones, 10g/L sodium chloride, 2g/L glucose, 0.05 ~ 0.2g/L lactose.Preferred lactose concn is 0.1g/L in inducing culture.

By controlling reaction condition, in 30 DEG C, pH7.2, substrate content rebaudioside-A：Sucrose mass ratio 1:3rd, enzyme concentration is When 8mg/mL, reaction time 16h, rebaudioside D molar yields improve 1.7 times, reach 86%.

Beneficial effect：Coexpression tomato source UDP- glycosyl transferases UGTSL2 and potato source sugarcane that the present invention builds The recombinant bacterium of sugared synthase StSUS1 is used as biocatalyst, it is not necessary to which separately expression and preparation UDP- glycosyl transferases are closed with sucrose Enzyme, it is not required that the proportioning between two kinds of enzymes of regulation.Recombinant bacterium can use recombinant bacterium in -20 DEG C or -80 DEG C preservations in reaction Crude enzyme liquid after broken, it is to avoid isolating and purifying for enzyme, without freeze-dried powder is made, simplifies technical process.In catalysis Lay Bao During enlightening glucoside A generation rebaudiosides D, it is not required to add UDP or UDPG in reaction solution, significantly reduces cost.Reaction solution In be not required to add any cell-permeant agent or other chemical reagent, environment friendly is more preferably.The yield of rebaudioside D is up to 10.8 g/L。

Brief description of the drawings

Fig. 1：Sucrose synthase StSUS1 and glycosyl transferase UGTSL2 coupling reaction schematic diagrames；

Fig. 2：Reaction solution sample HPLC testing result figures.

Specific embodiment

In following examples, rebaudioside D uses liquid chromatographic detection, and HPLC is in Agilent Agilent Carried out on the Infinity liquid chromatographs of Technologies 1290, chromatographiccondition is as follows：

Chromatographic column：Agilent5TC-C18（Netheriands）250×4.6mm；Mobile phase is 0.1% formic acid：Acetonitrile（70:30； V:V）；Flow velocity 1min/mL；55 DEG C of column temperature；Detection wavelength：210nm.

Rebaudioside D standard items are purchased from Shanghai Yuan Ye bio tech ltd.

The structure of the recombinant bacterial strain S1 of embodiment 1

The gene order of tomato source glycosyl transferase UGTSL2 as shown in SEQ.NO.1, originate sucrose synthase StSUS1 by potato Gene order is synthesized after codon optimization as shown in SEQ.NO.2 by Nanjing Jin Sirui companies.Design primer GGGAATTCCATATGGCGACCAACCTGCG and CCGCTCGAGTTAGTGGTGATGATGGTGATGTTTG amplification UGTSL2 bases Cause, pRSFDuet-1 is subcloned into by the gene（Novagen）NdeI and XhoI sites between, construction recombination plasmid pRSFDuet-SL2；Design primer TAATAAGGAGATATACCATGGCCGAACGTGTCCTGACCC and AGGCGCGCCGAGCTCGAATTCTTATTCAGCTGCCAGCG, with the one-step cloning of Nanjing Vazyme Biotechnology Co., Ltd. Kit（One Step Cloning Kit, Vazyme）By StSUS1 genes be subcloned into pRSFDuet-SL2 NcoI and Between EcoRI sites, construction recombination plasmid pRSFDuet-SL2-SUS1.With pRSFDuet-SL2-SUS1 as template, design is drawn Thing CATGCCATGGCCGAACGTGTC and CCGGAATTCTTATTCAGCTGCCAGCG, StSUS1 genes are subcloned into pET22b(+)（Novagen）NcoI and EcoRI sites between, construction recombination plasmid pET22b-SUS1.By pRSFDuet- SL2-SUS1 and pET22b-SUS1 are transformed into e. coli bl21（DE3）, obtain recombinant bacterium BL21（pRSFDuet-SL2- SUS1, pET22b-SUS1）, abbreviation S1.TransFast Taq archaeal dna polymerases are purchased from the full formula gold in Beijing in molecular cloning protocols Bioisystech Co., Ltd, T4 DNA ligases and restricted interior enzyme are purchased from Dalian TaKaRa companies, plasmid extraction kit Purchased from TIANGEN Biotech (Beijing) Co., Ltd..Step of converting is referred to《Molecular Cloning:A Laboratory guide》（（It is beautiful）J. Pehanorm cloth Shandong Gram wait write；Huang Peitang etc. is translated；Co., Ltd of Science Press；The third edition, the first volume, P91）, according to the resistance screening of plasmid Transformant, then upgrading grain through digestion verification confirming positive colony.

The structure of the recombinant bacterium S2 of embodiment 2

The recombinant plasmid pRSFDuet-SL2-SUS1 built with embodiment 1 designs primer as template AAGGAAAAAAGCGGCCGCTATGGCGACCAACCTGC and CCGGAATTCGTGGTGATGATGGTGATGTTTGCTC is expanded UGTSL2 genes, are subcloned into pET22b (+)（Novagen）NotI and EcoRI sites between, construction recombination plasmid pET22b-SL2.PRSFDuet-SL2-SUS1 and pET22b-SL2 are transformed into e. coli bl21（DE3）, obtain recombinant bacterium BL21（PRSFDuet-SL2-SUS1, pET22b-SL2）, abbreviation S2.

The structure of the recombinant bacterium S3 of embodiment 3

The pRSFDuet-SL2 and pET22b-SUS1 that are built in embodiment 1 are transformed into e. coli bl21（DE3）, weighed Group bacterium BL21（PRSFDuet-SL2, pET22b-SUS1）, abbreviation S3.

The structure of the recombinant bacterium S4 of embodiment 4

The pRSFDuet-SL2-SUS1 built in embodiment 1 is transformed into e. coli bl21（DE3）, obtain recombinant bacterium BL21 （pRSFDuet-SL2-SUS1）, abbreviation S4.

It is prepared by the induced expression recombinase of embodiment 5 and crude enzyme liquid

Recombinant bacterium S1 ~ S4 is inoculated into respectively and receives the 5mL LB culture mediums of mycin containing 0.05g/L cards（0.5g/L dusty yeasts, 0.5g/L sodium chloride, 1g/L tryptones）, in 37 DEG C, 250rpm shaken cultivation 8h, then culture bacterium solution is accessed by 2% inoculum concentration Contain 100mL inducing cultures（25g/L dusty yeasts, 15g/L tryptones, 10g/L sodium chloride, 2g/L glucose, 0.05g/L Lactose）500mL shaking flasks in, in 200rpm, 30 DEG C culture 2h, treat OD₆₀₀Turn 25 DEG C of induction 22h centrifugations when reaching 0.2 or so Collects thalline.Carrying out ultrasonic bacteria breaking, centrifuging and taking supernatant is crude enzyme liquid, is placed in 4 DEG C of refrigerators stand-by.

The reactant mixture of 10mL is added in 50mL triangular flasks, comprising 10g/L content rebaudioside-As（It is sweet purchased from Qufu sea root Chrysanthemum Products Co., Ltd）, 50g/L sucrose, 50mM sodium phosphate buffers regulation mixture pH be 7.2, be then respectively adding 3mg/ The crude enzyme liquid of mL S1 ~ S4, reaction is carried out under the conditions of 30 DEG C, 200rpm, is sampled after reaction 2-25h and is gone out in 95 DEG C of heating 5min Enzyme living, centrifuging and taking supernatant, using high performance liquid chromatography（HPLC）Detection rebaudioside concentration, the results are shown in Table 1.

Table 1：

Crude enzyme liquid is taken after above-mentioned 4 plants of bacterium induced expressions to be reacted, with anti-using crude enzyme liquid is obtained after recombinant bacterium S4 induced expressions The yield highest of rebaudioside D in the reaction solution answered, is 4.71 g/L.Next to that using the reaction solution of the bacterial strain thick enzyme of S2 and S3, Rebaudioside D concentration is 2.87 and 2.89 g/L, and rebaudioside D concentration is minimum in using the reaction solution of the bacterial strain thick enzymes of S1 （0.98 g/L）.Its reason is probably because, all containing two plasmids, bacterial strain burden is big during induced expression, mesh in strain bacterium S1-S3 Albumen mostly with occlusion body form exist, it is difficult to two kinds of ratios of recombinase of stability contorting, prevent its coupling reaction from reaching Yield higher.

Influence of the temperature of embodiment 6 to the induced expression of recombinant bacterium S4

Recombinant bacterium S4 is inoculated into and receives the 5mL LB culture mediums of mycin containing 0.05g/L cards（0.5g/L dusty yeasts, 0.5g/L chlorinations Sodium, 1g/L tryptones）, under the conditions of 37 DEG C, 250rpm shaken cultivation 8h, then culture bacterium solution is accessed by 2% inoculum concentration and contained 100mL inducing cultures（25g/L dusty yeasts, 15g/L tryptones, 10g/L sodium chloride, 2g/L glucose, 0.05g/L lactose） 500mL shaking flasks in, in 200rpm, cultivate 2h under the conditions of 30 DEG C respectively, treat OD₆₀₀When reaching 0.2 or so, respectively at 20 DEG C, 25 DEG C, 30 DEG C, 37 DEG C of induction 22h are collected by centrifugation thalline, and carrying out ultrasonic bacteria breaking, centrifuging and taking supernatant is crude enzyme liquid, is placed in 4 DEG C of refrigerators and treats With.

The crude enzyme liquid obtained under different inducing temperatures is taken respectively, in 30 DEG C of temperature, pH7.2, content rebaudioside-A 10g/L, sugarcane Reacted under conditions of sugared 30g/L, 8mg/mL crude enzyme liquid, rebaudioside D yield is shown in Table 2.

Table 2

Temperature (DEG C)	Rebaudioside D（g/L）
		20	9.76
25	7.98
		30	5.90
37	0.45

Producing enzyme is induced under the conditions of 20 DEG C, its crude enzyme liquid synthesis rebaudioside D yield highests, are 9.76 g/L.

Influence of the lactose concn of embodiment 7 to the induced expression of recombinant bacterium S4

Recombinant bacterium S4 is inoculated into and receives the 5mL LB culture mediums of mycin containing 0.05g/L cards（0.5g/L dusty yeasts, 0.5g/L chlorinations Sodium, 1g/L tryptones）, under the conditions of 37 DEG C, 250rpm shaken cultivation 8h, then culture bacterium solution is accessed containing not by 2% inoculum concentration With the 100mL inducing cultures of lactose concn（25g/L dusty yeasts, 15g/L tryptones, 10g/L sodium chloride, 2g/L glucose, The respectively lactose concn of 0.02g/L, 0.05g/L, 0.1g/L, 0.15g/L, 0.2g/L）500mL shaking flasks in, in 200rpm, 2h is cultivated under the conditions of 30 DEG C respectively, OD is treated₆₀₀When reaching 0.2 or so, induce 22h that thalline is collected by centrifugation at 20 DEG C respectively, ultrasound Broken bacterium, centrifuging and taking supernatant is crude enzyme liquid, is placed in 4 DEG C of refrigerators stand-by.

The lower crude enzyme liquids for obtaining of different lactose concns induction are taken respectively, in 30 DEG C of temperature, pH7.2, content rebaudioside-A 10g/ L, is reacted under conditions of sucrose 30g/L, 8mg/mL crude enzyme liquid, and rebaudioside D yield is shown in Table 3.

Table 3

Lactose concn（g/L）	Rebaudioside D（g/L）
		0.02	10.07
0.05	8.0
		0.1	10.78
0.15	10.23
		0.2	10.12

The optimal inductive condition that can obtain recombinant bacterium S4 by embodiment 6 and 7 is：20 DEG C of inducing temperature, derivant lactose concn It is 0.1g/L.

Embodiment 8

Reacted using the crude enzyme liquid obtained after recombinant bacterium S4 induced expressions, in 50mL triangular flasks, 10mL reactant mixtures In include 10g/L content rebaudioside-As, 50g/L sucrose, the 50mM sodium phosphate buffers of pH 7.2,3mg/mL crude enzyme liquids, react at 30 DEG C Carried out with the conditions of 200rpm.Add crude enzyme liquid to start reaction, sampled after 0,2,7,14 and 25 h are reacted add in 95 DEG C respectively Hot 5min inactivators, centrifuging and taking supernatant measures the content of rebaudioside D in different time reaction solution, the results are shown in Table 4.

Table 4

Time（h）	Rebaudioside D (g/L)
		0	0.13
2	0.98
		7	3.37
14	5.69
		25	6.1

The rebaudioside D yield highests in 25 h reaction solutions, at this moment the concentration of rebaudioside D is 6.1 g/L in reaction solution.But 14 H has reached 5.69 g/L, it is seen that after 14 h, and reaction is carried out slowly, and product accumulation is little.

Embodiment 9

Reacted using the crude enzyme liquid obtained after recombinant bacterium S4 induced expressions.In 50mL triangular flasks, 10mL reactant mixtures In include 10g/L content rebaudioside-As, 50g/L sucrose, the 50mM sodium phosphate buffers of pH 7.2,3mg/mL crude enzyme liquids, reaction exist respectively 20th, carry out under the conditions of 30,37,45,55 DEG C and 200rpm.Add crude enzyme liquid to start reaction, sampled after reaction 14h in 95 DEG C of heating 5min inactivators, centrifuging and taking supernatant measures the content of rebaudioside D in reaction solution at a temperature of differential responses, the results are shown in Table 5.

Table 5

Temperature (DEG C)	Rebaudioside D (g/L)
		20	2.75
30	3.82
		37	3.56
45	1.01
		55	0.24

It can be seen that in reaction solution under the conditions of 30 DEG C rebaudioside D yield highests, at this moment the concentration of rebaudioside D is in reaction solution 3.82g/L。

Embodiment 10

Reacted using the crude enzyme liquid obtained after recombinant bacterium S4 induced expressions.In 50mL triangular flasks, 10mL reactant mixtures In include 10g/L content rebaudioside-As, 50g/L sucrose, 3mg/mL crude enzyme liquids, 50mM sodium phosphate buffers pH is respectively configured as 6.4, 6.8th, 7.2,7.6 and 8, reaction is carried out under the conditions of 30 DEG C, 200rpm.Add crude enzyme liquid start reaction, reaction 14h after sample in 95 DEG C of heating 5min inactivators, centrifuging and taking supernatant measures the content of rebaudioside D in reaction solution under differential responses pH, as a result sees Table 6.

Table 6

pH	Rebaudioside D（g/L）
		6.4	2.83
6.8	5.55
		7.2	5.83
7.6	3.65
		8.0	3.31

The rebaudioside D yield highests in reaction solution under the conditions of pH 7.2 are measured, at this moment the concentration of rebaudioside D is in reaction solution 5.83g/L。

Embodiment 11

Reacted using the crude enzyme liquid obtained after recombinant bacterium S4 induced expressions.In 50mL triangular flasks, 10mL reactant mixtures In include 10g/L content rebaudioside-As, mass ratio is respectively 1：1、1：3、1：5、1：7 and 1：10 sucrose, the 50mM phosphoric acid of pH 7.2 Sodium is buffered, 3mg/mL crude enzyme liquids, and reaction is carried out under the conditions of 30 DEG C, 200rpm.Crude enzyme liquid is added to start reaction, after reaction 14h Sample and 5min inactivators are heated in 95 DEG C, centrifuging and taking supernatant measures different concentration of substrate proportionings and descends rebaudioside D in reaction solutions Content, the results are shown in Table 7.

Table 7

Content rebaudioside-A:Sucrose	Rebaudioside D (g/L)
		1:1	3.60
1:3	4.07
		1:5	3.82
1:7	3.38
		1:10	3.50

When the mass ratio of content rebaudioside-A and sucrose is 1：Rebaudioside D yield highests in reaction solution, are 4.07g/L when 3.

Embodiment 12

Reacted using the crude enzyme liquid obtained after recombinant bacterium S4 induced expressions.In 50mL triangular flasks, 10mL reactant mixtures In include 10g/L content rebaudioside-As, 50g/L sucrose, the 50mM sodium phosphate buffers of pH 7.2, crude enzyme liquid protein concentration is respectively 2, 4th, 6,8 and 10 mg/mL, reaction is carried out under the conditions of 30 DEG C, 200rpm.Add crude enzyme liquid to start reaction, sampled after reaction 14h 5min inactivators are heated in 95 DEG C, centrifuging and taking supernatant measures the content of rebaudioside D in reaction solution under different crude enzyme liquid concentration, The results are shown in Table 8.

Table 8

Enzyme concentration（g/L）	Rebaudioside D（g/L）
		2	1.45
4	3
		6	4.93
8	8.2
		10	8.2

When crude enzyme liquid protein concentration is 8 and 10 mg/mL, rebaudioside D yield highests in reaction solution, are 8.2g/L.

From embodiment 8-12, optimum reaction condition is：

Reacted using the crude enzyme liquid obtained after recombinant bacterium S4 induced expressions.In 50mL triangular flasks, 10mL reactant mixtures In include 10g/L content rebaudioside-As, 30g/L sucrose, the 50mM sodium phosphate buffers of pH 7.2, the mg/mL of crude enzyme liquid protein concentration 8, Reaction is carried out under the conditions of 30 DEG C, 200rpm.Add crude enzyme liquid to start reaction, sampled after reaction 16h and gone out in 95 DEG C of heating 5min Enzyme living, centrifuging and taking supernatant, rebaudioside D yield highests in reaction solution are 10.8 g/L, and yield is 86%.

SEQUENCE LISTING

<110>Nanjing University of Technology

<120>One plant of recombinant bacterium and its application in catalysis content rebaudioside-A generation rebaudioside D

<130>

<160> 12

<170> PatentIn version 3.3

<210> 1

<211> 1329

<212> DNA

<213>Artificial sequence

<400> 1

atggcgacca acctgcgtgt gctgatgttc ccgtggctgg cgtacggtca catcagcccg 60

tttctgaaca ttgcgaaaca gctggcggat cgtggcttcc tgatctacct gtgcagcacc 120

cgtattaacc tggagagcat cattaagaaa atcccggaaa agtatgcgga cagcatccac 180

ctgattgagc tgcaactgcc ggagctgccg gaactgccgc cgcactatca caccaccaac 240

ggtctgccgc cgcacctgaa cccgaccctg cacaaggcgc tgaaaatgag caagccgaac 300

tttagccgta tcctgcagaa cctgaaaccg gatctgctga tttacgacgt gctgcagccg 360

tgggcggagc acgttgcgaa cgaacaaaac attccggcgg gtaaactgct gaccagctgc 420

gcggcggtgt tcagctattt ctttagcttt cgtaagaacc cgggcgttga gttcccgttt 480

ccggcgatcc acctgccgga agtggaaaag gttaaaatcc gtgagattct ggcgaaagaa 540

ccggaggaag gtggccgtct ggatgagggt aacaagcaga tgatgctgat gtgcaccagc 600

cgtaccatcg aggcgaaata cattgactat tgcaccgaac tgtgcaactg gaaggtggtt 660

ccggtgggtc cgccgttcca agatctgatc accaacgatg cggacaacaa agagctgatt 720

gactggctgg gtaccaagca cgaaaacagc accgtgttcg ttagctttgg cagcgagtac 780

ttcctgagca aagaagatat ggaggaagtt gcgtttgcgc tggagctgag caacgtgaac 840

ttcatctggg ttgcgcgttt tccgaaaggc gaggaacgta acctggaaga tgcgctgccg 900

aagggcttcc tggagcgtat tggtgaacgt ggccgtgtgc tggacaagtt tgcgccgcag 960

ccgcgtatcc tgaaccaccc gagcaccggt ggcttcatta gccactgcgg ttggaacagc 1020

gcgatggaga gcatcgattt tggcgttccg atcattgcga tgccgatcca caacgaccaa 1080

ccgattaacg cgaaactgat ggtggagctg ggtgtggcgg ttgaaatcgt tcgtgacgat 1140

gacggtaaaa tccaccgtgg cgagattgcg gaaaccctga agagcgtggt taccggcgag 1200

accggcgaaa ttctgcgtgc gaaagtgcgt gaaatcagca aaaacctgaa gagcattcgt 1260

gatgaggaaa tggacgcggt tgcggaggaa ctgatccaac tgtgccgtaa cagcaacaag 1320

agcaaataa 1329

<210> 2

<211> 2418

<212> DNA

<213>Artificial sequence

<400> 2

atggccgaac gtgtcctgac ccgtgtccat agtctgcgtg aacgtgttga tgctaccctg 60

gctgcccacc gtaatgaaat cctgctgttt ctgagtcgta ttgaaagcca cggcaaaggt 120

atcctgaaac cgcacgaact gctggcagaa tttgatgcta ttcgccagga tgacaaaaac 180

aaactgaacg aacatgcatt cgaagaactg ctgaaaagca cccaagaagc tatcgtcctg 240

ccgccgtggg tggcactggc aattcgtctg cgcccgggcg tttgggaata catccgtgtt 300

aacgtcaatg cgctggttgt ggaagaactg agtgtgccgg aatatctgca gtttaaagaa 360

gaactggtcg atggcgcgtc caacggtaat ttcgtgctgg aactggactt tgaaccgttc 420

accgcctcat ttccgaaacc gaccctgacg aaatcgattg gcaacggtgt tgaatttctg 480

aatcgtcatc tgagcgccaa aatgttccac gataaagaat ctatgacccc gctgctggaa 540

tttctgcgcg cacatcacta taaaggtaaa accatgatgc tgaacgatcg tattcagaac 600

agcaatacgc tgcaaaatgt gctgcgcaaa gcggaagaat acctgatcat gctgccgccg 660

gaaaccccgt acttcgaatt tgaacataaa ttccaggaaa ttggcctgga aaaaggctgg 720

ggtgatacgg cagaacgtgt gctggaaatg gtttgcatgc tgctggatct gctggaagct 780

ccggacagct gtaccctgga aaaatttctg ggtcgcattc cgatggtttt caacgtcgtg 840

atcctgtctc cgcacggcta ttttgcgcag gaaaatgtcc tgggttaccc ggataccggc 900

ggtcaggttg tctatattct ggaccaagtg ccggccctgg aacgtgaaat gctgaaacgc 960

atcaaagaac agggcctgga tattatcccg cgtattctga tcgtcacccg tctgctgccg 1020

gacgcagtgg gcaccacgtg cggtcaacgt attgaaaaag tgtatggcgc tgaacattca 1080

cacatcctgc gtgttccgtt tcgcaccgaa aaaggtattg tccgtaaatg gatctcgcgc 1140

tttgaagtgt ggccgtacat ggaaacgttc attgaagatg ttgcaaaaga aatctcagcg 1200

gaactgcagg ccaaaccgga cctgattatc ggcaactata gcgaaggtaa tctggcggcc 1260

tctctgctgg cccataaact gggcgtgacc caatgtacga ttgcacacgc tctggaaaaa 1320

accaaatatc cggattcgga catctactgg aaaaaattcg atgaaaaata ccatttcagc 1380

tctcagttca ccgcagatct gattgctatg aaccacacgg actttattat caccagtacg 1440

ttccaggaaa tcgcgggctc caaagatacc gtgggtcaat acgaaagtca tatggccttt 1500

acgatgccgg gcctgtatcg cgtggttcac ggtatcaacg ttttcgatcc gaaattcaac 1560

attgtctccc cgggtgcaga catcaatctg tatttttcat actcggaaac cgaaaaacgt 1620

ctgacggctt tccatccgga aatcgatgaa ctgctgtata gcgatgtgga aaacgacgaa 1680

cacctgtgcg ttctgaaaga tcgcaccaaa ccgattctgt ttacgatggc gcgtctggac 1740

cgcgttaaaa atctgaccgg cctggtcgaa tggtacgcca aaaacccgcg tctgcgcggt 1800

ctggtgaatc tggtcgtggt tggcggtgat cgtcgcaaag aatctaaaga cctggaagaa 1860

caggcggaaa tgaagaaaat gtacgaactg atcgaaaccc ataacctgaa tggccagttc 1920

cgttggatca gttcccaaat gaaccgtgtt cgcaatggcg aactgtatcg ctacatcgca 1980

gatacgaaag gtgcttttgt ccagccggcg ttttacgaag ccttcggcct gaccgtcgtg 2040

gaagcgatga cgtgcggtct gccgaccttc gcaacgaatc atggcggccc ggcagaaatt 2100

atcgttcacg gcaaaagtgg ttttcatatt gatccgtatc acggcgaaca ggcagctgat 2160

ctgctggccg actttttcga aaaatgtaaa aaagacccgt cacattggga aaccatttcg 2220

atgggcggtc tgaaacgcat cgaagaaaaa tatacctggc aaatttacag cgaatctctg 2280

ctgacgctgg cggccgtgta cggtttctgg aaacacgttt ctaaactgga tcgtctggaa 2340

attcgtcgct atctggaaat gttttatgcg ctgaaatacc gcaaaatggc ggaagccgtg 2400

ccgctggcag ctgaataa 2418

<210> 3

<211> 442

<212> PRT

<213>Artificial sequence

<400> 3

Met Ala Thr Asn Leu Arg Val Leu Met Phe Pro Trp Leu Ala Tyr Gly

1 5 10 15

His Ile Ser Pro Phe Leu Asn Ile Ala Lys Gln Leu Ala Asp Arg Gly

20 25 30

Phe Leu Ile Tyr Leu Cys Ser Thr Arg Ile Asn Leu Glu Ser Ile Ile

35 40 45

Lys Lys Ile Pro Glu Lys Tyr Ala Asp Ser Ile His Leu Ile Glu Leu

50 55 60

Gln Leu Pro Glu Leu Pro Glu Leu Pro Pro His Tyr His Thr Thr Asn

65 70 75 80

Gly Leu Pro Pro His Leu Asn Pro Thr Leu His Lys Ala Leu Lys Met

85 90 95

Ser Lys Pro Asn Phe Ser Arg Ile Leu Gln Asn Leu Lys Pro Asp Leu

100 105 110

Leu Ile Tyr Asp Val Leu Gln Pro Trp Ala Glu His Val Ala Asn Glu

115 120 125

Gln Asn Ile Pro Ala Gly Lys Leu Leu Thr Ser Cys Ala Ala Val Phe

130 135 140

Ser Tyr Phe Phe Ser Phe Arg Lys Asn Pro Gly Val Glu Phe Pro Phe

145 150 155 160

Pro Ala Ile His Leu Pro Glu Val Glu Lys Val Lys Ile Arg Glu Ile

165 170 175

Leu Ala Lys Glu Pro Glu Glu Gly Gly Arg Leu Asp Glu Gly Asn Lys

180 185 190

Gln Met Met Leu Met Cys Thr Ser Arg Thr Ile Glu Ala Lys Tyr Ile

195 200 205

Asp Tyr Cys Thr Glu Leu Cys Asn Trp Lys Val Val Pro Val Gly Pro

210 215 220

Pro Phe Gln Asp Leu Ile Thr Asn Asp Ala Asp Asn Lys Glu Leu Ile

225 230 235 240

Asp Trp Leu Gly Thr Lys His Glu Asn Ser Thr Val Phe Val Ser Phe

245 250 255

Gly Ser Glu Tyr Phe Leu Ser Lys Glu Asp Met Glu Glu Val Ala Phe

260 265 270

Ala Leu Glu Leu Ser Asn Val Asn Phe Ile Trp Val Ala Arg Phe Pro

275 280 285

Lys Gly Glu Glu Arg Asn Leu Glu Asp Ala Leu Pro Lys Gly Phe Leu

290 295 300

Glu Arg Ile Gly Glu Arg Gly Arg Val Leu Asp Lys Phe Ala Pro Gln

305 310 315 320

Pro Arg Ile Leu Asn His Pro Ser Thr Gly Gly Phe Ile Ser His Cys

325 330 335

Gly Trp Asn Ser Ala Met Glu Ser Ile Asp Phe Gly Val Pro Ile Ile

340 345 350

Ala Met Pro Ile His Asn Asp Gln Pro Ile Asn Ala Lys Leu Met Val

355 360 365

Glu Leu Gly Val Ala Val Glu Ile Val Arg Asp Asp Asp Gly Lys Ile

370 375 380

His Arg Gly Glu Ile Ala Glu Thr Leu Lys Ser Val Val Thr Gly Glu

385 390 395 400

Thr Gly Glu Ile Leu Arg Ala Lys Val Arg Glu Ile Ser Lys Asn Leu

405 410 415

Lys Ser Ile Arg Asp Glu Glu Met Asp Ala Val Ala Glu Glu Leu Ile

420 425 430

Gln Leu Cys Arg Asn Ser Asn Lys Ser Lys

435 440

<210> 4

<211> 805

<212> PRT

<213>Artificial sequence

<400> 4

Met Ala Glu Arg Val Leu Thr Arg Val His Ser Leu Arg Glu Arg Val

1 5 10 15

Asp Ala Thr Leu Ala Ala His Arg Asn Glu Ile Leu Leu Phe Leu Ser

20 25 30

Arg Ile Glu Ser His Gly Lys Gly Ile Leu Lys Pro His Glu Leu Leu

35 40 45

Ala Glu Phe Asp Ala Ile Arg Gln Asp Asp Lys Asn Lys Leu Asn Glu

50 55 60

His Ala Phe Glu Glu Leu Leu Lys Ser Thr Gln Glu Ala Ile Val Leu

65 70 75 80

Pro Pro Trp Val Ala Leu Ala Ile Arg Leu Arg Pro Gly Val Trp Glu

85 90 95

Tyr Ile Arg Val Asn Val Asn Ala Leu Val Val Glu Glu Leu Ser Val

100 105 110

Pro Glu Tyr Leu Gln Phe Lys Glu Glu Leu Val Asp Gly Ala Ser Asn

115 120 125

Gly Asn Phe Val Leu Glu Leu Asp Phe Glu Pro Phe Thr Ala Ser Phe

130 135 140

Pro Lys Pro Thr Leu Thr Lys Ser Ile Gly Asn Gly Val Glu Phe Leu

145 150 155 160

Asn Arg His Leu Ser Ala Lys Met Phe His Asp Lys Glu Ser Met Thr

165 170 175

Pro Leu Leu Glu Phe Leu Arg Ala His His Tyr Lys Gly Lys Thr Met

180 185 190

Met Leu Asn Asp Arg Ile Gln Asn Ser Asn Thr Leu Gln Asn Val Leu

195 200 205

Arg Lys Ala Glu Glu Tyr Leu Ile Met Leu Pro Pro Glu Thr Pro Tyr

210 215 220

Phe Glu Phe Glu His Lys Phe Gln Glu Ile Gly Leu Glu Lys Gly Trp

225 230 235 240

Gly Asp Thr Ala Glu Arg Val Leu Glu Met Val Cys Met Leu Leu Asp

245 250 255

Leu Leu Glu Ala Pro Asp Ser Cys Thr Leu Glu Lys Phe Leu Gly Arg

260 265 270

Ile Pro Met Val Phe Asn Val Val Ile Leu Ser Pro His Gly Tyr Phe

275 280 285

Ala Gln Glu Asn Val Leu Gly Tyr Pro Asp Thr Gly Gly Gln Val Val

290 295 300

Tyr Ile Leu Asp Gln Val Pro Ala Leu Glu Arg Glu Met Leu Lys Arg

305 310 315 320

Ile Lys Glu Gln Gly Leu Asp Ile Ile Pro Arg Ile Leu Ile Val Thr

325 330 335

Arg Leu Leu Pro Asp Ala Val Gly Thr Thr Cys Gly Gln Arg Ile Glu

340 345 350

Lys Val Tyr Gly Ala Glu His Ser His Ile Leu Arg Val Pro Phe Arg

355 360 365

Thr Glu Lys Gly Ile Val Arg Lys Trp Ile Ser Arg Phe Glu Val Trp

370 375 380

Pro Tyr Met Glu Thr Phe Ile Glu Asp Val Ala Lys Glu Ile Ser Ala

385 390 395 400

Glu Leu Gln Ala Lys Pro Asp Leu Ile Ile Gly Asn Tyr Ser Glu Gly

405 410 415

Asn Leu Ala Ala Ser Leu Leu Ala His Lys Leu Gly Val Thr Gln Cys

420 425 430

Thr Ile Ala His Ala Leu Glu Lys Thr Lys Tyr Pro Asp Ser Asp Ile

435 440 445

Tyr Trp Lys Lys Phe Asp Glu Lys Tyr His Phe Ser Ser Gln Phe Thr

450 455 460

Ala Asp Leu Ile Ala Met Asn His Thr Asp Phe Ile Ile Thr Ser Thr

465 470 475 480

Phe Gln Glu Ile Ala Gly Ser Lys Asp Thr Val Gly Gln Tyr Glu Ser

485 490 495

His Met Ala Phe Thr Met Pro Gly Leu Tyr Arg Val Val His Gly Ile

500 505 510

Asn Val Phe Asp Pro Lys Phe Asn Ile Val Ser Pro Gly Ala Asp Ile

515 520 525

Asn Leu Tyr Phe Ser Tyr Ser Glu Thr Glu Lys Arg Leu Thr Ala Phe

530 535 540

His Pro Glu Ile Asp Glu Leu Leu Tyr Ser Asp Val Glu Asn Asp Glu

545 550 555 560

His Leu Cys Val Leu Lys Asp Arg Thr Lys Pro Ile Leu Phe Thr Met

565 570 575

Ala Arg Leu Asp Arg Val Lys Asn Leu Thr Gly Leu Val Glu Trp Tyr

580 585 590

Ala Lys Asn Pro Arg Leu Arg Gly Leu Val Asn Leu Val Val Val Gly

595 600 605

Gly Asp Arg Arg Lys Glu Ser Lys Asp Leu Glu Glu Gln Ala Glu Met

610 615 620

Lys Lys Met Tyr Glu Leu Ile Glu Thr His Asn Leu Asn Gly Gln Phe

625 630 635 640

Arg Trp Ile Ser Ser Gln Met Asn Arg Val Arg Asn Gly Glu Leu Tyr

645 650 655

Arg Tyr Ile Ala Asp Thr Lys Gly Ala Phe Val Gln Pro Ala Phe Tyr

660 665 670

Glu Ala Phe Gly Leu Thr Val Val Glu Ala Met Thr Cys Gly Leu Pro

675 680 685

Thr Phe Ala Thr Asn His Gly Gly Pro Ala Glu Ile Ile Val His Gly

690 695 700

Lys Ser Gly Phe His Ile Asp Pro Tyr His Gly Glu Gln Ala Ala Asp

705 710 715 720

Leu Leu Ala Asp Phe Phe Glu Lys Cys Lys Lys Asp Pro Ser His Trp

725 730 735

Glu Thr Ile Ser Met Gly Gly Leu Lys Arg Ile Glu Glu Lys Tyr Thr

740 745 750

Trp Gln Ile Tyr Ser Glu Ser Leu Leu Thr Leu Ala Ala Val Tyr Gly

755 760 765

Phe Trp Lys His Val Ser Lys Leu Asp Arg Leu Glu Ile Arg Arg Tyr

770 775 780

Leu Glu Met Phe Tyr Ala Leu Lys Tyr Arg Lys Met Ala Glu Ala Val

785 790 795 800

Pro Leu Ala Ala Glu

805

<210> 5

<211> 28

<212> DNA

<213>Artificial sequence

<400> 5

gggaattcca tatggcgacc aacctgcg 28

<210> 6

<211> 34

<212> DNA

<213>Artificial sequence

<400> 6

ccgctcgagt tagtggtgat gatggtgatg tttg 34

<210> 7

<211> 39

<212> DNA

<213>Artificial sequence

<400> 7

taataaggag atataccatg gccgaacgtg tcctgaccc 39

<210> 8

<211> 38

<212> DNA

<213>Artificial sequence

<400> 8

aggcgcgccg agctcgaatt cttattcagc tgccagcg 38

<210> 9

<211> 21

<212> DNA

<213>Artificial sequence

<400> 9

catgccatgg ccgaacgtgt c 21

<210> 10

<211> 26

<212> DNA

<213>Artificial sequence

<400> 10

ccggaattct tattcagctg ccagcg 26

<210> 11

<211> 35

<212> DNA

<213>Artificial sequence

<400> 11

aaggaaaaaa gcggccgcta tggcgaccaa cctgc 35

<210> 12

<211> 34

<212> DNA

<213>Artificial sequence

<400> 12

ccggaattcg tggtgatgat ggtgatgttt gctc 34

Claims (10)

1. one plant of recombinant bacterium, it is characterised in that originated glycosyl transferase UGTSL2 genes containing tomato simultaneously in the recombinant bacterium With potato source sucrose synthase StSUS1 genes, the tomato source glycosyl transferase UGTSL2 gene orders such as SEQ.NO.1 Shown, the potato originates sucrose synthase StSUS1 gene orders as shown in SEQ.NO.2.

2. the construction method of recombinant bacterium described in claim 1, it is characterised in that tomato is originated glycosyl transferase UGTSL2 genes It is cloned between NdeI the and XhoI sites of pRSFDuet-1, structure obtains recombinant plasmid pRSFDuet-SL2, then again by horse Bell potato originates sucrose synthase StSUS1 gene clonings between NcoI the and EcoRI sites of pRSFDuet-SL2, and structure obtains weight Group plasmid pRSFDuet-SL2-SUS1, recombinant plasmid pRSFDuet-SL2-SUS1 is transformed into host cell, is recombinated Bacterium.

3. application of the recombinant bacterium described in claim 1 in catalysis content rebaudioside-A generation rebaudioside D.

4. application according to claim 3, it is characterised in that will take crude enzyme liquid after recombinant bacterium induced expression, is added to anti- Answering catalysis content rebaudioside-A generation rebaudioside D in mixture, the reactant mixture includes content rebaudioside-A, sucrose and phosphoric acid Sodium buffer solution.

5. application according to claim 4, it is characterised in that the induced expression condition of the recombinant bacterium is：By recombinant bacterium It is inoculated into LB culture mediums, in 20 ~ 37 DEG C, 250rpm shaken cultivation 8h, then culture bacterium solution is accessed into induction training by 2% inoculum concentration Support in base, in 200rpm, 20 ~ 37 DEG C of culture 2h treat OD₆₀₀Turn 25 DEG C of Fiber differentiation 22h when reaching 0.2 or so, be collected by centrifugation Thalline.

6. application according to claim 4, it is characterised in that in the reactant mixture content rebaudioside-A concentration be 4 ~ 10g/L, sucrose concentration is 30 ~ 50g/L, and crude enzyme liquid concentration is 2 ~ 10g/L, and it is 6.4 ~ 8 to use sodium phosphate buffer to adjust pH.

7. application according to claim 4, it is characterised in that the reaction temperature is 20 ~ 55 DEG C, the reaction time is 2 ~ 25 h。

8. application according to claim 5, it is characterised in that the LB culture medium prescriptions are 0.5g/L dusty yeasts, 0.5g/ L sodium chloride, 1g/L tryptones, 0.05g/L cards receive mycin.

9. application according to claim 5, it is characterised in that the Fiber differentiation based formulas are 25g/L dusty yeasts, 15g/ L tryptones, 10g/L sodium chloride, 2g/L glucose, 0.05 ~ 0.2g/L lactose.

10. application according to claim 6, it is characterised in that content rebaudioside-A concentration is 10g/ in the reactant mixture L, sucrose concentration is 30g/L, and crude enzyme liquid concentration is 8g/L, and it is 7.2 to use sodium phosphate buffer to adjust pH.